CN110923299A - Primer, probe and kit for rapid quantitative detection of AR-V7 fluorescent qRT-PCR method - Google Patents
Primer, probe and kit for rapid quantitative detection of AR-V7 fluorescent qRT-PCR method Download PDFInfo
- Publication number
- CN110923299A CN110923299A CN202010085567.9A CN202010085567A CN110923299A CN 110923299 A CN110923299 A CN 110923299A CN 202010085567 A CN202010085567 A CN 202010085567A CN 110923299 A CN110923299 A CN 110923299A
- Authority
- CN
- China
- Prior art keywords
- final concentration
- kit
- probe
- primer
- exosome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer and a probe for detecting AR-V7 and AR, and provides a kit for detecting AR-V7 and AR based on the primer and the probe. The kit comprises an exosome extraction reagent, an exosome nucleic acid extraction reagent and a qRT-PCR detection reagent of AR-V7. The kit has the advantages of wide sample source, easy acquisition, high preparation success rate of exosomes, short required operation time and low operation error because the exosome nucleic acid is extracted automatically. Meanwhile, the one-step method qRT-PCR reagent provided by the invention simplifies the operation process, shortens the experiment period, improves the efficiency and also reduces the risk of sample pollution or detection error in the intermediate process.
Description
Technical Field
The invention relates to a molecular biology detection technology, in particular to a primer, a probe and a kit for rapid quantitative detection of a human AR-V7 fluorescence qRT-PCR method.
Background
Prostate cancer is a common malignancy and is the second leading cause of tumor death in men. In recent years, the incidence of prostate cancer in China is on a rapid rise year by year trend, 5.8/10 ten thousand people in 2004, and 8/10 ten thousand people in 2009. Because the screening work of people susceptible to the prostate cancer in China is relatively laggard, the advanced prostate cancer accounts for about 70% of the initially diagnosed prostate cancer, and the proportion of the advanced prostate cancer in the initial diagnosis in China is far higher than that in European and American countries (20-30%). Androgen Deprivation Therapy (ADT) is the leading treatment for these prostate cancer patients. Although prostate cancer is controlled to varying degrees at the beginning of ADT treatment, most patients gradually and irreversibly develop castration-resistant prostate cancer (CRPC) after a period of treatment.
The existing medicines abiraterone and anthraglutamine have good effects on the treatment of CRPC patients, but 20% -40% of patients PSA is maintained at a high level, but no obvious curative effect is achieved, and most of patients treated by abiraterone and anthraglutamine have acquired drug resistance in the later period. With regard to the mechanism of abiraterone and anthryl-hybrid-luramine resistance, literature data show that the abnormality of androgen receptor signaling pathway belongs to one of the possible mechanisms of resistance occurrence, wherein the generation of splicing isomer of androgen receptor and AR-V7 are more truncated forms of splicing isomer studied by Androgen Receptor (AR), and AR-V7 can continuously activate downstream signaling pathway without depending on androgen binding due to lack of ligand binding region, thereby causing abnormal cell proliferation. Further studies also showed that AR-V7 positive is significantly inversely correlated with PSA response and survival in patients with CRPC treated with abiraterone and anthraluramine. Therefore, the detection of AR-V7 is of great significance in characterizing the therapeutic effect of CRPC patients.
Regarding the detection of AR-V7, the only product currently available in the market for scientific research services is Adna Test State Cancer Panel manufactured by Qiagen corporation, and the general procedure of the detection is as follows: the method comprises the steps of firstly capturing Circulating Tumor Cells (CTC) of a patient by a magnetic bead method, then carrying out mRNA separation and extraction and reverse transcription, and finally completing AR-V7 detection by a qRT-PCR method.
The detection of subsequent AR-V7 using CTCs currently has many problems, including the following, one of which is that it requires a high freshness of the whole blood sample, and the sample must be collected within hours to complete the separation of CTCs; secondly, the heterogeneity of tumor cells is high, so that the separation of CTC can only be achieved by obtaining part of tumor cells, and the disease state of a patient cannot be comprehensively reflected; thirdly, the number of CTCs in the circulation is small, and 5mL of whole blood may have only 6-7 CTCs isolated, or even none isolated. Therefore, the development of an effective, rapid and sensitive detection kit for AR-V7 is urgently needed.
Disclosure of Invention
Based on the method, the exosome in the plasma or human urine is extracted, the nucleic acid in the exosome is extracted, and then the extracted exosome RNA is subjected to AR-V7 and AR detection by using one-step RT-PCR.
The invention discloses a primer for detecting AR-V7 and AR, which comprises the following components:
AR-V7 forward primer: CAGGGATGACTCTGGGAGAAA
AR-V7 reverse primer: AGTCAGCCTTTCTTCAGGGTC
AR forward primer: TGCTCAAGACGCTTCTACCAG
AR reverse primer: AGTGAACTGATGCAGCTCTC are provided.
The second aspect of the invention discloses a primer and a probe for detecting AR-V7 and AR, wherein the primer and the probe are respectively as follows:
AR-V7 forward primer: CAGGGATGACTCTGGGAGAAA
AR-V7 reverse primer: AGTCAGCCTTTCTTCAGGGTC
AR forward primer: TGCTCAAGACGCTTCTACCAG
AR reverse primer: AGTGAACTGATGCAGCTCTC
AR-V7 probe: AGCAGGGATGACTCT
An AR probe: TTCTACCAGCTCACCA are provided.
Preferably, the probe comprises a fluorophore.
The third aspect of the invention discloses a kit for detecting AR-V7 and AR, which contains the primer and the probe of the invention;
preferably, the kit comprises: an exosome extraction reagent, an exosome nucleic acid extraction reagent and a qRT-PCR detection reagent of AR-V7.
Preferably, the exosome-extracting agent comprises:
1) a suspension of magnetic beads comprising: 0.1-5 mg/mL of carboxyl magnetic beads coated by one or two or three antibodies selected from CD63, CD81 or CD 9;
2) a washing solution comprising: 0.01M phosphate buffer containing 0.005-0.05 mg/mL bovine serum albumin;
3) an eluent, comprising: 0.01M phosphate buffer.
Preferably, the exosome nucleic acid extracting agent comprises:
1) the solution I comprises guanidine isothiocyanate with the final concentration of 1-5 mol/L, sodium citrate with the final concentration of 5-10 mmol/L, Polidocanol with the final concentration of 0.01-1 g/ml, ethanol with the volume percentage of 5-45% and β -mercaptoethanol with the final concentration of 0.5-5 mmol/L.
2) The solution II comprises protease K with the final concentration of 1-50 mg/mL, Tris-HCl with the final concentration of 10-50 mmol/L, PolyA with the final concentration of 0.01-1 mg/mL and CaCl2 with the final concentration of 10-20 mmol/L;
3) the solution III comprises silicon hydroxyl magnetic beads with the final concentration of 1-30 mg/mL and the diameter of 300nm and glycerol with the volume percentage of 10-50%;
4) washing liquid A, comprising: guanidinium isothiocyanate with the final concentration of 0.1-5 mol/L, Tris-HCl with the final concentration of 50-100 mmol/L, Tween-20 with the volume percentage concentration of 0.5-5 percent and ethanol with the volume percentage concentration of 30-80 percent;
5) washing liquid B, comprising: the final concentration is 0.1-5 mol/L NaCl, and 1-20 mmol/L Tris-HCl;
6) washing liquid C, comprising: Tris-HCl with the final concentration of 5-20 mmol/L and ethanol with the volume percentage concentration of 70-80%;
7) an eluent, comprising: Tris-HCl (pH 8.5) at a final concentration of 5-20 mmol/L.
Preferably, the sum of the final concentrations of the primers in the qRT-PCR detection reagent for AR-V7 is between 100 and 900 nM, and the sum of the final concentrations of the probes is between 25 and 500 nM.
Preferably, in the qRT-PCR detection reagent for AR-V7, the 5' ends of the AR probe and the AR-V7 probe are provided with a fluorescent group, and the fluorescent group comprises: VIC, FAM, ROX or HEX; the 3' ends of the AR probe and the AR-V7 probe are provided with quenching groups, and the quenching groups comprise: MGB or BHQ 1.
Preferably, the PCR reaction solution in the qRT-PCR detection reagent for AR-V7 comprises:
reaction solution A, comprising: 0.1 to 50mM dATP, 0.1 to 50mM dCTP, 0.1 to 50mM dGTP, 0.1 to 100 mM dUTP, 1 to 500 mM MgCl 2; and
reaction solution B, comprising: 1-1000U of reverse transcriptase, 1-500U of RNase inhibitor, 1-500U of hot start DNA polymerase, 0.1-100U of heat-sensitive UDG enzyme and 1-50% of BSA solution.
Preferably, the qRT-PCR detection reagent for AR-V7 further comprises an internal control comprising porcine plasma, or plasma of other non-human species.
Preferably, the qRT-PCR detection reagent for AR-V7 further comprises a standard substance, wherein the standard substance comprises an RNA diluent of an AR-V7 positive cell line 22RV1, and the concentration of the RNA diluent is in the range of 0.01-1000 ng/muL.
Preferably, the qRT-PCR method of AR-V7 is a one-step method.
Preferably, the sample source for AR-V7 detection is human plasma or human urine.
Preferably, the kit is used for comprising quality control products, and the positive quality control products used in the quality control comprise: 0.01-1 ng/. mu.L of RNA of AR-V7 positive cell line 22RV 1; the negative quality control material used for quality control comprises: 10-100 ng/. mu.L RNA of AR-V7 negative cell line DU 145.
The primer and the probe of AR-V7 and AR provided by the invention have the following advantages: the length of the amplified fragment of the primer pair is relatively short, so the problem that the long fragment is difficult to amplify due to RNA fragmentation in exosomes can be solved by using the primer provided by the invention.
The internal control provided by the invention is exogenous porcine plasma, and the exosome contained in the internal control can be prepared together with the extraction of the exosome of human plasma or human urine, so that the quality control of the exosome extraction can be realized, and the internal control can also be used as the quality control of the whole process.
The AR-V7 detection kit provided by the invention has the advantages of wide sample source, easiness in obtaining and high preparation success rate of exosomes. The exosome nucleic acid is extracted automatically, the required operation time is short, the operation error is low, and the repeatability of the detection result is better. Meanwhile, the reagent for one-step method qRT-PCR provided by the invention realizes the direct output of the detection result from RNA input to AR-V7, greatly simplifies the operation process, shortens the experiment period, improves the efficiency, and reduces the risk of pollution or error in the intermediate process. The AR-V7 detection kit provided by the invention comprises a quantitative standard substance, and can verify that the detection result of AR-V7 is reliable in measurement.
Drawings
FIG. 1 is a graph showing the results of amplification of different primer pairs of AR-V7;
FIG. 2 is a graph showing the amplification results of different primer pairs for AR;
FIG. 3 is a comparative 2100 assay of exosome RNA extracted by TRIzol method and an exosome nucleic acid automated extraction reagent provided in the present invention;
FIG. 4 is a negative and positive quality control inspection chart of the present invention;
FIG. 5 is a detection chart of the quantitative standards of the present invention;
FIG. 6 is a detection map of clinical specimen AR-V7 of the present invention;
FIG. 7 is an AR-FL detection map of a clinical specimen of the present invention;
FIG. 8 is a GAPDH assay of a control pig according to the invention;
FIG. 9 is a negative and positive quality control inspection chart of the present invention;
FIG. 10 is a detection map of a quantitative standard of the present invention;
FIG. 11 is an AR-V7 test chart of clinical plasma and urine samples according to the present invention;
FIG. 12 is an AR-FL assay of a clinical plasma sample and a urine sample according to the present invention;
figure 13 is a graph of the detection of GAPDH in clinical plasma samples and control pigs in urine samples according to the invention.
Detailed Description
The present invention will be described in further detail with reference to specific examples, but the embodiments of the present invention are not limited thereto.
Example 1 exosome extraction
Materials: plasma samples were collected in 8 EDTA tubes and exosome preparation was performed using exosome-automated extraction reagents.
The experimental steps are as follows:
1. plasma sample pretreatment
Taking a plasma sample of 16.000 g, centrifuging at 4 ℃ for 10 min, and taking 1 mL of supernatant for later use;
2. the formula of the exosome automatic extraction reagent is as follows:
(1) a magnetic bead suspension, mainly carboxyl magnetic beads coated with 1mg/mL CD63 antibody;
(2) washing solution, mainly 0.02 mg/mL bovine serum albumin in 0.01M phosphate buffer;
(3) eluent mainly 0.01M phosphate buffer solution;
3. the parameter setting of the exosome automatic extraction device is as follows:
4. the specific operation flow is as follows:
(1) taking a 96-hole deep-hole plate, adding 1 mL of plasma of 8 samples into the No. 1 hole in sequence, and adding 100 mu L of pig plasma into each of the 8 samples;
(2) adding magnetic bead suspension into the No. 2 hole sites, wherein 200 mu L of each magnetic bead suspension is added;
(3) adding washing solution into No. 3 hole sites, 1000 mu L of each washing solution;
(4) washing solution is added into the No. 4 hole site, and each washing solution is 1000 mu L;
(5) eluent is added into the No. 5 hole site, and each 100 mu L of eluent is added;
5. putting the 96-hole deep-hole plate after sample adding into an instrument, and operating the instrument;
6. the instrument was run with 100. mu.L of phosphate buffer containing exosomes and magnetic beads.
Example 2 exosome nucleic acid extraction
Materials: preparing exosome RNA by taking 100 mu L of phosphate buffer solution containing exosomes and magnetic beads prepared in the embodiment 1, using the exosome nucleic acid extraction reagent and using an automatic nucleic acid purifier;
the experimental process comprises the following steps:
the exosome nucleic acid extraction reagent provided by the invention adopts a KY-32A automatic nucleic acid extraction workstation of Kanghe organisms to extract exosome RNA, and the reagent adding method comprises the following steps:
to 8 wells in column 1 of the 96-well plate, 10. mu.L of the exosome suspension, 800. mu.L of solution I, and 10. mu.L of solution II were added, respectively. Add 40. mu.L of solution III to 8 wells in column 2, 300. mu.L of Wash A to 8 wells in column 3, 400. mu.L of Wash B to 8 wells in column 4, 500. mu.L of Wash C to 8 wells in column 5, and 50. mu.L of eluent to 8 wells in column 6. A new magnetic sleeve is placed in column 1.
In the provided exosome nucleic acid extraction reagent, a solution I comprises guanidinium isothiocyanate with a final concentration of 3 mol/L, sodium citrate with a final concentration of 7 mmol/L, Polidocanol with a concentration of 0.08 g/mL, ethanol with a volume percentage of 10%, β -mercaptoethanol with a final concentration of 1 mmol/L, a solution II comprises Proteinase K with a final concentration of 15 mg/mL, Tris-HCl with a final concentration of 30 mmol/L, PolyA with a final concentration of 0.1 mg/mL, CaCl2 with a final concentration of 20mmol/L, a solution III comprises silicon hydroxyl magnetic bead with a final concentration of 15 mg/mL, glycerol with a volume percentage of 20%, a washing solution A comprises guanidinium isothiocyanate with a final concentration of 2 mol/L, Tris-HCl with a final concentration of 70mmol/L, Tween-20 with a volume percentage concentration of 3%, ethanol with a volume percentage of 50%, a washing solution B comprises NaCl with a final concentration of 2 mol/L, a washing solution with a final concentration of 5mmol/L, Tris-HCl with a final concentration of 10% and an eluent with a final concentration of 10% HCl (HCl), wherein Tris-HCl with a volume percentage of 75: 10: 10.8).
After the start of the running program, the automation is as follows
(1) Firstly, uniformly mixing and cracking the magnetic sleeve in the 1 st column for 5 min;
(2) transferring the magnetic beads in the 2 nd column to the 1 st column by the magnetic bar, uniformly mixing, cracking and adsorbing for 10 min;
(3) magnetic beads in the 1 st column are taken by the magnetic rod and are respectively and sequentially transferred to the 3 rd, 4 th and 5 th columns for washing;
(4) transferring the 5 th column of magnetic beads from the magnetic bar to the 6 th column of magnetic beads for washing RNA products;
the instrument run resulted in 60 μ L EB buffer containing exosome RNA.
Example 3 screening and optimization of AR-V7 primer pairs and AR primer pairs
The invention discloses a primer sequence for detecting AR-V7 and AR as follows:
AR-V7 forward primer: CAGGGATGACTCTGGGAGAAA, respectively;
AR-V7 reverse primer: AGTCAGCCTTTCTTCAGGGTC, respectively;
AR forward primer: TGCTCAAGACGCTTCTACCAG, respectively;
AR reverse primer: AGTGAACTGATGCAGCTCTC, respectively;
the primer sequences for detecting AR-V7 and AR reported in the literature (AR-V7 and resistance to enzalutamide and abiraterone in prostatecancer. N Engl J Med 2014;371: 1028-38) are as follows:
AR-FL forward primer: CAGCCTATTGCGAGAGAGCTG, respectively;
AR-FL reverse primer: GAAAGGATCTTGGGCACTTGC, respectively;
AR-V7 forward primer: CCATCTTGTCGTCTTCGGAAATGTTA, respectively;
AR-V7 reverse primer: TTTGAATGAGGCAAGTCAGCCTTTCT, respectively;
comparative testing of primer pairs was performed using ultracentrifugation 22RV1 cell culture supernatant exosome RNA.
The experimental steps are as follows:
1. preparing a culture supernatant exosome of human prostate cells (22 RV 1) by an ultra-high-speed centrifugation method;
taking 180 mL of 22RV1 cell culture supernatant, dividing the supernatant into 6 tubes, centrifuging the tubes at 120,000 g and 4 ℃ for 2 h; removing supernatant, and resuspending each tube with 100 μ L PBS to obtain resuspension, namely 22RV1 cell culture supernatant exosome;
2.22 RV1 cell culture supernatant exosome RNA extraction;
preparing exosome RNA by using miRNeasy Micro Kit (QIAGEN) in one tube of prepared exosome of 22RV1 cell culture supernatant;
3. detection of exosome RNA of 22RV1 cell culture supernatant by adopting one-step RT-PCR (reverse transcription-polymerase chain reaction) with different primer pairs
Template: 6 mu L of exosome RNA of 22RV1 cell culture supernatant;
the concentration configuration of the primer pair disclosed by the invention and the concentration configuration of the primer pair reported by the literature are both 10 mu M;
one-step qRT-PCR refers to a classical method for analyzing RNA structure by directly performing reverse transcription of RNA into cDNA by the fusion of reverse transcriptase and taq polymerase and then directly completing amplification.
One-step method reagent: one step RT-PCR kit (SYBR Green) Kangh Biotech Co., Ltd, the sample well reaction system was configured as follows:
the reaction process is as follows:
4. quantitative detection is carried out by using QuantStaudio 3;
5. the detection results are shown in FIG. 1 and FIG. 2, wherein the amplification efficiency of the AR-V7 primer pair and the AR primer pair is higher.
Example 4 verification of the comparative effect of the TRIzol method and the exosome RNA extraction method provided by the present invention on exosome RNA extraction.
A comparison test is designed to compare the yield of the exosome RNA extracted by the traditional TRIzol method on the market with the exosome nucleic acid automatic extraction reagent provided by the invention, the harm of the extraction process to personnel and environment, the automation of the operation process and the like.
The experimental steps are as follows:
1. taking exosomes obtained by a precipitation method, dividing into 10 parts, and respectively taking 100 mu L of exosomes; two groups of 5 parts were randomized. According to the invention, 5 parts of RNA are respectively extracted by providing an exosome nucleic acid automatic extraction reagent and a traditional TRIzol method.
2. The invention provides an automatic extraction reagent extraction operation method of exosome nucleic acid, which comprises the following steps:
1) transferring the exosome suspension obtained by the precipitation method into a 1.5 mL centrifuge tube, adding 800 mu L of solution I and 10 mu L of solution II, shaking and uniformly mixing, and standing at room temperature for 5 min;
wherein the solution I comprises guanidine isothiocyanate with the final concentration of 3 mol/L, sodium citrate with the final concentration of 7 mmol/L, Polidocanol with the concentration of 0.08 g/ml, ethanol with the volume percentage of 10 percent and β -mercaptoethanol with the final concentration of 1 mmol/L;
solution II included Proteinase K at a final concentration of 15 mg/mL, Tris-HCl at a final concentration of 30 mmol/L, PolyA at a final concentration of 0.1 mg/mL, CaCl2 at a final concentration of 20 mmol/L.
2) Adding 40 μ L of solution III, mixing, and standing at room temperature for 10 min; the solution III comprises silicon hydroxyl magnetic bead magnetic beads with the final concentration of 15 mg/mL and glycerol with the volume percentage of 20 percent;
3) placing the centrifuge tube on a magnetic frame, standing for 1 min to make the solution transparent, and discarding the solution;
4) adding 300 mu L of washing solution A, fully and uniformly mixing, carrying out instantaneous centrifugation for 3s, placing the centrifugal tube on a magnetic frame, standing for 30s to ensure that the solution becomes transparent, and discarding the solution; washing liquid A, comprising: guanidine isothiocyanate with the final concentration of 2 mol/L, Tris-HCl with the final concentration of 70mmol/L, Tween-20 with the volume percentage concentration of 3 percent and ethanol with the volume percentage concentration of 50 percent.
5) Adding 400 mu L of washing liquid B, fully and uniformly mixing, carrying out instantaneous centrifugation for 3s, placing the centrifugal tube on a magnetic frame, standing for 30s to ensure that the solution becomes transparent, and discarding the solution; washing liquid B, comprising: final concentration of 2 mol/L NaCl, final concentration of 5mmol/L Tris-HCl.
6) Adding 500 mu L of washing liquid C, fully and uniformly mixing, carrying out instantaneous centrifugation for 3s, placing the centrifugal tube on a magnetic frame, standing for 30s to ensure that the solution becomes transparent, and discarding the solution; washing liquid C, comprising: Tris-HCL with the final concentration of 10mmol/L and ethanol with the volume percentage concentration of 75 percent. An eluent, comprising: Tris-HCl (pH 8.5) at a final concentration of 10 mmol/L.
7) Centrifuging the centrifuge tube for 5 s instantly, placing on a magnetic frame, standing for 3s to make the solution transparent, and discarding the residual liquid;
8) opening the centrifugal tube cover, standing at room temperature for 3-5 min to volatilize alcohol on the surface of the magnetic beads as much as possible, adding 50 μ L of eluent, fully shaking and mixing uniformly, shaking and incubating at 50 ℃ for 15 min, then using a pipettor to put the solution containing RNA into a new tube, and placing at 4 ℃ for later use.
3. The effect of RNA extraction using the TRIzol one-step RNA extraction kit (cat # 15596-026) from Invitrogen was selected as a control.
1) Adding plasma exosome suspension into TRIzol Reagent 800 μ L, vortex and shake to dissolve white precipitate completely, converting into white powder, and standing at room temperature for 5 min;
2) adding 160 μ L chloroform into each tube of mixed solution, shaking, mixing, standing at room temperature for 3 min;
3) 12000 g of the mixed solution is centrifuged at 4 ℃ for 15 min, the visible mixed solution is divided into three layers, each tube takes supernatant with 1000 mu L of pipettors, the volume is about 500 mu L (without contacting the middle layer), then 750 mu L of absolute ethyl alcohol is respectively added, the mixture is shaken and mixed evenly, and the mixture is placed at room temperature for 5-10 min;
4) centrifuging at 4 ℃ for 10 min at 12000 g, removing supernatant, and obtaining RNA as tube bottom sediment;
5) adding 1 ml of 75% ethanol into the tube, gently shaking, and resuspending the precipitate;
6) centrifuging at 4 deg.C for 5 min at 7500 g, and discarding supernatant as much as possible;
7) centrifuging rapidly, and discarding the supernatant;
8) drying at room temperature for 5-10 min;
9) adding 50 μ L free water, performing metal bath at 65 deg.C for 10 min, taking out to obtain exosome RNA solution, and standing at 4 deg.C for use.
The two methods for extracting RNA yield, harm to human and environment and whether automation can be achieved are summarized as follows, wherein the AR gene in exosomes is detected by measuring RNA yield through Agilent 2100 and RT-PCR amplification. The Agilent 2100 quantification results are shown in FIG. 3, and the results of RT-PCR amplification for detecting the AR gene in exosomes are shown in the following table:
therefore, the direct yield of the RNA extracted by the method is obviously superior to that of the traditional TRIzol RNA extraction method; the invention has simple operation, easy popularization and easy realization of automation.
Similar experimental results can be obtained in other concentration ranges of the components of the exosome nucleic acid extraction reagent, wherein the solution I comprises 1-5 mol/L of guanidinium isothiocyanate, 5-10 mmol/L of sodium citrate, 0.01-1 g/mL of Polidocanol, 5-45% of ethanol by volume, 0.5-5 mmol/L of β -mercaptoethanol by volume, the solution II comprises 1-50 mg/mL of Proteinase K, 10-50 mmol/L of Tris-Hcl, 0.01-1 mg/mL of PolyA, 10-20 mmol/L of CaCl2. solution III, 1-30 mg/mL of silicon hydroxyl magnetic beads with the diameter of 300nm, 10-50% of glycerol by volume, the Tris-A comprises 0.1-5 mol/L of guanidinium isothiocyanate, 50-20 mmol/L of a NaCl, and 10-20% of NaCl, the 1-20% of HCl by volume, the eluent comprises 0.1-5 mmol/L of guanidinium isothiocyanate, the final concentration of 50-20% of NaCl, the eluent comprises 0.5-20% of NaCl, and the eluent comprises 0.5-20% of 10-20% of NaCl by volume, and the 1-20% of the ethanol by volume.
The experimental steps are as follows:
1. the invention provides an exosome nucleic acid automatic extraction reagent which comprises the following components:
solution I comprising guanidine isothiocyanate at a final concentration of 3 mol/L, sodium citrate at a final concentration of 7 mmol/L, Polidocanol at a concentration of 0.08 g/mL, 10% by volume ethanol, β -mercaptoethanol at a final concentration of 1 mmol/L solution II comprising Proteinase K at a final concentration of 15 mg/mL, Tris-HCl at a final concentration of 30 mmol/L, PolyA at a final concentration of 0.1 mg/mL, CaCl2 at a final concentration of 20mmol/L solution III comprising silica-hydroyxgnetic beads at a final concentration of 15 mg/mL, 20% by volume glycerol, Wash A comprising guanidine isothiocyanate at a final concentration of 2 mol/L, Tris-HCl at a final concentration of 70mmol/L, Tween-20 at a final concentration of 3%, ethanol Tris at a final concentration of 50% at a volume, Wash B comprising Tris at a final concentration of 2 mol/L, NaCl at a final concentration of 5 mmol/L-HCl, Wash C comprising Tris at a final concentration of 10% by volume, and Tris at a final concentration of 10% HCl (75.8% by volume).
2. The invention provides an operation method for extracting RNA by an exosome nucleic acid automatic extraction reagent, which comprises the following steps:
1) transferring the exosome weight suspension obtained by the precipitation method into a 1.5 ml centrifuge tube, adding 800 mu L of solution I and 10 mu L of solution II, shaking and uniformly mixing, and standing for 5 min at room temperature;
2) adding 40 μ L of solution III, mixing, and standing at room temperature for 10 min;
3) placing the centrifuge tube on a magnetic frame, standing for 1 min to make the solution transparent, and discarding the solution;
4) adding 300 mu L of washing solution A, fully and uniformly mixing, carrying out instantaneous centrifugation for 3s, placing the centrifugal tube on a magnetic frame, standing for 30s to ensure that the solution becomes transparent, and discarding the solution;
5) adding 400 mu L of washing liquid B, fully and uniformly mixing, carrying out instantaneous centrifugation for 3s, placing the centrifugal tube on a magnetic frame, standing for 30s to ensure that the solution becomes transparent, and discarding the solution;
6) adding 500 mu L of washing liquid C, fully and uniformly mixing, carrying out instantaneous centrifugation for 3s, placing the centrifugal tube on a magnetic frame, standing for 30s to ensure that the solution becomes transparent, and discarding the solution;
7) centrifuging the centrifuge tube for 5 s instantly, placing on a magnetic frame, standing for 3s to make the solution transparent, and discarding the residual liquid;
8) opening the centrifugal tube cover, standing at room temperature for 3-5 min to volatilize alcohol on the surface of the magnetic beads as much as possible, adding 50 μ L of eluent, fully shaking and mixing uniformly, shaking and incubating at 50 ℃ for 15 min, then using a pipettor to put the solution containing RNA into a new tube, and placing at 4 ℃ for later use.
CN 108949747A patent A kit for extracting RNA and an application method thereof are provided, wherein the method comprises the following steps:
exosome RNA extraction was performed as claimed in patent CN 108949747 a.
The yields of RNA extracted by the two methods are summarized in the following table. Where the AR gene in the exosomes was detected by Agilent 2100 measurement of RNA yield and RT-PCR amplification. Since the RNA content in exosomes is low, purity measurements cannot be done, so RNA purity comparisons cannot be made here.
Therefore, under the condition that the exosome nucleic acid automatic extraction reagent provided by the invention does not contain lithium chloride, glycogen and DNAse components, the extracted RNA yield is equal to or even exceeds that in the patent CN 108949747A, and the direct yield is obviously superior to that of the traditional TRIzol RNA extraction method; the invention has simple operation, easy popularization and easy realization of automation.
Similar experimental results can be obtained in other concentration ranges of the components of the exosome nucleic acid extraction reagent, wherein the solution I comprises 1-5 mol/L of guanidinium isothiocyanate, 5-10 mmol/L of sodium citrate, 0.01-1 g/mL of Polidocanol, 5-45% of ethanol by volume, 0.5-5 mmol/L of β -mercaptoethanol by volume, the solution II comprises 1-50 mg/mL of Proteinase K, 10-50 mmol/L of Tris-Hcl, 0.01-1 mg/mL of PolyA, 10-20 mmol/L of CaCl2. solution III, 1-30 mg/mL of silicon hydroxyl magnetic beads with the diameter of 300nm, 10-50% of glycerol by volume, the Tris-A comprises 0.1-5 mol/L of guanidinium isothiocyanate, 50-20 mmol/L of a NaCl, and 10-20% of NaCl, the 1-20% of HCl by volume, the eluent comprises 0.1-5 mmol/L of guanidinium isothiocyanate, the final concentration of 50-20% of NaCl, the eluent comprises 0.5-20% of NaCl, and the eluent comprises 0.5-20% of 10-20% of NaCl by volume, and the 1-20% of the ethanol by volume.
Example 6 detection of exosomes AR-V7
Materials: clinical samples were tested by taking 8 plasma samples from prostate cancer patients and testing for exosome AR-V7.
The experimental process comprises the following steps:
1. preparation of plasma exosomes according to the protocol provided in example 1 of the present invention
2. The preparation of plasma exosome RNA was performed according to the protocol provided in example 2 of the present invention.
3. AR-V7 detection of exosome RNAs:
(1) preparing a primer probe mixed solution:
the configuration concentrations of the AR-V7, the AR upstream and downstream primers and the internal control pig GAPDH upstream and downstream primers (pig GAPDH forward primer sequence ACATGGCCTCCAAGGAGTAAGA; pig GAPDH reverse primer sequence GATCGAGTTGGGGCTGTGACT) are all 10 mu M, the configuration concentrations of the AR-V7 probe, the AR probe and the internal control pig GAPDH probe (CCACCAACCCCAGCAAGAGCACGC) are all 5 mu M, the 5 'end fluorescent group of the AR-V7 probe is marked by FAM, the 3' end quenching group is MGB, the 5 'end fluorescent group of the AR probe is marked by VIC, the 3' end quenching group is MGB, the 5 'end fluorescent group of the internal control pig GAPDH probe is marked by ROX, and the 3' end quenching group is BHQ 1.
2) Preparing a PCR reaction solution:
reaction A, containing 20mM dATP, 20mM dCTP, 20mM dGTP, 20mM dUTP, 5mM MgCl 2;
reaction solution B, comprising: 300U of reverse transcriptase, 10U of RNase inhibitor, 50U of hot start DNA polymerase, 4U of heat sensitive UDG enzyme, 1% BSA solution;
3) the positive quality control substance is 0.05 ng/. mu.L of RNA solution of the cell line 22RV1, and the negative quality control substance is 20 ng/. mu.L of RNA solution of the cell line DU 145;
4) AR-V7 quantitative detection standard mainly comprises RNA diluents of different concentrations of AR-V7 positive cell line 22RV1, wherein the concentrations are 0.01 ng/mu L, 1 ng/mu L, 10 ng/mu L, 100 ng/mu L and 1000 ng/mu L in sequence;
5) and (3) PCR reaction system configuration:
sample well reaction system:
a reaction system of negative and positive quality control products and quantitative detection standard products:
6) quantitative detection is carried out by using QuantStaudio 3;
4. and (3) displaying a detection result:
1) the detection results of the negative and positive quality control products are normal, negative is not detected, positive is obviously amplified, and the detection results are shown in figure 4;
2) the detection result of the quantitative standard is normal, R = 0.996, and the detection result is shown in fig. 5;
3) 2 of the 8 samples were positive for AR-V7 mRNA, and the results are shown in FIG. 6;
4) all AR-FL mRNA in 8 samples were detected positively, and the detection results are shown in FIG. 7;
5) all the internal control pig GAPDH in 8 samples are detected positively, and the detection result is shown in FIG. 8;
the internal control provided by the invention is exogenous porcine plasma, and the exosome contained in the internal control can be prepared together with the extraction of the exosome of human plasma or human urine, so that the quality control of the exosome extraction can be realized, and the internal control can also be used as the quality control of the whole process.
Example 7 consistency comparison of plasma and urine sample AR-V7 assays
Materials: plasma and urine samples of 8 prostate cancer patients in example 6 were tested simultaneously for AR-V7, and plasma and urine samples were tested for consistency in AR-V7 testing.
The experimental process comprises the following steps:
1. clinical sample plasma exosome RNA was directly followed from the prepared sample in example 2;
2. preparing exosome and exosome RNA in a clinical urine sample:
1) 20 mL of urine of 8 patients is respectively added into 100 mu L of pig plasma, and the mixture is shaken and mixed evenly. Then, 10 mL of PEG6000 (5 mg/mL) was added, the mixture was shaken and mixed, left at 4 ℃ for 15 min and 2000 g, centrifuged for 10 min, the supernatant was discarded, and the resulting precipitate was resuspended in 100. mu.L of PBS.
2) Extraction of urinary exosome RNA the extraction protocol for exosome RNA in example 6 was followed;
3. PCR detection of plasma exosome and urine exosome RNA, the configuration of the PCR reaction system is shown as the scheme in example 3;
4. and (3) displaying a detection result:
1) the detection results of the negative and positive quality control products are normal, negative is not detected, positive is obviously amplified, and the detection results are shown in figure 9;
2) the detection result of the quantitative standard is normal, R = 0.998, and the detection result is shown in fig. 10;
3) among 8 samples, 2 samples of the samples showed positive results in the detection of AR-V7 mRNA of plasma exosomes and urine exosomes, the consistency of the two samples is good, and the detection results are shown in FIG. 11;
4) all the AR-FL mRNA of the plasma exosomes and the urine exosomes in 8 samples were detected positively, and the detection results are shown in FIG. 12;
5) all the internal control porcine GAPDH of the plasma exosomes and the urine exosomes in 8 samples were detected positively, and the detection results are shown in FIG. 13.
Claims (14)
1. Primers for detecting AR-V7 and AR, wherein the primers are respectively:
AR-V7 forward primer: CAGGGATGACTCTGGGAGAAA
AR-V7 reverse primer: AGTCAGCCTTTCTTCAGGGTC
AR forward primer: TGCTCAAGACGCTTCTACCAG
AR reverse primer: AGTGAACTGATGCAGCTCTC are provided.
2. A primer and a probe for detecting AR-V7 and AR, wherein the primer and the probe are respectively:
AR-V7 forward primer: CAGGGATGACTCTGGGAGAAA
AR-V7 reverse primer: AGTCAGCCTTTCTTCAGGGTC
AR forward primer: TGCTCAAGACGCTTCTACCAG
AR reverse primer: AGTGAACTGATGCAGCTCTC
AR-V7 probe: AGCAGGGATGACTCT
An AR probe: TTCTACCAGCTCACCA are provided.
3. A kit for detecting AR-V7 and AR, comprising the primer of claim 1 or the primer and probe of claim 2.
4. The kit of claim 3, wherein the kit comprises: an exosome extraction reagent, an exosome nucleic acid extraction reagent and a qRT-PCR detection reagent of AR-V7.
5. The kit of claim 4, wherein the exosome-extracting agent comprises:
1) a suspension of magnetic beads comprising: 0.1-5 mg/mL of carboxyl magnetic beads coated by one or two or three antibodies selected from CD63, CD81 or CD 9;
2) a washing solution comprising: 0.005-0.05 mg/mL bovine serum albumin in 0.01M phosphate buffer;
3) an eluent, comprising: 0.01M phosphate buffer.
6. The kit of claim 5, wherein the exosome nucleic acid extracting agent comprises:
1) the solution I comprises guanidine isothiocyanate with the final concentration of 1-5 mol/L, sodium citrate with the final concentration of 5-10 mmol/L, Polidocanol with the final concentration of 0.01-1 g/ml, ethanol with the volume percentage of 5-45% and β -mercaptoethanol with the final concentration of 0.5-5 mmol/L;
2) the solution II comprises protease K with the final concentration of 1-50 mg/mL, Tris-HCl with the final concentration of 10-50 mmol/L, polyA with the final concentration of 0.01-1 mg/mL, CaCl with the final concentration of 10-20 mmol/L2；
3) The solution III comprises silicon hydroxyl magnetic beads with the final concentration of 1-30 mg/mL and the diameter of 300nm and glycerol with the volume percentage of 10-50%;
4) washing liquid A, comprising: guanidinium isothiocyanate with the final concentration of 0.1-5 mol/L, Tris-HCl with the final concentration of 50-100 mmol/L, Tween-20 with the volume percentage concentration of 0.5-5 percent and ethanol with the volume percentage concentration of 30-80 percent;
5) washing liquid B, comprising: the final concentration is 0.1-5 mol/L NaCl, and 1-20 mmol/L Tris-HCl;
6) washing liquid C, comprising: Tris-HCL with the final concentration of 5-20 mmol/L and ethanol with the volume percentage concentration of 70-80%;
7) an eluent, comprising: Tris-HCl (pH 8.5) at a final concentration of 5-20 mmol/L.
7. The kit according to claim 6, wherein the final concentration sum of the primers in the qRT-PCR detection reagent for AR-V7 is 100-900 nM, and the final concentration sum of the probes is 25-500 nM.
8. The kit according to claim 7,
in the qRT-PCR detection reagent for AR-V7, the 5' ends of the AR probe and the AR-V7 probe are provided with fluorescent groups, and the fluorescent groups comprise: VIC, FAM, ROX or HEX; the 3' ends of the AR probe and the AR-V7 probe are provided with quenching groups, and the quenching groups comprise: MGB or BHQ 1.
9. The kit according to claim 8, wherein the PCR reaction solution in the qRT-PCR detection reagent for AR-V7 comprises:
reaction solution A, comprising: 0.1 to 50mM dATP, 0.1 to 50mM dCTP, 0.1 to 50mM dGTP, 0.1 to 100 mM dUTP, 1 to 500 mM MgCl 2; and
reaction solution B, comprising: 1-1000U of reverse transcriptase, 1-500U of RNase inhibitor, 1-500U of hot start DNA polymerase, 0.1-100U of heat-sensitive UDG enzyme and 1-50% of BSA solution.
10. The kit of claim 9, wherein the qRT-PCR detection reagents for AR-V7 further comprise an internal control comprising porcine plasma, or plasma from other non-human species.
11. The kit of claim 10, wherein the qRT-PCR detection reagent for AR-V7 further comprises a standard, the standard comprises an RNA diluent of AR-V7 positive cell line 22RV1, and the concentration of the RNA diluent is in the range of 0.01-1000 ng/μ L.
12. The kit according to any one of claims 4 to 11, wherein the qRT-PCR method of AR-V7 is a one-step method.
13. The kit according to any one of claims 3 to 11, wherein the sample for detecting AR-V7 is derived from human plasma or human urine.
14. The kit of claim 13, wherein the procedure for detecting with the kit comprises a positive and negative quality control, and the positive quality control used by the quality control comprises: 0.01-1 ng/. mu.L of RNA of AR-V7 positive cell line 22RV 1; the negative quality control material used for quality control comprises: 10-100 ng/. mu.L RNA of AR-V7 negative cell line DU 145.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010085567.9A CN110923299B (en) | 2020-02-11 | 2020-02-11 | Primer, probe and kit for rapid quantitative detection of AR-V7 fluorescent qRT-PCR method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010085567.9A CN110923299B (en) | 2020-02-11 | 2020-02-11 | Primer, probe and kit for rapid quantitative detection of AR-V7 fluorescent qRT-PCR method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110923299A true CN110923299A (en) | 2020-03-27 |
| CN110923299B CN110923299B (en) | 2020-06-12 |
Family
ID=69854847
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010085567.9A Active CN110923299B (en) | 2020-02-11 | 2020-02-11 | Primer, probe and kit for rapid quantitative detection of AR-V7 fluorescent qRT-PCR method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110923299B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500728A (en) * | 2020-05-13 | 2020-08-07 | 无锡市申瑞生物制品有限公司 | Primer probe composition, kit and detection method for detecting human AR-V7 and AR gene expression |
| CN112029855A (en) * | 2020-08-05 | 2020-12-04 | 上海思路迪医学检验所有限公司 | Androgen receptor splice variant-7 nucleic acid quantitative detection method, internal standard and kit |
| CN112143814A (en) * | 2020-11-04 | 2020-12-29 | 上海思路迪生物医学科技有限公司 | Exosome ecDNA biomarker detection reagent for early diagnosis of lung cancer and application thereof |
| CN115521895A (en) * | 2021-06-24 | 2022-12-27 | 上海思路迪生物医学科技有限公司 | Application of water-soluble protein as exosome extraction enhancer and exosome extraction reagent |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108070641A (en) * | 2018-01-24 | 2018-05-25 | 北京恩泽康泰生物科技有限公司 | It is used to detect the primer and probe of AR-V7 and AR in vesica based on qPCR or digital pcr technology |
-
2020
- 2020-02-11 CN CN202010085567.9A patent/CN110923299B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108070641A (en) * | 2018-01-24 | 2018-05-25 | 北京恩泽康泰生物科技有限公司 | It is used to detect the primer and probe of AR-V7 and AR in vesica based on qPCR or digital pcr technology |
Non-Patent Citations (1)
| Title |
|---|
| URINE-BASED LIQUID BIOPSY: NON-INVASIVE AND SENSITIVE AR-V7 DETE: "Urine-based liquid biopsy: non-invasive and sensitive AR-V7 detection in urinary EVs from patients with prostate cancer", 《LAB CHIP》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500728A (en) * | 2020-05-13 | 2020-08-07 | 无锡市申瑞生物制品有限公司 | Primer probe composition, kit and detection method for detecting human AR-V7 and AR gene expression |
| CN112029855A (en) * | 2020-08-05 | 2020-12-04 | 上海思路迪医学检验所有限公司 | Androgen receptor splice variant-7 nucleic acid quantitative detection method, internal standard and kit |
| CN112029855B (en) * | 2020-08-05 | 2024-05-17 | 上海思路迪医学检验所有限公司 | Androgen receptor splice variant-7 nucleic acid quantitative detection method, internal standard and kit |
| CN112143814A (en) * | 2020-11-04 | 2020-12-29 | 上海思路迪生物医学科技有限公司 | Exosome ecDNA biomarker detection reagent for early diagnosis of lung cancer and application thereof |
| CN115521895A (en) * | 2021-06-24 | 2022-12-27 | 上海思路迪生物医学科技有限公司 | Application of water-soluble protein as exosome extraction enhancer and exosome extraction reagent |
| CN115521895B (en) * | 2021-06-24 | 2024-04-05 | 上海思路迪生物医学科技有限公司 | Application of water-soluble protein as exosome extraction enhancer and exosome extraction reagent |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110923299B (en) | 2020-06-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110923299B (en) | Primer, probe and kit for rapid quantitative detection of AR-V7 fluorescent qRT-PCR method | |
| EP2061801A1 (en) | Diagnosis of fetal abnormalities by comparative genomic hybridization analysis | |
| CN107022651B (en) | Kit for rapidly detecting hepatitis C virus nucleic acid and detection method thereof | |
| CN111235313A (en) | CRISPR-Cas13 method for rapidly detecting novel coronavirus | |
| EP2652147B1 (en) | One-step method of elution of dna from blood samples | |
| WO2010102460A1 (en) | A method and kit for quantitative and qualitative detection of genetic material of pathogenic microorganisms | |
| CN105936940B (en) | Nucleic acid sequence for detecting deafness gene and application thereof | |
| CN107574261B (en) | Detection primer, detection kit and detection method for detecting hantavirus | |
| CN115851926A (en) | Real-time fluorescent nucleic acid isothermal amplification detection kit for prostate cancer and special primer and probe thereof | |
| CN115927565A (en) | Establishment and application of method for detecting pathogenic microorganisms in CAR-T cell product based on mNGS | |
| CN112029855B (en) | Androgen receptor splice variant-7 nucleic acid quantitative detection method, internal standard and kit | |
| CN116083555A (en) | Biomarker combination for predicting or detecting keratoconus, detection agent and application | |
| CN109628640B (en) | RPA-LFD primer, method and kit for rapidly detecting spring viremia of carp virus | |
| WO2017026692A1 (en) | Composition for early diagnosis of obesity and use thereof | |
| CN107746880A (en) | A kind of kit based on RT qPCR methods detection stomach cancer and its preparation method and application | |
| CN114410795A (en) | Liver cancer early detection based on miRNA (micro ribonucleic acid) feature marker | |
| CN113667773A (en) | Primer, probe and kit for detecting whether RCL (Rich cell line) pollution exists in CarT cells | |
| US9487820B2 (en) | Methods of nucleic acid liquid-phase extraction and detection | |
| CN108949947B (en) | Cytochrome P450 gene polymorphic site related to generation of anti-tubercular drug liver injury | |
| CN113897419B (en) | Kit and method for capturing extracellular vesicles or quantitatively analyzing extracellular vesicle contents | |
| CN111154836A (en) | Targeted nucleic acid capture and detection methods | |
| US20230135802A1 (en) | Methods for diagnosis and in vitro risk stratification for head and neck cancer based on exosomal mrnas | |
| CN114427009A (en) | Multiple enrichment detection method for influenza A, influenza B and respiratory syncytial virus | |
| CN114107307B (en) | Method for screening PD-L1 DNA nucleic acid aptamer in vitro and application thereof | |
| CN108949946B (en) | UGT2 gene polymorphism site related to anti-tubercular drug hepatic injury and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210311 Address after: Room 304, 404, 402, 401, building 2, No. 158, Xinjun Ring Road, Minhang District, Shanghai, 201114 Patentee after: SHANGHAI 3D MEDICINES Co.,Ltd. Address before: 200120 8, 25 building, 3399 lane, Kang Xin Road, Pudong New Area, Shanghai. Patentee before: SHANGHAI SILUDI MEDICAL LABORATORY Co.,Ltd. |
|
| TR01 | Transfer of patent right |