CN110904258A

CN110904258A - Method for high-throughput targeted identification of physical and chemical mutation plant M1 generation mutation and acquisition of mutant

Info

Publication number: CN110904258A
Application number: CN201911223356.0A
Authority: CN
Inventors: 韶也; 赵炳然; 毛毕刚; 彭彦; 唐丽; 李曜魁; 胡远艺; 张丹; 柏连阳; 袁隆平
Original assignee: Hunan Hybrid Rice Research Center
Current assignee: Hunan Hybrid Rice Research Center
Priority date: 2019-12-03
Filing date: 2019-12-03
Publication date: 2020-03-24
Anticipated expiration: 2039-12-03
Also published as: CN110904258B

Abstract

The invention discloses a method for identifying physical and chemical mutation generation M1 of a plant by high-throughput targeting and obtaining the mutant, which comprises the following steps: carrying out mutagenesis on plants by a non-lethal dose physicochemical mutagenesis mode, planting the obtained M1 generation plants in individual plants, mixing leaves of each individual plant, extracting mixed pool DNA, and carrying out high-depth targeted sequencing on a target gene region; and comparing the sequencing result with the related sequence of the target gene region, and identifying whether the target SNP and/or Indel exist. And (3) carrying out DNA identification on the chimera single plant on the basis of identifying the chimera single plant containing the target gene region mutation, selecting spikes containing the mutation, mixing and collecting seeds of the spikes, carrying out mixed sowing, then carrying out DNA identification on the single plant to obtain an M2 single plant with the target genetic phenotype. The method has the advantages of high efficiency, good accuracy and simple operation, and has significant progress significance for identifying and obtaining innovative germplasm.

Description

Method for high-throughput targeted identification of physical and chemical mutation plant M1 generation mutation and acquisition of mutant

Technical Field

The invention belongs to the field of plant mutant identification, and particularly relates to a method for identifying a physicochemical mutation plant mutant and obtaining the mutant.

Background

The germplasm resources are the basis of plant genetic breeding, and mutation breeding can generate abundant genetic variation, so that the variation rate is thousands of times of natural variation. According to the statistics of the world atomic energy organization in 1985, more than 500 varieties can be bred in all countries of the world through a mutagenesis method, and a large amount of valuable germplasm resources are obtained. However, mutation breeding has a number of obvious defects, the most important of which is due to random mutation positions, and the target mutants can be selected only in M2 generation, which results in low accuracy and efficiency of innovative germplasm.

With the popularization of the gene site-directed editing technology in plants, the technology effectively makes up the defect of mutation breeding by the characteristics of accuracy, high efficiency and simplicity, and is favored by the plant genetic breeding community. Although the gene site-directed editing technology overcomes the main defects of mutation breeding, the application of the gene site-directed editing technology to plants needs a transgenic means, and some important plant transgenic systems are not mature, so that the application of the gene site-directed editing technology is limited. The mutation breeding is realized by physical and chemical means without the help of transgenic technology, and most plants can obtain stably inherited mutant germplasm through mutation, so that the mutation breeding still has the irreplaceable advantages. In addition, mutation breeding has a long history of application in plants. In 1927, Muller discussed the X-ray induced Drosophila profuse variation in the third International genetics, suggesting that induced mutations improved plants. Afterwards, Stadler demonstrated for the first time that X-rays can induce maize and barley mutations. Nilsson-Ehle & Gustafsson (1930) obtained barley mutants with stiff stalk, compact ear, erect type using X-ray irradiation. In 1934 Tollenear developed the first tobacco mutant "Chlorina" by X-ray. In 1948, drought resistant cotton varieties were bred in India using X-ray mutagenesis. In 1957, the Chinese academy of agricultural sciences established the first research room for atomic energy agricultural utilization in China, and then various provinces also established related research institutions in succession. In the middle of the 60 s of the 20 th century, new varieties are bred on main crops such as rice, wheat, soybean and the like by utilizing radiation mutagenesis, and the new varieties are applied to production. In the later 70 s of the 20 th century, plant radiation mutation breeding began to be applied to breeding of vegetables, sugar, melons, fruits, feeds, medicinal plants and ornamental plants. It can be seen that mutation breeding has been examined for a long time, and has made a great contribution to genetic breeding of plants in the world, and has become a generally accepted breeding means in both the scientific and industrial fields.

The general consensus of mutagenic breeding has been that mutation selection was not performed on the mutagenic current generation (M1) because the genetic variation caused by mutagenesis is mostly recessive and is present in M1 as a chimera. Only by the time of the segregating population of the mutagenic second generation (M2) was the recessive variation produced by M1 present in homozygous form in the M2 individuals, at which time mutants could be selected for the trait of interest. Based on the irreplaceable advantages of mutation breeding, the problem that the mutation breeding is beneficial to selection and the mutation efficiency of a target gene is low is expected to be solved.

Disclosure of Invention

The technical problem to be solved by the invention is to overcome the defects and defects in the background technology, provide a method for identifying the M1 generation mutation of the physicochemical mutation plant in a high-throughput targeted manner, which has high efficiency, good accuracy and simple and convenient operation, and correspondingly provide a method for obtaining the mutant by identifying the M1 generation mutation in a high-throughput targeted manner, which can save manpower and material resources, and has high efficiency and good precision.

In order to solve the technical problems, the technical scheme provided by the invention is a method for identifying the mutation of the M1 generation of a physicochemical mutation plant in a high-throughput targeted manner, which comprises the following steps:

a) mutagenizing plants by a non-lethal dose physicochemical mutagenesis mode to obtain plant material M1 generation;

b) the obtained M1 generation plants are divided into single plants for planting, and the leaves of the single plants after planting are taken and mixed;

c) extracting mixed pool DNA from all mixed leaf materials;

d) performing high-depth target sequencing on the extracted mixed pool DNA in a target gene region;

e) and comparing the high-depth targeted sequencing result with the related sequence of the target gene region, and identifying whether the target SNP and/or Indel of the target gene region exists in the population DNA sample in the high-depth targeted sequencing result.

Nowadays, the second generation sequencing technology (NGS) and the latest third generation sequencing have accelerated the research in the fields of genetic diseases, cancers, etc., and themselves gradually enter the clinic as a more advanced gene detection means. Among numerous sequencing technologies, flexibility and low cost are fully considered, a targeted sequencing technology is finally selected, high-depth sequencing is carried out on a target region of a genome, the target region is transferred to rapid screening and identification of plant innovative germplasm, and accuracy and efficiency of screening of the existing innovative germplasm are greatly improved.

Preferably, in the above method, after the identification in step e), the method further includes verifying the identification result by using any one or more of the following methods to verify whether the target SNP and/or Indel of the target gene region exists in the sample, where the verification method specifically includes:

e₁: detecting all plants in a Digital PCR (polymerase chain reaction, dPCR) identification mode;

e₂: carrying out typing identification on each individual plant by a KASP typing mode;

e₃: each individual was identified by a one-generation sequencing approach.

Digital PCR is a new generation of PCR technology that has been rapidly developed in recent years, and is an absolute quantitative technique for nucleic acid molecules, whereby a digital PCR system can easily quantitatively analyze low-frequency mutations as low as 0.01% by virtue of its ultra-high sensitivity. Because the digital PCR is an absolute quantitative technology accurate to a single DNA molecule, the method has ultrahigh precision, and can accurately verify the low-frequency mutation detected by deep sequencing by combining the digital PCR with a high-depth targeted sequencing technology, thereby further improving the accuracy and efficiency of the existing innovative germplasm screening.

KASP, competitive allele Specific PCR (Kompetitive Allelele Specific PCR), is a high throughput known SNP/Indel detection technique that detects different genotypes of the same locus with two-color fluorescence based on terminal fluorescence readings. By utilizing the KASP technology to carry out high-throughput typing identification on different individuals on the SNP/Indel discovered by high-depth targeted sequencing, the accuracy and efficiency of the existing innovative germplasm screening can be further improved.

The method as described above, more preferably, the specific identification method adopted in step e) comprises the following two steps:

1) firstly, detecting the population DNA in the high-depth target sequencing result by adopting a digital PCR identification mode, and identifying whether the target SNP and/or Indel of a target gene region exists in a population DNA sample; if yes, executing the following step 2, otherwise, terminating;

2) and designing KASP typing primers aiming at SNP and/or Indel sites identified by digital PCR, carrying out KASP genotyping on individual plants of a population corresponding to the mixed pool sample containing the mutation, and finally determining whether the chimeric individual plant containing the target gene region mutation exists.

KASP is a high-throughput known SNP/Indel detection technology, and based on terminal fluorescence reading, bicolor fluorescence can detect different genotypes of the same locus. By reducing the candidate region population by using digital PCR and then carrying out accurate typing on different individuals on the SNP/Indel found by high-depth targeted sequencing by using KASP technology, the accuracy and efficiency of the existing innovative germplasm screening can be further improved.

In the above method, preferably, the non-lethal dose in step a) is a dose controlled in a range of about 20% of the semi-lethal dose. The dosage control can obtain a certain mutation rate and a certain number of live seeds; such as a particularly preferred semi-lethal dose. The balance relationship between mutation efficiency and the amount of the active species can be coordinated through the control of the mutagenesis mode dosage.

The method preferably, the physical and chemical mutagenesis in step a) includes one or more of the following physical and chemical mutagenesis modes:

the physical mutagenesis comprises ultraviolet mutagenesis, X-ray mutagenesis, gamma-ray mutagenesis, β ray mutagenesis, α ray mutagenesis, high-energy particle mutagenesis, cosmic ray mutagenesis and microgravity mutagenesis, wherein Indel mutagenesis is easier to generate by the physical mutagenesis;

the chemical mutagenesis comprises alkylating agent mutagenesis, azide mutagenesis, base analogue mutagenesis, lithium chloride mutagenesis, antibiotic mutagenesis and intercalating dye mutagenesis; chemical mutagenesis is more likely to generate SNP mutations;

the alkylating agent mutagenesis comprises ethyl methyl naphthenate (EMS) mutagenesis, diethyl sulfate (DES) mutagenesis and Ethylene Imine (EI) mutagenesis.

In the above method, preferably, in the step b), when the obtained M1 generation plants are planted in single plants, an arbitrary number of plants is used as a group, and numbering is performed in units of each group; in a subsequent step c), the leaves of each population are mixed in a centrifuge tube to extract the DNA, so that the DNA of each tube contains the genetic information of the entire population. Through the grouping operation, a larger sample amount can be contained in the sequencing, then a large amount of samples are mixed in a pool, the sequencing cost is reduced, and finally effective balance of high throughput and low cost is realized by combining the KASP technology of adding and typing later.

More preferably, the number of arbitrary strains in the one population is 48, 96 or 192 strains; when taking leaves of each individual plant, equal amount of leaves at different parts of the same individual plant are selected. As a further preference, in the subsequent step d), the sequencing depth of the high-depth targeted sequencing of the single population with the strain number of 48 is more than 2000 times, the sequencing depth of the high-depth targeted sequencing of the single population with the strain number of 96 is more than 5000 times, and the sequencing depth of the high-depth targeted sequencing of the single population with the strain number of 192 is more than 10000 times.

The method as described above, preferably, in the step d), the target gene region includes an exon region of the target gene or a non-coding region of the target gene (or other interested region on the plant genome, particularly preferably, an exon region), and the high-depth targeted sequencing includes a targeted capture technology based on multiplex PCR amplification, a targeted capture technology based on liquid phase probe capture hybridization, or a third generation sequencing single molecule targeted sequencing technology;

the sequencing depth of the high-depth target sequencing is determined according to the number of the single plants in each population.

As a general technical concept, the invention also provides a method for high-throughput targeted identification of mutations at M1 generation by physicochemical mutagenesis and obtaining of mutants, which is characterized in that on the basis of the identification of a chimeric individual containing a mutation in the target gene region by the method of the invention, the method further comprises the following steps:

f) extracting DNA of leaves corresponding to each ear of each chimera single plant containing the target gene region mutation, carrying out DNA identification, selecting the ears containing the mutation, and mixing the ears and the seeds;

g) and performing mixed sowing on the mixed harvested seeds (M2 generation), then performing individual plant leaf extraction and DNA identification, and finally obtaining the M2 individual plant with the target genetic phenotype.

The above method, preferably, in step f), the DNA identification is preferably performed by using KASP typing primers which have been designed, but may be a first generation sequencing identification for the target region; the KASP typing primer is adopted for identification, so that high flux, low cost and convenience in operation can be better realized.

In said step g), said DNA identification is preferably performed by using KASP typing primers which have been designed, but may be a one-generation sequencing identification for the target region. The KASP typing primer is adopted for identification, so that high flux, low cost and convenience in operation can be better realized.

Compared with the prior art, the invention has the advantages that:

the invention creatively combines the high-depth targeted sequencing technology with one or more of the targeted sequencing technology, the digital PCR technology and the KASP genotyping technology, and creatively transfers the high-depth targeted sequencing technology to the field of mutation breeding mutation screening, thereby realizing high-throughput accurate selection of the mutation of the target gene in the mutation M1 generation and accurately positioning the mutation to the chimera single plant containing the mutation of the target gene. The technical scheme of the invention not only saves the time cost required for breeding a first generation, but also solves the problem of too high land, manpower and mutation selection cost caused by the large increase of the population number after breeding a first generation, and has significant progress significance for the identification and acquisition of innovative germplasm.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to these drawings without creative efforts.

FIG. 1 is a process flow diagram of the method for high-throughput targeted identification of mutations at M1 generation of a plant subjected to physicochemical mutation and acquisition of the mutants.

FIG. 2 shows the results of population typing using KASP typing primer set No. 32 in example 1 of the present invention.

FIG. 3 shows the results of population typing using KASP typing primer set No. 26 in example 1 of the present invention.

FIG. 4 shows the results of population typing using KASP typing primer set No. 34 in example 1 of the present invention.

Detailed Description

In order to facilitate an understanding of the invention, the invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of the invention is not limited to the specific embodiments below.

Unless otherwise defined, all terms of art used hereinafter have the same meaning as commonly understood by one of ordinary skill in the art. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention.

Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be prepared by existing methods.

Example 1:

the invention discloses a method for identifying mutation of a physicochemical mutation plant M1 generation and obtaining the mutant in a high-throughput targeted manner, which is shown in figure 1 and specifically comprises the following steps:

1. with 80MeV/u carbon ions (¹²C⁶⁺) Twenty thousand seeds of the rice variety 638S were irradiated at a dose of 180Gy to obtain the M1 generation of the rice variety 638S (hereinafter, 638S).

2. And planting the plants of which twenty thousand seeds of 638S M1 generations are raised in a single plant. 96 plants are used as a group, 8 rows of each group and 12 plants are used as a row, 100 groups are planted, 9600 plants are obtained, and each group is numbered from 1 to 100.

3. Taking the same amount of leaves of each individual plant as a unit of each population, mixing 96 equal parts of leaves in 1 centrifugal tube to extract DNA, and extracting 100 parts of DNA in total, wherein the DNA number corresponds to 1-100 of each population.

4. And taking DNA of each population as a sequencing sample, and carrying out targeted high-depth sequencing on exon regions of an OsNramp5 gene (Os07g0257200) and an OsRR22 gene (Os06g0183100), wherein the sequencing depth is more than 5000 times.

5. And comparing the high-depth targeted sequencing data with the Nipponbare sequence to obtain SNP and Indel data of the OsNramp5 gene and OsRR22 gene exons in 100 samples. The detection shows that in the sample No. 32, 18 bp deletion exists at the position 8875646-8875663 (RAP _ Locus) of the OsNramp5 gene, [ CCTACGTGGCAATTCACA/- ], and the deletion has 1bp of the initial base positioned in the 9 th exon; the No. 26 sample is detected to have 1bp deletion at position 4138902 (RAP _ Locus) of the OsRR22 gene, and the deletion is positioned in exon 3; the sample No. 34 is detected to have 7 bp deletion [ CGGCTTT/- ] at positions 4140861-4140867 (RAP _ Locus) of the OsRR22 gene, and the deletion is positioned in the 5 th exon.

6. And (3) verifying indels in the sequencing data of the population samples No. 32, 26 and 34 by adopting a digital PCR technology, wherein the verification result shows that the deletion mutation genotypes in the target sequencing data exist in all three samples.

7. Based on the deletion mutant genotypes present in the DNA of population Nos. 32, 26 and 34, KASP typing primers were designed as follows:

32FAM 5-’GAAGGTGACCAAGTTCATGCTGAAGAACCTGCACCCGTCCT-' 3 (shown in SEQ ID NO.1, underlined part indicates a fluorescent tag primer);

32HEX 5-’GAAGGTCGGAGTCAACGGATTGAAGAACCTGCACCCGTCAC-' 3 (shown in SEQ ID NO.2, underlined part indicates a fluorescent tag primer);

32COMMON 5- 'GCATGGAAAGAAACTGAACAAAGAT-' 3 (shown in SEQ ID NO. 3);

26FAM 5-’GAAGGTGACCAAGTTCATGCTCAGGCACCATGAGTTATCCCT-' 3 (shown in SEQ ID NO.4, underlined part indicates a fluorescent tag primer);

26HEX 5-’GAAGGTCGGAGTCAACGGATTCAGGCACCATGAGTTATCCCC-' 3 (shown in SEQ ID NO.5, underlined part indicates a fluorescent tag primer);

26COMMON 5- 'TGTTATCAGTAAATGGAGAGACAAAGAC-' 3 (shown in SEQ ID NO. 6);

34FAM 5-’GAAGGTGACCAAGTTCATGCTGCAAGCTCCTGAAGTCCGAA-' 3 (shown in SEQ ID NO.7, underlined part indicates a fluorescent tag primer);

34HEX 5-’GAAGGTCGGAGTCAACGGATTCAAGCTCCTGAAGTCCGCG-' 3 (shown in SEQ ID NO.8, underlined part indicates a fluorescent tag primer);

34COMMON 5- 'TTCTGCTGCTCTTCCATCTTTCA-' 3 (shown in SEQ ID NO. 9).

8. Using 3 KASP typing primers for deletion mutation sites, 96 × 3 to 288 individuals of the 32, 26, and 34 populations were each typed. After typing, row 4, strain 5 (32-D-5) in population No. 32 was found to contain a deletion genotype of 18 bp of exon 9 [ CCTACGTGGCAATTCACA/- ] of the OsNramp5 gene (see FIG. 2); it was also found that row 1, line 7 (26-A-7) in population No. 26 contained a deletion genotype of 1bp for exon 3 [ G/- ] of the OsRR22 gene (see FIG. 3); it was also found that line 3, line 6 (34-C-6) in population 34 contained a deletion genotype of 7 bp for exon 5 [ CGGCTTT/- ] of the OsRR22 gene (see FIG. 4). Finally obtaining 3M 1 generation individual strains with deletion mutation of target genes, wherein 1 strain OsNramp5 gene frameshift mutation chimera 32-D-5, and 2 strains OsRR22 gene frameshift mutation chimeras 26-A-7 and 34-C-6.

9. DNA is extracted from corresponding leaves on each spike of the individual plants of 32-D-5, 26-A-7 and 34-C-6, and sequencing detection is carried out aiming at Indel mutation existing in the individual plants, so that 3 spikes in the individual plant of 32-D-5 contain [ CCTACGTGGCAATTCACA/- ] mutation genotype, 2 spikes in the individual plant of 26-A-7 contain [ G/- ] mutation genotype and 4 spikes in the individual plant of 34-C-6 contain [ CGGCTTT/- ] mutation genotype. And (3) mixing and harvesting seeds containing mutant genotype ears by taking the individual plant as a unit.

10. Sowing seeds harvested by 32-D-5, 26-A-7 and 34-C-6 in 3 groups, and typing individual plants by using KASP primers designed in the step 7 to finally obtain 638S-32-D-5 with a cadmium low absorption phenotype in the M2 group of 32-D-5; 638S-26-A-7 and 638S-34-C-6 with salt tolerant phenotype were obtained in the M2 population of the 26-A-7, 34-C-6 population.

Example 2

1. taking twenty thousand seeds of the rice variety Huahang 31, soaking the seeds in clean water in a constant temperature incubator at 28 ℃ for 16h, fishing out the seeds and draining. Soaking the seeds in 1% (w/w) Ethyl Methanesulfonate (EMS) solution for 8h in a constant temperature incubator at 28 ℃, taking out the seeds and draining the water. Washing seeds with clear water, changing water for 8 times, accelerating germination, sowing and raising seedlings at 37 ℃, planting 96 plants as one group, planting 100 groups with 8 rows and 12 plants in each row for 9600 plants, and numbering 1-100 for each group.

2. Taking the same amount of leaves of each individual plant as a unit of each population, mixing 96 equal parts of leaves in 1 centrifugal tube to extract DNA, and extracting 100 parts of DNA in total, wherein the DNA number corresponds to 1-100 of each population.

3. And taking the DNA of each population as a sequencing sample, and carrying out targeted high-depth sequencing on the exon region of the OsBADH2(Os08g 042455) gene, wherein the sequencing depth is more than 5000-fold.

4. And comparing the high-depth targeted sequencing data with the Nipponbare sequence to obtain the SNP and Indel data of the OsBADH2 gene exon in 100 samples. In the sample No. 72, a [ G/A ] single base mutation is detected to exist at position 20381445 (RAP _ Locus) of the OsBADH2 gene, the mutation causes that the 109 th amino acid is changed from Trp into a terminator, and the protein coded by the OsBADH2 gene is terminated early.

5. And (3) verifying the SNP in the sequencing data of the population 72 sample by adopting a digital PCR technology, wherein the result shows that the SNP genotype in the target sequencing data exists in the sample.

6. Based on the SNP genotype present in the DNA in the population sample No. 72, KASP typing primers were designed as follows:

72FAM 5-’GAAGGTGACCAAGTTCATGCTGAAGCCTCTTGATGAAGCAGCATG-' 3 (shown in SEQ ID NO.10, underlined part indicates fluorescent tag primer);

72HEX 5-’GAAGGTCGGAGTCAACGGATTGAAGCCTCTTGATGAAGCAGCATA-' 3 (shown in SEQ ID NO.11, underlined part indicates fluorescent tag primer);

72COMMON 5- 'CAACATCGTCCTGACAAATGGAAT-' 3 (shown in SEQ ID NO. 12).

7. Using the above-designed KASP typing primers, 96 individuals of population 72 were typed. After typing, the 7 rd row 3 rd strain (72-G-3) in population 72 was found to contain the exon 3 [ G/A ] single base mutant genotype of OsBADH2 gene. Finally obtaining 1M 1 generation individual 72-G-3 with the target gene terminated in advance.

8. Extracting DNA from corresponding leaves on each ear of a 72-G-3 individual plant, carrying out sequencing detection on SNP (single nucleotide polymorphism) mutation existing in the individual plant, finding that 3 ears of the 72-G-3 individual plant contain [ G/A ] single-base mutation genotypes, and harvesting seeds containing the mutant genotype ears together.

9. And (3) mixing the seeds harvested from the 72-G-3 individual plant, planting the seeds in individual plants after seedling raising, and typing the individual plants by using the KASP primer designed in the step 6, so as to finally obtain Huahang 31-72-G-3 with rice aroma phenotype in the M2 population of 72-G-3.

Example 3:

1. by using⁶⁰The Co-gamma ray irradiates one hundred thousand seeds of the rice variety Huazhan with the dosage of 350Gy to obtain the M1 generation of the rice variety Huazhan.

2. After seedling cultivation of seeds of hundreds of thousands of Huazhan M1 generations, 96 plants are used as a group, 8 lines of each group and 12 plants in each line, 500 groups are planted, and 48000 plants are planted in total, and each group is numbered from 1 to 500.

3. Taking the same amount of leaves of each individual plant as a unit of each population, mixing 96 equal parts of leaves in 1 centrifugal tube to extract DNA, and extracting 500 parts of DNA in total, wherein the DNA number corresponds to the number of each population from 1 to 500.

4. And taking the DNA of each population as a sequencing sample, and carrying out targeted high-depth sequencing on the binding region of the TAL effector of the bacterial blight bacterium in the gene regulatory region of the Os11N3 gene (Os11g0508600) and the Os8N3 gene (Os08g0535200), wherein the sequencing depth is more than 5000.

5. And comparing the high-depth targeted sequencing data with a Nipponbare sequence to obtain SNP and Indel data in the binding region of the gene Os11N3 and the TAL effector of bacterial leaf blight bacteria in the gene regulation region Os8N3 in 500 samples. Through detection, the sample No. 261 shows that 22 bp deletion exists at the 18174476-18174497 position (RAP _ Locus) of the Os11N3 gene [ CCAACCAGGTGCTAAGCTCATC/- ]; the 385 sample is detected to have 34 bp deletion at the positions 26728837-26728870 (RAP _ Locus) of the Os8N3 gene.

6. And (3) verifying indels in the sequencing data of the sample No. 261 and No. 385 by adopting a digital PCR technology, wherein the results show that the deletion mutation genotypes in the targeted sequencing data exist in all three samples.

7. Based on the deletion mutant genotypes present in the DNA of population Nos. 261 and 385, KASP typing primers were designed as follows:

261FAM 5-’GAAGGTGACCAAGTTCATGCTTCCTAGCACTATATAAACCCCCTC-' 3 (shown in SEQ ID NO.13, underlined part indicates fluorescent tag primer);

261HEX 5-’GAAGGTCGGAGTCAACGGATTTCCTAGCACTATATAAACCCCCTA-' 3 (shown in SEQ ID NO.14, underlined part indicates fluorescent tag primer);

261COMMON 5- 'CTTGAGTTTGCTTTGCTTGAAGGC-' 3 (shown in SEQ ID NO. 15);

385FAM 5-’GAAGGTGACCAAGTTCATGCTGGCTCAGTGTTTATATAGTTGGAGAC-' 3 (shown in SEQ ID NO.16, underlined part indicates fluorescent tag primer);

385HEX 5-’GAAGGTCGGAGTCAACGGATTGGCTCAGTGTTTATATAGTTGGAGA-' 3 (shown in SEQ ID NO.17, underlined part indicates fluorescent tag primer);

385COMMON 5- 'GAAAAAAAAGCAAAGGTTAGATATGCA-' 3 (shown in SEQ ID NO. 18).

8. Using 2 KASP typing primers for deletion mutation sites, 96 × 2 ═ 192 individuals of population nos. 261 and 385 were each typed. After typing, the deletion genotype of 22 bp of a TAL effector binding region (CCAACCAGGTGCTAAGCTCATC/- ] of the bacterial blight TAL effector in the gene regulatory region of the Os11N3 is found in the 7 th strain (261-B-7) in the row 2 in the population No. 261; after typing, it was also found that the 3 rd strain (385-H-3) in the 8 rd row of No. 385 population contained a deletion genotype of 34 bp of the TAL effector binding region [ TCTCCCCCTACTGTACACCACCAAAAGTGGAGGG/- ] of bacterial blight bacterium in the regulatory region of Os8N3 gene. Finally obtaining 2M 1 generation individual strains with deletion mutation of target genes, wherein 1 Os11N3 gene frameshift mutation chimera 261-B-7 and 1 Os8N3 gene frameshift mutation chimera 385-H-3.

9. DNA is extracted from corresponding leaves on each ear of 261-B-7 and 385-H-3 individuals, sequencing detection is carried out on Indel mutation existing in the individuals, and 4 ears in 261-B-7 individuals contain [ CCAACCAGGTGCTAAGCTCATC/- ] mutant genotype and 3 ears in 385-H-3 individuals contain [ TCTCCCCCTACTGTACACCACCAAAAGTGGAGGG/- ] mutant genotype. And (3) mixing and harvesting seeds containing mutant genotype ears by taking the individual plant as a unit.

10. Seeds harvested by 261-B-7 and 385-H-3 are sown in 2 groups, and the KASP primer designed in the step 7 is used for typing the single plant, finally, the Huazhan-261-B-7 and the Huazhan-385-H-3 which can resist the bacterial leaf blight are obtained in M2 groups of 261-B-7 and 385-H-3.

Sequence listing

<110> research center for hybrid rice in Hunan province

<120> method for identifying M1 generation mutation of physicochemical mutation plant and obtaining mutant by high-throughput targeting

<160>18

<170>SIPOSequenceListing 1.0

<210>1

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

gaaggtgacc aagttcatgc tgaagaacct gcacccgtcc t 41

<210>2

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

gaaggtcgga gtcaacggat tgaagaacct gcacccgtca c 41

<210>3

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gcatggaaag aaactgaaca aagat 25

<210>4

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gaaggtgacc aagttcatgc tcaggcacca tgagttatcc ct 42

<210>5

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gaaggtcgga gtcaacggat tcaggcacca tgagttatcc cc 42

<210>6

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

tgttatcagt aaatggagag acaaagac 28

<210>7

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gaaggtgacc aagttcatgc tgcaagctcc tgaagtccga a 41

<210>8

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

gaaggtcgga gtcaacggat tcaagctcct gaagtccgcg 40

<210>9

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ttctgctgct cttccatctt tca 23

<210>10

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

gaaggtgacc aagttcatgc tgaagcctct tgatgaagca gcatg 45

<210>11

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gaaggtcgga gtcaacggat tgaagcctct tgatgaagca gcata 45

<210>12

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

caacatcgtc ctgacaaatg gaat 24

<210>13

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

gaaggtgacc aagttcatgc ttcctagcac tatataaacc ccctc 45

<210>14

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

gaaggtcgga gtcaacggat ttcctagcac tatataaacc cccta 45

<210>15

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

cttgagtttg ctttgcttga aggc 24

<210>16

<211>47

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

gaaggtgacc aagttcatgc tggctcagtg tttatatagt tggagac 47

<210>17

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

gaaggtcgga gtcaacggat tggctcagtg tttatatagt tggaga 46

<210>18

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

gaaaaaaaag caaaggttag atatgca 27

Claims

1. A method for high-throughput targeted identification of mutations at M1 generation in plants by physical and chemical mutagenesis, which comprises the following steps:

c) extracting mixed pool DNA from all mixed leaf materials;

2. The method according to claim 1, wherein after the identification in step e), the method further comprises verifying the identification result by using any one or more of the following methods to verify whether the target SNP and/or Indel of the target gene region exists in the sample, wherein the verification method specifically comprises:

e₁: detecting and verifying all plants in a digital PCR identification mode;

e₂: carrying out typing verification on each single plant in a KASP typing mode;

e₃: each individual was verified by a one-generation sequencing approach.

3. The method of claim 2, wherein the authentication mode comprises the following two steps:

1) firstly, detecting the population DNA in the high-depth target sequencing result by adopting a digital PCR identification mode, and identifying whether the target SNP and/or Indel of a target gene region exists in a population DNA sample; if yes, executing the following step 2), otherwise, terminating;

4. A method according to any one of claims 1 to 3, wherein the non-lethal dose in step a) is a dose controlled to a range which is 20% of the semi-lethal dose.

5. The method according to any one of claims 1 to 3, wherein the physicochemical mutagenesis in step a) comprises one or more of the following physical mutagenesis and chemical mutagenesis in combination:

the physical mutagenesis comprises ultraviolet mutagenesis, X-ray mutagenesis, gamma-ray mutagenesis, β ray mutagenesis, α ray mutagenesis, high-energy particle mutagenesis, cosmic ray mutagenesis and microgravity mutagenesis;

the chemical mutagenesis comprises alkylating agent mutagenesis, azide mutagenesis, base analogue mutagenesis, lithium chloride mutagenesis, antibiotic mutagenesis and intercalating dye mutagenesis;

the alkylating agent mutagenesis comprises ethyl methylcyclooate mutagenesis, diethyl sulfate mutagenesis and ethyleneimine mutagenesis.

6. The method according to any one of claims 1 to 3, wherein in the step b), the obtained M1 generation plants are divided into individual plants, and the individual plants are planted with an arbitrary number of plants as a group, and the numbers are counted by taking each group as a unit; in the subsequent step c, the leaves of each population are mixed in a centrifuge tube to extract DNA.

7. The method of claim 6, wherein any number of strains of the one population is 48, 96 or 192; when taking leaves of each individual plant, selecting equivalent leaves at different parts of the same individual plant;

in the subsequent step d), the sequencing depth of the high-depth targeted sequencing of the single population with the strain number of 48 is more than 2000, the sequencing depth of the high-depth targeted sequencing of the single population with the strain number of 96 is more than 5000, and the sequencing depth of the high-depth targeted sequencing of the single population with the strain number of 192 is more than 10000.

8. The method according to any one of claims 1 to 3, wherein in the step d), the target gene region comprises an exon region of a target gene or a non-coding region of the target gene, and the high-depth targeted sequencing comprises a multiplex PCR amplification-based targeted capture technology, a liquid phase probe capture hybridization-based targeted capture technology or a third generation sequencing single-molecule targeted sequencing technology;

9. A method for high-throughput targeted identification of mutations at generation M1 by physical and chemical mutagenesis and mutant acquisition, which is characterized in that the method is carried out on the basis of identification of a chimera single plant containing the mutation of a target gene region by the method of any one of claims 1-7, and then the method comprises the following steps:

g) and performing mixed sowing on the mixed harvested seeds, then performing individual plant leaf extraction and DNA identification to finally obtain the M2 individual plant with the target genetic phenotype.

10. The method of claim 9, wherein in step f, the DNA identification is performed using KASP typing primers that have been designed;

in said step g), said DNA identification is carried out using a KASP typing primer which has been designed.