CN110904224A - Manganese dioxide/nucleic acid probe composite nano probe capable of being amplified by signal specificity and preparation method and application thereof - Google Patents
Manganese dioxide/nucleic acid probe composite nano probe capable of being amplified by signal specificity and preparation method and application thereof Download PDFInfo
- Publication number
- CN110904224A CN110904224A CN201910655848.0A CN201910655848A CN110904224A CN 110904224 A CN110904224 A CN 110904224A CN 201910655848 A CN201910655848 A CN 201910655848A CN 110904224 A CN110904224 A CN 110904224A
- Authority
- CN
- China
- Prior art keywords
- manganese dioxide
- nucleic acid
- stranded dna
- acid probe
- cationic polymer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
- A61K49/001—Preparation for luminescence or biological staining
- A61K49/0013—Luminescence
- A61K49/0017—Fluorescence in vivo
- A61K49/005—Fluorescence in vivo characterised by the carrier molecule carrying the fluorescent agent
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
- A61K49/001—Preparation for luminescence or biological staining
- A61K49/0013—Luminescence
- A61K49/0017—Fluorescence in vivo
- A61K49/005—Fluorescence in vivo characterised by the carrier molecule carrying the fluorescent agent
- A61K49/0054—Macromolecular compounds, i.e. oligomers, polymers, dendrimers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Animal Behavior & Ethology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pathology (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a manganese dioxide/nucleic acid probe composite nano material, which comprises manganese dioxide, a cationic polymer and a nucleic acid probe; the nucleic acid probe consists of double-stranded DNA molecules and single-stranded DNA molecules. The manganese dioxide/nucleic acid probe composite nano probe provided by the invention can realize specific signal amplification of tumor cells, and firstly, the composite nano probe can open double-stranded nucleic acid to generate a fluorescent signal under the triggering of high-expression microRNA in the tumor cells; secondly, the single-stranded nucleic acid is released in the tumor cells specifically and rapidly, and the specific amplification of the tumor cell fluorescence signal is realized. The composite nano probe can realize tumor cell signal amplification, and the signal specific amplification strategy enhances the specificity of nucleic acid detection by virtue of the advantages of nano particles. The preparation method is simple, the conditions are mild, the detection signals in normal cells can be effectively reduced, and the method has universality and good application prospects.
Description
Technical Field
The invention belongs to the technical field of tumor living cell detection, relates to a manganese dioxide/nucleic acid probe composite nano-material, and a preparation method and application thereof, and particularly relates to a manganese dioxide/nucleic acid probe composite nano-probe capable of realizing signal specific amplification, a preparation method thereof, an imaging and signal specific amplification material and an application thereof.
Background
microRNA is a non-coding single-stranded RNA molecule which is coded by endogenous genes and has the length of about 22 nucleotides, and the type and the number of the microRNA are closely related to the occurrence and the development of tumors, so the microRNA is often used as a marker for tumor detection. However, the microRNA concentration at the tumor site is low, and therefore, amplification strategies are often used for detection.
Commonly used amplification strategies for detecting micrornas fall into two categories: amplification of microRNA molecules, namely amplification; and amplifying the detection signal. Amplification techniques for microRNA molecules include real-time fluorescent polymerase chain reaction (see Nature, Biotechnol.2008,26,462-469.), and a series of DNA isothermal amplification techniques (see Nature,1991,350, 91-92; Proc. Natl. Acad. Sci.,1992,89, 392-396; Nat. Genet.,1998,19, 225-232; chem. Sci.,2017,8, 3668-3675; chem. Sci.,2015,6,6777-6782), and the like. However, these nucleic acid amplification techniques often require enzyme participation, have high requirements on enzyme activity, have harsh detection conditions, and require enzyme activity. The microRNA enzyme-free signal amplification technology is based on a toehold mediated strand displacement reaction and can be divided into Hybrid Chain Reaction (HCR), Catalytic Hairpin Assembly (CHA) and entropy-driven catalysis (EDC) according to a reaction mechanism. The enzyme-free signal amplification technology based on the entropy-driven catalytic reaction is simple in design and short in detection time.
At present, most of nanoprobes (see Science,2007,318, 1121-1125; Angew. chem.2016,128,3125-3128) can amplify signals in normal cells while amplifying at a tumor site, so that the specificity of detection is greatly reduced. The introduction of complex probe sequences to enhance the specificity of nucleic acid probes consumes a lot of time and labor in the early sequence design and sequence screening process, and prevents the nucleic acid probes from entering the next clinical application.
Therefore, how to obtain a simple and specific signal amplification probe, which overcomes the problems of accuracy and complexity of the existing nanoprobe, provides possibility for accurate detection of tumor, and has become one of the focuses of research of many leading-edge scholars in the technical field of tumor detection in the field.
Disclosure of Invention
In view of the above, the technical problem to be solved by the present invention is to provide a manganese dioxide/nucleic acid probe composite nanomaterial, a preparation method thereof, and an application thereof, and in particular, a manganese dioxide/nucleic acid probe composite nanoprobe capable of signal specific amplification, which has tumor microenvironment responsiveness, generates a fluorescent signal, and can also achieve signal amplification in tumor cells, wherein the signal is not amplified in normal cells, thereby greatly simplifying the sequence design of a specific signal amplification probe, and simultaneously satisfying the requirement of specificity.
The invention provides a manganese dioxide/nucleic acid probe composite nano material, which comprises manganese dioxide, a cationic polymer and a nucleic acid probe;
the nucleic acid probe consists of double-stranded DNA molecules and single-stranded DNA molecules.
Preferably, the composite nano material is a composite nano probe;
the single-stranded DNA is compounded on the manganese dioxide;
the double-stranded DNA is complexed with the cationic polymer;
the cationic polymer is complexed on the manganese dioxide.
Preferably, the cationic polymer comprises one or more of polyethyleneimine, imidazole-modified polyethyleneimine, polylysine and imidazole-modified polylysine;
the molecular weight of the cationic polymer is 600-30000 Da;
the mass ratio of the manganese dioxide to the single-stranded DNA is (1-200): 1;
the mass ratio of the cationic polymer to the double-stranded DNA is (1-20): 1;
the mass ratio of the double-stranded DNA to the single-stranded DNA is 1: (0.1-10).
Preferably, the manganese dioxide comprises manganese dioxide nanosheets and/or manganese dioxide nanospheres;
the size of the manganese dioxide is 100-250 nm;
the nucleic acid probe is used for detecting microRNA;
the single-stranded DNA is a signal amplification strand; the double-stranded DNA is a signal reporter strand.
Preferably, the microRNA comprises one or more of microRNA-21, microRNA-221 and microRNA-155;
the double-stranded DNA is compounded on the cationic polymer through electrostatic interaction;
the single-stranded DNA is compounded on the manganese dioxide through various non-covalent bonds;
the complexing mode of the cationic polymer and the manganese dioxide comprises complexation;
the nucleic acid probe is designed aiming at high-expression microRNA in tumor cells.
Preferably, the sequence of the single-stranded DNA comprises one or more of CTTATCAGACTGATGTTGATTGG, CTTATCAGACTGATGTTGATTGGT, CTTATCAGACTGATGTTGATTGGA, CTTATCAGACTGATGTTGATTGGAT and CTTATCAGACTGATGTTGATTGGTA;
the double-stranded DNA molecule consists of a first single-stranded DNA for marking a fluorescent molecule and a second single-stranded DNA for marking a quenching group;
the sequence of the first single-stranded DNA comprises one or more of TATCAGACTGATGTTGATTGG, TATCAGACTGATGTTGATTGGT, TATCAGACTGATGTTGATTGGA, TATCAGACTGATGTTGATTGGAT and TATCAGACTGATGTTGATTGGTA;
the sequence of the second single-stranded DNA comprises one or more of CCAATCAACATCAGTCTGATAAGCTA, ACCAATCAACATCAGTCTGATAAGCTA, TCCAATCAACATCAGTCTGATAAGCTA, ATCCAATCAACATCAGTCTGATAAGCTA and TACCAATCAACATCAGTCTGATAAGCTA;
the double-stranded DNA molecule is composed in a manner that involves base complementary pairing.
The invention provides a preparation method of a manganese dioxide/nucleic acid probe composite nano material, which comprises the following steps:
1) mixing manganese dioxide with a buffer solution, and then uniformly mixing the mixture with single-stranded DNA to obtain a first mixture;
firstly mixing a cationic polymer with a buffer solution, and then carrying out vortex mixing on the cationic polymer and double-stranded DNA to obtain a second mixture;
2) and uniformly mixing the first mixture and the second mixture obtained in the step to obtain the manganese dioxide/nucleic acid probe composite nano material.
Preferably, the buffer comprises tris-hydrochloric acid buffer and/or 4-hydroxyethylpiperazine ethanesulfonic acid-hydrochloric acid buffer;
the vortex mixing time is 10-30 seconds;
the pH value of the buffer solution is 7.2-8.5;
the step of standing is also included after the uniform mixing;
the standing time is 5-40 minutes.
The invention provides an imaging and signal specific amplification material, which comprises a manganese dioxide/nucleic acid probe composite nano material prepared by any one of the technical schemes or a manganese dioxide/nucleic acid probe composite nano material prepared by the preparation method of any one of the technical schemes;
the imaging material includes a fluorescence imaging contrast agent.
The invention provides the manganese dioxide/nucleic acid probe composite nanomaterial described in any one of the above technical schemes, the manganese dioxide/nucleic acid probe composite nanomaterial prepared by the preparation method described in any one of the above technical schemes, or the application of the imaging material described in the above technical schemes in the field of tumor detection.
The invention provides a manganese dioxide/nucleic acid probe composite nano material, which comprises manganese dioxide, a cationic polymer and a nucleic acid probe; the nucleic acid probe consists of double-stranded DNA molecules and single-stranded DNA molecules. Compared with the prior art, the invention aims at the current situation that the signal amplification specificity of the existing nucleic acid signal amplification probe is poor. The introduction of the complex enhanced nucleic acid probe with the specific probe sequence consumes a great deal of time and labor in the early sequence design and sequence screening process, thereby preventing the nucleic acid probe from entering the next clinical application.
The manganese dioxide/nucleic acid probe composite nano probe provided by the invention can realize specific signal amplification of tumor cells, and can open double-stranded nucleic acid to generate a fluorescent signal under the triggering of high-expression microRNA in the tumor cells; secondly, the single-stranded nucleic acid is released in the tumor cells specifically and rapidly, and the specific amplification of the tumor cell fluorescence signal is realized. The manganese dioxide/nucleic acid probe composite nano probe can realize tumor cell signal amplification, and the signal specific amplification strategy enhances the specificity of nucleic acid detection by virtue of the advantages of nano particles.
According to the invention, signal amplification in tumor cells is realized by virtue of the tumor microenvironment responsiveness of the nanoparticles, signals are not amplified in normal cells, the sequence design of a specific signal amplification probe can be greatly simplified, and the requirement of specificity can be met at the same time. And the manganese dioxide/nucleic acid probe composite nano probe is compounded based on non-covalent bonds, is simple to prepare and mild in condition, can effectively reduce detection signals in normal cells, and has universality and good application prospect.
Experimental results show that tumor cells incubated with the manganese dioxide/nucleic acid probe composite nanoprobe provided by the invention have stronger signals, and normal cells incubated with the manganese dioxide/nucleic acid probe composite nanoprobe provided by the invention have weaker signals.
Drawings
FIG. 1 is a transmission electron microscope image of a manganese dioxide/nucleic acid probe composite nanoprobe prepared in example 18 of the present invention;
FIG. 2 is a diagram of the UV-Vis spectrum of manganese dioxide/nucleic acid probe composite nanoprobe prepared in example 18 of the present invention;
FIG. 3 shows fluorescence intensities of manganese dioxide/nucleic acid probe composite nanoprobes provided by the present invention after reacting with microRNAs of different concentrations for a period of time in the presence of glutathione;
FIG. 4 shows the average fluorescence intensity of co-cultured manganese dioxide/nucleic acid probe composite nanoprobes with MCF-7 tumor cells and CHO non-tumor cells respectively.
Detailed Description
For a further understanding of the invention, preferred embodiments of the invention are described below in conjunction with the examples, but it should be understood that these descriptions are included merely to further illustrate the features and advantages of the invention and are not intended to limit the invention to the claims.
All of the starting materials of the present invention, without particular limitation as to their source, may be purchased commercially or prepared according to conventional methods well known to those skilled in the art.
All the raw materials of the present invention are not particularly limited in their purity, and the present invention preferably adopts the purity of analytical purity, the purity conventional in the medical field or the field of application thereof.
All the noun expressions and acronyms of the invention belong to the conventional noun expressions and acronyms in the field, each noun expression and acronym is clearly and definitely clear in the relevant application field, and a person skilled in the art can clearly, exactly and uniquely understand the noun expressions and acronyms.
The invention provides a manganese dioxide/nucleic acid probe composite nano material, which comprises manganese dioxide, a cationic polymer and a nucleic acid probe;
the nucleic acid probe consists of double-stranded DNA molecules and single-stranded DNA molecules.
The manganese dioxide/nucleic acid probe composite nano material is a manganese dioxide/nucleic acid probe composite nano probe, comprises manganese dioxide, cationic polymer and a nucleic acid probe, and can also be called as a cationic polymer/manganese dioxide/nucleic acid probe composite nano material.
The invention is not particularly limited in principle to the said complexing, and may be one or more of carrying, doping, adsorbing, wrapping or growing in the concept of complexing well known to those skilled in the art, and those skilled in the art can adjust the complexing according to the application situation, application requirement or product performance requirement.
The specific structure and mode of the composite are not particularly limited in principle, and can be adjusted by a person skilled in the art according to application conditions, application requirements or product performance requirements. The double-stranded DNA is preferably complexed with the cationic polymer. The cationic polymer, i.e., the material in which the duplex DNA and the cationic polymer are complexed, is preferably complexed on the manganese dioxide. In the compounding mode, the double-stranded DNA is preferably compounded on the cationic polymer through electrostatic interaction, specifically, the manganese dioxide/nucleic acid probe composite nano-material is uncharged, the cationic polymer is positively charged, the nucleic acid probe is negatively charged, and the nucleic acid probe is compounded on the cationic polymer through electrostatic adsorption. The single-stranded DNA of the present invention is preferably complexed on the manganese dioxide through a plurality of non-covalent bonds, and particularly, the nucleic acid probe is complexed on the manganese dioxide through one or more of pi-pi interaction, hydrogen bonding and electrostatic interaction. The complexing means of said cationic polymer with said manganese dioxide preferably comprises complexation.
The specific selection of the cationic polymer is not particularly limited in principle, and can be adjusted by the ordinary cationic polymer well known to those skilled in the art according to the application condition, application requirement or product performance requirement, and the cationic polymer comprises one or more of polyethyleneimine, imidazole-modified polyethyleneimine, polylysine and imidazole-modified polylysine, and more preferably, the polyethyleneimine, imidazole-modified polyethyleneimine, polylysine or imidazole-modified polylysine is used for improving the signal amplification specificity, more accurate responsiveness and stability of the composite nanomaterial.
The invention has no special limitation on the parameters of the cationic polymer in principle, and the skilled person can adjust the parameters according to the application situation, application requirements or product performance requirements, in order to improve the signal amplification specificity, more accurate responsiveness and stability of the composite nano material, the molecular weight of the cationic polymer is preferably 600-30000 Da, more preferably 1800-25000 Da, more preferably 5000-20000 Da, more preferably 10000-15000 Da.
In the manganese dioxide/nucleic acid probe composite nanomaterial, the proportion of the cationic polymer is not particularly limited in principle, and can be adjusted by a person skilled in the art according to application conditions, application requirements or product performance requirements, in order to improve the signal amplification specificity and more accurate responsiveness and stability of the composite nanomaterial, the mass ratio of the cationic polymer to the double-stranded DNA is preferably (1-20): 1, more preferably (3 to 18): 1, more preferably (5-15): 1, more preferably (8-12): 1.
the morphology of the manganese dioxide is not particularly limited in principle, and can be adjusted by those skilled in the art according to the application condition, application requirements or product performance requirements. The size of the manganese dioxide is preferably 100-250 nm, more preferably 120-220 nm, and more preferably 150-200 nm.
In the manganese dioxide/nucleic acid probe composite nanomaterial, the proportion of manganese dioxide is not particularly limited in principle, and can be adjusted by a person skilled in the art according to application conditions, application requirements or product performance requirements, in order to improve the signal amplification specificity, more accurate responsiveness and stability of the composite nanomaterial, the mass ratio of manganese dioxide to single-stranded DNA is preferably (1-200): 1, more preferably (10 to 180): 1, more preferably (40 to 150): 1, more preferably (70 to 120): 1, more preferably (90-100): 1.
the specific selection of the nucleic acid probe is not particularly limited in principle, and can be adjusted by a person skilled in the art according to application conditions, application requirements or product performance requirements. Wherein, the microRNA preferably comprises one or more of microRNA-21, microRNA-221 and microRNA-155, and more preferably microRNA-21, microRNA-221 or microRNA-155.
The nucleic acid probe consists of double-stranded DNA molecules and single-stranded DNA molecules. The invention is not particularly limited to the specific function of the nucleic acid probe in principle, and the skilled person can adjust the function according to the application condition, the application requirement or the product performance requirement, in order to improve the signal amplification specificity, more accurate responsiveness and stability of the composite nano material, the single-stranded DNA is preferably used as a signal amplification chain; the double-stranded DNA is preferably used as a signal reporter strand. The signal (detection signal) according to the present invention is preferably a fluorescent signal.
The double-stranded DNA molecule preferably comprises a first single-stranded DNA for marking a fluorescent molecule and a second single-stranded DNA for marking a quenching group, and more preferably comprises the first single-stranded DNA for marking the fluorescent molecule and the second single-stranded DNA for marking the quenching group which are obtained by base complementary pairing. The double-stranded DNA molecule of the present invention is preferably used as a reporter for a fluorescence detection signal, i.e., a signal reporter strand. The source of the double-stranded DNA molecule is not particularly limited in the present invention, and the double-stranded DNA molecule may be prepared by a method for preparing such a double-stranded DNA molecule, which is well known to those skilled in the art, or may be commercially available. The sequence of the first single-stranded DNA of the present invention preferably includes one or more of TATCAGACTGATGTTGATTGG, TATCAGACTGATGTTGATTGGT, TATCAGACTGATGTTGATTGGA, TATCAGACTGATGTTGATTGGAT and TATCAGACTGATGTTGATTGGTA, more preferably TATCAGACTGATGTTGATTGG, TATCAGACTGATGTTGATTGGT, TATCAGACTGATGTTGATTGGA, TATCAGACTGATGTTGATTGGAT or TATCAGACTGATGTTGATTGGTA, and still more preferably TATCAGACTGATGTTGATTGG, ATCAGACTGATGTTGATTGGT or TATCAGACTGATGTTGATTGGA. The sequence of the second single-stranded DNA preferably includes one or more of CCAATCAACATCAGTCTGATAAGCTA, ACCAATCAACATCAGTCTGATAAGCTA, TCCAATCAACATCAGTCTGATAAGCTA, ATCCAATCAACATCAGTCTGATAAGCTA and TACCAATCAACATCAGTCTGATAAGCTA, more preferably CCAATCAACATCAGTCTGATAAGCTA, ACCAATCAACATCAGTCTGATAAGCTA, TCCAATCAACATCAGTCTGATAAGCTA, ATCCAATCAACATCAGTCTGATAAGCTA or TACCAATCAACATCAGTCTGATAAGCTA, and more preferably CCAATCAACATCAGTCTGATAAGCTA, ACCAATCAACATCAGTCTGATAAGCTA or TCCAATCAACATCAGTCTGATAAGCTA.
Among them, the single-stranded DNA molecule of the present invention is preferably used as a signal amplification strand, which is an enhancing part of a fluorescence detection signal. The source of the single-stranded DNA molecule is not particularly limited in the present invention, and the single-stranded DNA molecule may be prepared by a method for preparing the single-stranded DNA molecule, which is well known to those skilled in the art, or may be commercially available. The sequence of the single-stranded DNA of the present invention preferably includes one or more of CTTATCAGACTGATGTTGATTGG, CTTATCAGACTGATGTTGATTGGT, CTTATCAGACTGATGTTGATTGGA, CTTATCAGACTGATGTTGATTGGAT and CTTATCAGACTGATGTTGATTGGTA, more preferably CTTATCAGACTGATGTTGATTGG, CTTATCAGACTGATGTTGATTGGT, CTTATCAGACTGATGTTGATTGGA, CTTATCAGACTGATGTTGATTGGAT or CTTATCAGACTGATGTTGATTGGTA, and still more preferably CTTATCAGACTGATGTTGATTGG, CTTATCAGACTGATGTTGATTGGT or CTTATCAGACTGATGTTGATTGGA.
In order to improve the signal amplification specificity, more accurate responsiveness and stability of the composite nanomaterial, the mass ratio of the double-stranded DNA molecules to the single-stranded DNA molecules is preferably 1: (0.1 to 10), more preferably 1: (0.5 to 8), more preferably 1: (1-5), more preferably 1: (2-4).
The invention also provides a preparation method of the manganese dioxide/nucleic acid probe composite nano material, which comprises the following steps:
1) mixing manganese dioxide with a buffer solution, and then uniformly mixing the mixture with single-stranded DNA to obtain a first mixture;
firstly mixing a cationic polymer with a buffer solution, and then carrying out vortex mixing on the cationic polymer and double-stranded DNA to obtain a second mixture;
2) and uniformly mixing the first mixture and the second mixture obtained in the step to obtain the manganese dioxide/nucleic acid probe composite nano material.
In the preparation method of the present invention, the property, structure, proportion and other preferred principles or specific preferred schemes of the raw materials preferably correspond to the property, structure, proportion and other preferred principles or specific preferred schemes of the manganese dioxide/nucleic acid probe composite nanomaterial, and thus are not described in detail herein.
Firstly, mixing manganese dioxide with a buffer solution, and then uniformly mixing the mixture with single-stranded DNA to obtain a first mixture;
the cationic polymer is first mixed with a buffer solution, and then vortexed with double-stranded DNA to obtain a second mixture.
The source of the manganese dioxide is not particularly limited in principle, and those skilled in the art can prepare the manganese dioxide according to well-known methods or purchase the manganese dioxide from the market, and the manganese dioxide is preferably obtained by reacting a divalent manganese salt, an oxidizing agent, a surfactant and water in order to improve the signal amplification specificity, more accurate responsiveness and stability of the composite nanomaterial. Among them, the divalent manganese salt is preferably manganese chloride tetrahydrate.
The selection and parameters of the buffer solution are not particularly limited in principle, and can be adjusted by those skilled in the art according to the application situation, application requirements or product performance requirements, and in order to improve the signal amplification specificity, more accurate responsiveness and stability of the composite nanomaterial, the buffer solution preferably comprises a tris (hydroxymethyl) aminomethane-hydrochloric acid buffer solution and/or a 4-hydroxyethylpiperazine ethanesulfonic acid-hydrochloric acid buffer solution, and more preferably comprises a tris (hydroxymethyl) aminomethane-hydrochloric acid buffer solution or a 4-hydroxyethylpiperazine ethanesulfonic acid-hydrochloric acid buffer solution. The pH value of the buffer solution is preferably 7.2-8.5, more preferably 7.5-8.2, and more preferably 7.8-8.
The mode and parameters of the mixing and the first mixing are not particularly limited in principle, and can be adjusted by those skilled in the art according to the application condition, application requirements or product performance requirements. The mixing time is preferably 5-30 seconds. The time for the first mixing is preferably 5 to 30 seconds.
In the invention, the parameters of the vortex mixing are not particularly limited in principle, and can be adjusted by a person skilled in the art according to application conditions, application requirements or product performance requirements, and in order to improve the signal amplification specificity of the composite nano material and achieve more accurate responsiveness and stability, the time of the vortex mixing is preferably 10-30 seconds.
And finally, uniformly mixing the first mixture and the second mixture obtained in the step to obtain the manganese dioxide/nucleic acid probe composite nano material.
The invention is not particularly limited in principle to the mode and parameters of the uniform mixing, and can be adjusted by those skilled in the art according to the application condition, application requirements or product performance requirements. The time for uniform mixing is preferably 10-30 seconds.
The invention is a complete and refined preparation process, further ensures the signal amplification specificity, more accurate responsiveness and stability of the composite nano material, and preferably also comprises a standing step after uniform mixing. The standing time is preferably 5-40 minutes, more preferably 10-30 minutes, and more preferably 20-30 minutes.
The steps for preparing the manganese dioxide/nucleic acid probe composite nano material can specifically be as follows:
mixing manganese dioxide with an aqueous medium (buffer solution), and then adding single-stranded DNA for mixing; mixing a cationic polymer with an aqueous medium (buffer solution), adding double-stranded DNA, and mixing by vortexing for 30 s; and mixing the two parts uniformly again to obtain the manganese dioxide/nucleic acid probe composite nano probe.
The invention provides a signal specific amplification strategy, under the triggering of tumor high glutathione, single-stranded DNA compounded on manganese dioxide is released, and DNA chain type substitution reaction can be carried out with the double-stranded DNA and target microRNA, so that specific fluorescence signal amplification is realized.
The invention provides a manganese dioxide/nucleic acid probe composite nanoprobe, which can open double-stranded nucleic acid to generate a fluorescent signal under the triggering of highly expressed microRNA in tumor cells; secondly, the single-stranded nucleic acid is released in the tumor cells specifically and rapidly, and the specific amplification of the tumor cell fluorescence signal is realized. The manganese dioxide/nucleic acid probe composite nano probe provided by the invention can realize tumor cell signal amplification; the signal specific amplification strategy provided by the invention enhances the specificity of nucleic acid detection by virtue of the advantages of the nanoparticles. The manganese dioxide/nucleic acid probe composite nano probe prepared by the invention is compounded based on non-covalent bonds, the preparation method is simple and convenient, the detection signal in normal cells can be effectively reduced, and the preparation method has a good application prospect.
The invention also provides an imaging and signal specific amplification material, which comprises the manganese dioxide/nucleic acid probe composite nano material prepared by the preparation method of any one of the technical schemes or the manganese dioxide/nucleic acid probe composite nano material prepared by the preparation method of any one of the technical schemes.
The imaging material is not particularly limited by the present invention, and can be adjusted by one skilled in the art according to the application, application requirements or product performance requirements, and preferably comprises an imaging agent, and more preferably comprises a fluorescence imaging contrast agent. The present invention is not particularly limited to other components in the image forming material (image forming agent) as long as conventional auxiliary components for such an image forming agent are well known to those skilled in the art.
The invention also provides the manganese dioxide/nucleic acid probe composite nanomaterial prepared by any one of the technical schemes, the manganese dioxide/nucleic acid probe composite nanomaterial prepared by the preparation method of any one of the technical schemes, or the application of the imaging material in the tumor detection field.
The invention provides a manganese dioxide/nucleic acid probe composite nano probe capable of being amplified by signal specificity, a preparation method and application thereof. According to the invention, through multiple actions, single-stranded nucleic acid and double-stranded nucleic acid with negative electricity are respectively loaded on manganese dioxide and a cationic polymer, so that the composite nano probe with signal specific amplification is formed. The manganese dioxide/nucleic acid probe composite nano probe provided by the invention can realize specific signal amplification of tumor cells, and can open double-stranded nucleic acid to generate a fluorescent signal under the triggering of high-expression microRNA in the tumor cells; secondly, single-stranded nucleic acid is released in the tumor cells specifically and rapidly to realize the specific amplification of the tumor cell fluorescence signals, and the amplified nucleic acid signals are generated under the triggering of microRNA of the nucleic acid molecules with specific and high expression of the tumor, so that the signals in normal cells are further reduced compared with a nano probe system without participation of tumor response nano particles.
The invention realizes signal amplification in tumor cells by virtue of the tumor microenvironment responsiveness of the nanoparticles, does not amplify signals in normal cells, can greatly simplify the sequence design of a specific signal amplification probe, and can also meet the requirement of specificity at the same time. Meanwhile, the composite nano probe provided by the invention is compounded based on non-covalent bonds, is simple to prepare and mild in condition, can effectively reduce detection signals in normal cells, and has universality and good application prospect.
Experimental results show that tumor cells incubated with the manganese dioxide/nucleic acid probe composite nanoprobe provided by the invention have stronger signals, and normal cells incubated with the manganese dioxide/nucleic acid probe composite nanoprobe provided by the invention have weaker signals.
For further illustration of the present invention, the manganese dioxide/nucleic acid probe composite nanomaterial and the preparation method and application thereof provided by the present invention are described in detail below with reference to the following examples, but it should be understood that the examples are implemented on the premise of the technical scheme of the present invention, and the detailed embodiments and specific procedures are given only for further illustration of the features and advantages of the present invention, but not for limitation of the claims of the present invention, and the scope of protection of the present invention is not limited to the following examples.
Examples 1 to 23
Preparation of manganese dioxide/nucleic acid probe composite nano probe
Dissolving manganese chloride tetrahydrate in water, quickly adding the dissolved manganese chloride tetrahydrate into a mixed solution of 30% hydrogen peroxide and 25% tetramethylammonium hydroxide, mixing the three reactant solutions, reacting at 25 ℃ for 12 hours, centrifuging at 8000rpm for 15min, repeatedly washing the centrifuged product with water and methanol, centrifuging again, and vacuum-drying the centrifuged product to obtain the manganese dioxide nanosheet. And (3) compounding the manganese dioxide nanosheets and the single-stranded DNA at different mass ratios (examples 1 to 7) to obtain a manganese dioxide/single-stranded DNA compound.
Referring to table 1, table 1 shows the mass ratio of the manganese dioxide nanosheet to the single-stranded DNA in examples 1 to 7 of the present invention.
The cationic polymer and the double-stranded DNA are compounded in different mass ratios (examples 8 to 15) to obtain the cationic polymer/double-stranded DNA compound.
Referring to table 2, table 2 shows the mass ratio of the manganese dioxide nanosheet to the double-stranded DNA in examples 8 to 15 of the present invention.
Manganese dioxide and a cationic polymer are compounded according to different mass ratios (examples 16-23) to obtain the final manganese dioxide/nucleic acid probe composite nano probe.
Referring to table 3, table 3 shows the mass ratio of the manganese dioxide nanosheets to the cationic polymer in examples 16-23 of the present invention.
TABLE 1
| Examples | Mass ratio of manganese dioxide to single-stranded |
| 1 | 10 |
| 2 | 20 |
| 3 | 40 |
| 4 | 80 |
| 5 | 100 |
| 6 | 150 |
| 7 | 200 |
TABLE 2
TABLE 3
| Examples | Cationic polymers | Mass ratio of manganese dioxide to cationic polymer |
| 16 | Polyethylene imine | 40 |
| 17 | Polyethylene imine | 80 |
| 18 | Imidazole-modified polyethyleneimine | 40 |
| 19 | Imidazole-modified polyethyleneimine | 80 |
| 20 | Polylysine | 40 |
| 21 | Polylysine | 80 |
| 22 | Imidazole-modified polylysine | 40 |
| 23 | Imidazole-modified polylysine | 80 |
In examples 16 to 23, the mass ratio of the manganese dioxide nanosheet to the single-stranded DNA was 80, and the mass ratio of the cationic polymer to the double-stranded DNA was 2.5.
The manganese dioxide/nucleic acid probe composite nanoprobes prepared in the embodiment of the invention are characterized.
Referring to fig. 1, fig. 1 is a transmission electron microscope image of a manganese dioxide/nucleic acid probe composite nanoprobe prepared in example 18 of the present invention.
As can be seen from FIG. 1, the manganese dioxide/nucleic acid probe composite nanoprobe prepared by the invention has a sheet structure, and the sheet structure is not affected after the imidazole modified polyethyleneimine is coordinated with manganese dioxide.
Referring to fig. 2, fig. 2 is a uv-vis spectrum of manganese dioxide/nucleic acid probe composite nanoprobe prepared in example 18 of the present invention.
As can be seen from fig. 2, the effect between manganese dioxide prepared according to the present invention and imidazole-modified polyethyleneimine is a coordination effect.
Example 24
1) Fluorescent response of manganese dioxide/nucleic acid probe composite nano probe to microRNA-21 with different concentrations
Dispersing the manganese dioxide/nucleic acid probe composite nano-probe prepared in the example 18 in a buffer solution, adding microRNA-21 with different concentrations, reacting at 37 ℃ for 4h, and then testing a fluorescent signal;
dispersing the manganese dioxide/nucleic acid probe composite nanoprobe prepared in the example 18 in a buffer solution, adding 2mM glutathione for reaction for 5min, adding microRNA-21 with different concentrations, reacting for 4h at 37 ℃, testing a fluorescence signal,
referring to fig. 3, fig. 3 is a graph showing fluorescence intensities of the manganese dioxide/nucleic acid probe composite nanoprobe provided by the present invention after reacting with micrornas with different concentrations for a period of time in the presence of glutathione.
The intensity of fluorescence signals generated by different concentrations of microRNA-21 under the condition of existence and absence of 2mM glutathione in the manganese dioxide/nucleic acid probe composite nanoprobe prepared in example 18 of figure 3 shows that higher fluorescence signals can be triggered by high glutathione under the condition of the same concentration of microRNA-21.
2) Culture of cells
MCF-7 tumor cells and CHO non-tumor cells were cultured in a medium containing 10% fetal bovine serum at 37 ℃ in an incubator. Logarithmic growthCells of stage 5X 10 per well4The density of cells was plated in six-well plates and incubated overnight in a 37 ℃ incubator.
3) Manganese dioxide/nucleic acid probe composite nano probe for detecting microRNA in cells
The manganese dioxide/nucleic acid probe composite nanoprobes prepared in example 18 were added to MCF-7 tumor cells and CHO non-tumor cells, respectively, and after culturing in an incubator at 37 ℃ for 4 hours, the average fluorescence intensity in the cells was analyzed by flow cytometry.
The above process is detected. Referring to FIG. 4, FIG. 4 is a graph showing the mean fluorescence intensity of the manganese dioxide/nucleic acid probe composite nanoprobe co-cultured with MCF-7 tumor cells and CHO non-tumor cells, respectively.
As can be seen from FIG. 4, the manganese dioxide/nucleic acid probe composite nanoprobe prepared in example 18 of the present invention can trigger MCF-7 tumor cells to generate comparable fluorescence signals, while generating significantly reduced fluorescence signals in CHO normal cells, compared to pure cationic polymer/nucleic acid probe composite nanoprobe.
While the manganese dioxide/nucleic acid probe composite nanoprobes of the present invention, which can be amplified with specificity to signal and methods for their preparation, imaging and signal specific amplification materials, and applications thereof have been described in detail above, the principles and embodiments of the present invention are described herein with particular reference to examples, which are provided only to facilitate the understanding of the methods and their core concepts, including the best mode, and to enable any person skilled in the art to practice the invention, including making and using any devices or systems and performing any incorporated methods. It should be noted that, for those skilled in the art, it is possible to make various improvements and modifications to the present invention without departing from the principle of the present invention, and those improvements and modifications also fall within the scope of the claims of the present invention. The scope of the invention is defined by the claims and may include other embodiments that occur to those skilled in the art. Such other embodiments are intended to be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims, or if they include equivalent structural elements with insubstantial differences from the literal languages of the claims.
Claims (10)
1. The manganese dioxide/nucleic acid probe composite nanomaterial is characterized by comprising manganese dioxide, a cationic polymer and a nucleic acid probe;
the nucleic acid probe consists of double-stranded DNA molecules and single-stranded DNA molecules.
2. The composite nanomaterial of claim 1, wherein the composite nanomaterial is a composite nanoprobe;
the single-stranded DNA is compounded on the manganese dioxide;
the double-stranded DNA is complexed with the cationic polymer;
the cationic polymer is complexed on the manganese dioxide.
3. The composite nanomaterial of claim 1, wherein the cationic polymer comprises one or more of polyethyleneimine, imidazole-modified polyethyleneimine, polylysine, and imidazole-modified polylysine;
the molecular weight of the cationic polymer is 600-30000 Da;
the mass ratio of the manganese dioxide to the single-stranded DNA is (1-200): 1;
the mass ratio of the cationic polymer to the double-stranded DNA is (1-20): 1;
the mass ratio of the double-stranded DNA to the single-stranded DNA is 1: (0.1-10).
4. The composite nanomaterial of claim 1, wherein the manganese dioxide comprises manganese dioxide nanoplates and/or manganese dioxide nanospheres;
the size of the manganese dioxide is 100-250 nm;
the nucleic acid probe is used for detecting microRNA;
the single-stranded DNA is a signal amplification strand; the double-stranded DNA is a signal reporter strand.
5. The composite nanomaterial of claim 4, wherein the microRNA comprises one or more of microRNA-21, microRNA-221, and microRNA-155;
the double-stranded DNA is compounded on the cationic polymer through electrostatic interaction;
the single-stranded DNA is compounded on the manganese dioxide through various non-covalent bonds;
the complexing mode of the cationic polymer and the manganese dioxide comprises complexation;
the nucleic acid probe is designed aiming at high-expression microRNA in tumor cells.
6. The composite nanomaterial according to any of claims 1 to 5, wherein the sequence of the single-stranded DNA comprises one or more of CTTATCAGACTGATGTTGATTGG, CTTATCAGACTGATGTTGATTGGT, CTTATCAGACTGATGTTGATTGGA, CTTATCAGACTGATGTTGATTGGAT and CTTATCAGACTGATGTTGATTGGTA;
the double-stranded DNA molecule consists of a first single-stranded DNA for marking a fluorescent molecule and a second single-stranded DNA for marking a quenching group;
the sequence of the first single-stranded DNA comprises one or more of TATCAGACTGATGTTGATTGG, TATCAGACTGATGTTGATTGGT, TATCAGACTGATGTTGATTGGA, TATCAGACTGATGTTGATTGGAT and TATCAGACTGATGTTGATTGGTA;
the sequence of the second single-stranded DNA comprises one or more of CCAATCAACATCAGTCTGATAAGCTA, ACCAATCAACATCAGTCTGATAAGCTA, TCCAATCAACATCAGTCTGATAAGCTA, ATCCAATCAACATCAGTCTGATAAGCTA and TACCAATCAACATCAGTCTGATAAGCTA;
the double-stranded DNA molecule is composed in a manner that involves base complementary pairing.
7. The preparation method of the manganese dioxide/nucleic acid probe composite nano material is characterized by comprising the following steps of:
1) mixing manganese dioxide with a buffer solution, and then uniformly mixing the mixture with single-stranded DNA to obtain a first mixture;
firstly mixing a cationic polymer with a buffer solution, and then carrying out vortex mixing on the cationic polymer and double-stranded DNA to obtain a second mixture;
2) and uniformly mixing the first mixture and the second mixture obtained in the step to obtain the manganese dioxide/nucleic acid probe composite nano material.
8. The method according to claim 7, wherein the buffer comprises tris-hydrochloric acid buffer and/or 4-hydroxyethylpiperazine ethanesulfonic acid-hydrochloric acid buffer;
the vortex mixing time is 10-30 seconds;
the pH value of the buffer solution is 7.2-8.5;
the step of standing is also included after the uniform mixing;
the standing time is 5-40 minutes.
9. An imaging and signal specific amplification material, which is characterized by comprising the manganese dioxide/nucleic acid probe composite nanomaterial according to any one of claims 1 to 6 or the manganese dioxide/nucleic acid probe composite nanomaterial prepared by the preparation method according to any one of claims 7 to 8;
the imaging material includes a fluorescence imaging contrast agent.
10. The manganese dioxide/nucleic acid probe composite nanomaterial according to any one of claims 1 to 6, the manganese dioxide/nucleic acid probe composite nanomaterial prepared by the preparation method according to any one of claims 7 to 8, or the imaging material according to claim 9, and is applied to the field of tumor detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910655848.0A CN110904224A (en) | 2019-07-19 | 2019-07-19 | Manganese dioxide/nucleic acid probe composite nano probe capable of being amplified by signal specificity and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910655848.0A CN110904224A (en) | 2019-07-19 | 2019-07-19 | Manganese dioxide/nucleic acid probe composite nano probe capable of being amplified by signal specificity and preparation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110904224A true CN110904224A (en) | 2020-03-24 |
Family
ID=69814414
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910655848.0A Pending CN110904224A (en) | 2019-07-19 | 2019-07-19 | Manganese dioxide/nucleic acid probe composite nano probe capable of being amplified by signal specificity and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110904224A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105950150A (en) * | 2016-03-16 | 2016-09-21 | 深圳大学 | Core/shell-type multifunctional nano material and preparation method thereof |
| CN107988351A (en) * | 2017-12-14 | 2018-05-04 | 福州大学 | A kind of application of cyclic DNA in the detection, imaging and gene therapy of just RNA |
| CN108273056A (en) * | 2018-02-01 | 2018-07-13 | 中国科学院长春应用化学研究所 | A kind of modified gold nano-material/nucleic acid probe nanometer system and preparation method thereof, application |
-
2019
- 2019-07-19 CN CN201910655848.0A patent/CN110904224A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105950150A (en) * | 2016-03-16 | 2016-09-21 | 深圳大学 | Core/shell-type multifunctional nano material and preparation method thereof |
| CN107988351A (en) * | 2017-12-14 | 2018-05-04 | 福州大学 | A kind of application of cyclic DNA in the detection, imaging and gene therapy of just RNA |
| CN108273056A (en) * | 2018-02-01 | 2018-07-13 | 中国科学院长春应用化学研究所 | A kind of modified gold nano-material/nucleic acid probe nanometer system and preparation method thereof, application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yi et al. | Nanoscale zeolitic imidazolate framework-8 for ratiometric fluorescence imaging of microRNA in living cells | |
| Zhang et al. | An “off–on” electrochemiluminescent biosensor based on DNAzyme-assisted target recycling and rolling circle amplifications for ultrasensitive detection of microRNA | |
| Ou et al. | MnO 2 nanosheet mediated “DD–A” FRET binary probes for sensitive detection of intracellular mRNA | |
| Zhang et al. | Multiplexed detection of microRNAs by tuning DNA-scaffolded silver nanoclusters | |
| Yu et al. | Combining padlock exponential rolling circle amplification with CoFe2O4 magnetic nanoparticles for microRNA detection by nanoelectrocatalysis without a substrate | |
| Wang et al. | MnO 2 nanosheets as a carrier and accelerator for improved live-cell biosensing application of CRISPR/Cas12a | |
| CN109913546B (en) | Fluorescent biological probe for detecting miRNA, detection method and application | |
| WO2018054390A1 (en) | Preparation method for satellite-shaped nanoassembly used for intracellular cancer marker dual detection, and application | |
| Yin et al. | Dual-wavelength electrochemiluminescence biosensor based on a multifunctional Zr MOFs@ PEI@ AuAg nanocomposite with intramolecular self-enhancing effect for simultaneous detection of dual microRNAs | |
| Cheng et al. | CRISPR/Cas12a-Modulated fluorescence resonance energy transfer with nanomaterials for nucleic acid sensing | |
| Jiang et al. | Ultrasensitive CRISPR/Cas13a-mediated photoelectrochemical biosensors for specific and direct assay of miRNA-21 | |
| Zhou et al. | Chemiluminescence sensor for miRNA-21 detection based on CRISPR-Cas12a and cation exchange reaction | |
| CN109837326A (en) | The biological target molecular detecting method of output signal is captured and amplified based on multivalence | |
| CN106957908B (en) | method for detecting miRNA and/or target molecule with aptamer and detection probe | |
| Tang et al. | A triple-amplification strategy based on the formation of peroxidase-like two-dimensional DNA/Fe 3 O 4 networks initiated by the hybridization chain reaction for highly sensitive detection of microRNA | |
| CN113512578B (en) | miRNA chemiluminescence detection kit based on constant-temperature enzyme-free multistage amplification | |
| Gao et al. | The self-powered electrochemical biosensing platform with multi-amplification strategy for ultrasensitive detection of microRNA-155 | |
| CN111220666A (en) | Efficient miRNA detection based on hemin-induced biocatalysis photoelectric sensitive interface | |
| CN110628874B (en) | Method for ultrasensitively detecting miRNA (micro ribonucleic acid) based on poly (A) tailing and biological cycle luminescence technology for non-diagnosis purpose | |
| Trinh et al. | Physical and chemical template-blocking strategies in the exponential amplification reaction of circulating microRNAs | |
| Cui et al. | Target-triggered, self-powered DNAzyme–MnO 2 nanosystem: towards imaging microRNAs in living cells | |
| CN113265448A (en) | Method for improving sensitivity and specificity of real-time fluorescence PCR (polymerase chain reaction) based on graphene oxide | |
| Chen et al. | A cancer cell membrane vesicle-packaged DNA nanomachine for intracellular microRNA imaging | |
| CN110618112B (en) | Preparation method and application of aptamer fluorescence sensor based on AuNPs @ ZIF-8 | |
| Cui et al. | An intelligent, autocatalytic, DNAzyme biocircuit for amplified imaging of intracellular microRNAs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200324 |