CN110904210B - Autosomal dominant Dnajc17 gene mutant and application thereof, diagnostic kit and diagnostic gene chip - Google Patents

Autosomal dominant Dnajc17 gene mutant and application thereof, diagnostic kit and diagnostic gene chip Download PDF

Info

Publication number
CN110904210B
CN110904210B CN201911164469.8A CN201911164469A CN110904210B CN 110904210 B CN110904210 B CN 110904210B CN 201911164469 A CN201911164469 A CN 201911164469A CN 110904210 B CN110904210 B CN 110904210B
Authority
CN
China
Prior art keywords
dnajc17
gene
mutant
deafness
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201911164469.8A
Other languages
Chinese (zh)
Other versions
CN110904210A (en
Inventor
刘�东
段旭初
张鲁平
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nantong University
Original Assignee
Nantong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nantong University filed Critical Nantong University
Priority to CN201911164469.8A priority Critical patent/CN110904210B/en
Publication of CN110904210A publication Critical patent/CN110904210A/en
Application granted granted Critical
Publication of CN110904210B publication Critical patent/CN110904210B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an autosomal dominant Dnajc17 gene mutant and application thereof, a diagnostic kit and a diagnostic gene chip, wherein the mutation site of the mutant is that the 401 th nucleotide A of a Dnajc17 gene coding region on a 15 th chromosome of a human is mutated into C (c.401A > C), so that the 134 th amino acid of a protein sequence of the mutant is mutated from glutamic acid E into alanine A (p.E134A). According to the invention, exome sequencing analysis and animal experiment verification are carried out on members of the deafness family, and the Dnajc17 is found to have obvious correlation with occurrence of deafness and is an important inducer of hereditary deafness.

Description

Autosomal dominant Dnajc17 gene mutant and application thereof, diagnostic kit and diagnostic gene chip
Technical Field
The invention belongs to the technical field of biomedicine, and particularly relates to an autosomal dominant Dnajc17 gene mutant and application thereof, a diagnostic kit and a diagnostic gene chip.
Background
Deafness is one of the most common diseases causing human communication disorder, and brings great pain and inconvenience to patients. More than 4 million people are afflicted with deafness throughout the world, and about 40% of the elderly over 65 have deafness. Because the current treatment means aiming at deafness is still very limited, the discovery and diagnosis of the occurrence of deafness diseases as early as possible have important significance for the prevention and treatment of the diseases.
Genetic factors are important reasons for deafness, more than 400 genetic syndromes of deafness are found, and variation of more than 100 genes is related to deafness. Most deafness is sensorineural deafness, i.e., caused by loss of function of the inner ear in receiving and transmitting sound signals. Hair cells are auditory perception cells, and their main functions are to sense sound and convert acoustic signals into electrical signals to be transmitted to the brain. The damage and decrease of hair cells are the leading causes of the occurrence of sensorineural deafness. Research shows that many deafness related gene mutations can cause abnormal development and structural function damage of hair cells, and further cause hearing loss. Therefore, the discovery and research of deafness-related genes are necessary preconditions for people to know the genetic mechanism of deafness occurrence, and provide new ideas and targets for the development of early diagnosis and prevention strategies of hereditary deafness.
Molecular chaperones are proteins with similar functions in cells, and generally play an important role in maintaining protein homeostasis in organisms by regulating the processes of translation, folding, transport, degradation and the like of other proteins in cells. Dnajc17 is a heat shock protein, also a molecular chaperone protein, the role of which is related to the exertion of a plurality of basic functions of cells, and can regulate the protein expression and mRNA selective shearing and splicing process in the cells through interacting with a plurality of proteins related to protein synthesis and mRNA precursor splicing, thereby regulating various vital activities of the cells and influencing the stability of the internal environment of the cells. There are studies showing that some other proteins of the Dnajc17 family, such as Dnajc5 and Dnajc14, are involved in the development of inner ear hair cells or maintenance of hearing function, but there is no direct evidence to show the relationship between Dnajc17 and the occurrence of deafness, or to confirm that the genetic mutation is one of the genetic factors for the occurrence of deafness.
Disclosure of Invention
In order to solve the problems in the prior art, the invention provides an autosomal dominant Dnajc17 gene mutant and application thereof, a diagnostic kit and a diagnostic gene chip thereof, and the invention adopts a second-generation sequencing technology, and discovers that the Dnajc17 mutant has obvious correlation with deafness through exome sequencing analysis and animal experiment verification on members of the deafness family.
In order to achieve the purpose, the invention adopts the technical scheme that:
an autosomal dominant Dnajc17 gene mutant, the nucleotide sequence of which is shown in SEQ ID NO 2.
Furthermore, the mutation site is that the 401 st nucleotide A of the coding region of the Dnajc17 gene (SEQ ID NO: 1) on the 15 th chromosome of a human is mutated into C (C, 401A > C, p, E134A), and the mutation is heterozygote, and sequence analysis shows that the deletion mutation at the position causes the amino acid mutation of the protein coded by the Dnajc17 gene, so that the 134 nd amino acid residue in the original wild type Dnajc17 protein is changed from glutamic acid (E) into alanine (A).
An application of autosomal dominant Dnajc17 gene mutant in preparing deafness diagnostic kit.
A diagnostic kit of autosomal dominant Dnajc17 gene mutant comprises a genome DNA extraction system and a PCR reaction system, wherein: the genome DNA extraction system comprises a QIAmp Blood Kit, and the PCR reaction system contains a primer sequence for specifically amplifying a gene sequence of SEQ ID NO. 2 and a primer sequence for sequencing a PCR amplification product.
Further, the PCR reaction system comprises an amplification system and a primer system, wherein the amplification system is PrimeSTAR HS DNA Polymerase reagent; the primer system comprises a specific amplification primer and a sequencing primer of the Dnajc17 gene mutant, wherein the specific amplification upstream primer sequence of the Dnajc17 gene mutant is shown as SEQ ID NO. 3, the specific amplification downstream primer sequence of the Dnajc17 gene mutant is shown as SEQ ID NO. 4, and the sequencing primer sequence of the Dnajc17 gene mutant is shown as SEQ ID NO. 5.
Further, the diagnostic kit comprises:
genome DNA extraction System:
QIAmp Blood Kit；
and (3) PCR system:
PrimeSTAR HS DNA Polymerase50μL；
buffer 100μL；
dNTP Mixture(2.5mM each)250μL；
specific amplification upstream primer of Dnajc17 gene mutant 1 tube, 10. Mu.M, 100. Mu.L/tube;
specific amplification downstream primer of Dnajc17 gene mutant 1 tube, 10 muM, 100 muL/tube;
sequencing of Dnajc17 Gene mutants primers 1 tube, 10. Mu.M, 100. Mu.L/tube.
A diagnostic gene chip of autosomal dominant Dnajc17 gene mutant is provided with a probe for detecting the Dnajc17 gene mutant of a nucleotide sequence shown in SEQ ID NO. 2 and a gene chip for detecting autosomal dominant non-syndromic deafness diagnosis by using the probe.
Furthermore, the probe sequence of the Dnajc17 gene mutant is shown as SEQ ID NO. 6 and SEQ ID NO. 7.
Furthermore, in the application of the gene chip, the nucleic acid probe of the Dnajc17 gene mutant is hybridized with the Dnajc17 gene in a sample to be detected to generate a fluorescent signal, and whether the gene mutation occurs in the Dnajc17 sequence of the sample to be detected is reflected through the strength of the signal.
Compared with the prior art, the invention has the following beneficial effects:
the invention provides a diagnostic kit and a diagnostic gene chip for early diagnosis and early intervention treatment of deafness, has great clinical application value, and can be used for screening high risk groups of deafness.
Drawings
FIG. 1 is a family map of a patient with deafness, which is found clinically.
FIG. 2 shows the loci of Dnajc17 mutations in deaf patients as found by exome sequencing analysis.
FIG. 3 is a diagram showing the expression verification of the Dnajc17 gene in hair cells in zebra fish in an animal model.
FIG. 4 is a schematic diagram showing that the Dnajc17 gene is down-regulated in zebrafish resulting in a reduction in hair cell number.
FIG. 5 is a diagram showing the decrease in the ability of zebrafish to respond to a sound stimulus by a stress behavior after the Dnajc17 gene is down-regulated.
Detailed Description
The present invention will be further described with reference to the following examples.
An autosomal dominant Dnajc17 gene mutant, the nucleotide sequence of which is shown in SEQ ID NO. 2, specifically, the mutation site is that the 401 th nucleotide A of the Dnajc17 gene coding region on the 15 th chromosome of human is mutated into C (C, 401A > C), which results in that the 134 th amino acid of the protein sequence is mutated from glutamic acid E into alanine A (p, E134A).
Example 1
The invention discovers that the mutation (C, 401A > C, p, E134A) of the chromosome 15 Dnajc17 gene of a human and the occurrence of deafness have obvious relevance by carrying out exome sequencing on an autosomal dominant non-syndromic deafness family. And it was concluded therefrom that Dnajc17 could be a biomarker for the diagnosis of deafness.
Dnajc17 is verified to be related to deafness, namely the Dnajc17 is determined to be used as a biomarker for deafness diagnosis: the method comprises the following steps:
first, sample preparation: clinically, a family of acquired deafness (shown in figure 1) is found, wherein 9 acquired deaf patients have been diagnosed, and peripheral blood samples of deaf patients (experimental group, 9 persons) and non-deaf individuals (9 persons) in the family are respectively extracted.
Secondly, sequencing the exome of the sample and analyzing pathogenic mutant genes: sequencing analysis was performed on each group of blood using whole exome sequencing technology. The specific content comprises the following steps: the sequences of the exon and peripheral intron regions, microRNA sequences and other non-coding genes of all the expressed genes in each sample were captured by Illumina TruSeq exterior Enrichment Kit and determined by HiSeq 2000 sequencer (Illumina, san Diego, calif., USA). The sequences tested were analyzed by alignment with the NCBI37/hg19 database. SNP and DNA deletion sites were identified using SOAPsnp software and GATK Indel Genotyper software, respectively. Through comparison with control genome data, candidate pathogenic mutant genes are screened and searched, and the 401 th nucleotide A of the Dnajc17 gene is finally determined to be mutated into C (C, 401A > C, p, E134A), the mutation site has high correlation with the occurrence of deafness in the family (as shown in figure 2), and the mutation site has obvious coseparation in the family. The sequencing results for 18 subjects were: 9 deaf patients develop the mutation at the site; none of the 9 hearing normal persons had this site mutation.
Thirdly, verifying the expression of the Dnajc17 gene in neural hills in a hair cell enrichment region by using a zebra fish animal model: the hair cells, i.e. the auditory perception cells, mainly function to sense sound and convert acoustic signals into electrical signals which are then transmitted to the brain. The damage and decrease of hair cells are the most main causes of occurrence of sensorineural deafness. In the zebra fish body, the otolith and the lateral nerve colliculus of the head are areas with abundant hair cells, so the invention uses the nucleic acid in situ hybridization technology to confirm that the Dnajc17 gene has high expression in the otolith and the lateral nerve colliculus of the zebra fish (as shown in figure 3). The specific process is as follows: designing an in-situ hybridization probe by taking a gene coding region sequence of Dnajc17 as a template, amplifying the probe sequence by PCR and constructing the probe sequence into T-easy clone plasmid, preparing an RNA probe with a fluorescent label by using an in-vitro transcription kit, mixing the probe and a fixed 72h zebra fish embryo, carrying out incubation hybridization at 70 ℃, adding an antibody after the hybridization is finished, carrying out a color reaction and observing the result. FIG. 3 is a nucleic acid in situ hybridization analysis of the zebrafish Dnajc17 gene, wherein the red triangles and the boxes indicate blue regions or dots indicating the expression region of Dnajc17, coinciding with the zebrafish otolith and lateral neurostimulator locations, indicating that Dnajc17 is highly expressed in the zebrafish otolith and neurostimulator (hair cell aggregation region).
Fourthly, the danajc 17 gene expression is proved to be reduced to cause the reduction of hair cell number and the reduction of the ability of the danio rerio to stress behaviors caused by sound stimulation by using a danio rerio animal model, and the function of the Dnajc17 gene is proved to be related to the hair cell development process and the hearing function of the danio rerio (as shown in figure 4 and figure 5).
The invention utilizes zebra fish with hair cell specific fluorescent marker (Brn 3C) as an object, microinjects a Mophonino reagent targeting Dnajc17 gene into the embryo of the zebra fish to reduce the expression of the gene, observes the change of the content of the fluorescent marker hair cells in the treated zebra fish embryo, and simultaneously measures and analyzes the hearing behavior of the zebra fish with the Dnajc17 gene reduced. The results in FIG. 4 show that the number of fluorescently labeled hair cells in zebrafish embryos was significantly reduced (reduction of green fluorescent spots) after the Dnajc17 gene was down-regulated by Mopholino. FIG. 5 is a test of the audiological behavior of zebrafish after the Dnajc17 gene was down-regulated, and the results showed that the down-regulation of Dnajc17 resulted in a decrease in the ability of the zebrafish to respond to the sound stimuli, compared to the Control (Control), which responded to the sounds with a swimming time of 0.12 and 0.24s after the sounds were heard, whereas the zebrafish after the gene down-regulation responded very weakly and hardly observed in the same time period.
Example 2
An application of the autosomal dominant Dnajc17 gene mutant in preparing the deafness diagnosing reagent kit.
The nucleotide sequence of the autosomal dominant Dnajc17 mutant is shown as SEQ ID NO:2, the specific PCR upstream and downstream primers are designed through Primer 5, the Invitrogen company is responsible for Primer synthesis, the purity is PAGE grade, the synthesized primers are dissolved by RNase free H2O, and the total concentration is 10 mu M.
A diagnostic kit for an autosomal dominant Dnajc17 gene mutant comprises:
(a) DNA extraction System:
QIAmp Blood Kit；
(b) And (3) PCR system:
PrimeSTAR HS DNA Polymerase 50μL；
buffer 100μL；
dNTP Mixture(2.5mM each)250μL；
specific amplification upstream primer (SEQ ID NO: 3) of Dnajc17 gene mutant, 1 tube, 10. Mu.M, 100. Mu.L/tube;
specific amplification downstream primer (SEQ ID NO: 4) of Dnajc17 gene mutant, 1 tube, 10 muM, 100 muL/tube;
sequencing primers for Dnajc17 Gene mutant (SEQ ID NO: 5), 1 tube, 10. Mu.M, 100. Mu.L/tube.
Example 3
Sequence detection of Dnajc17 gene in peripheral blood cells of deaf patients
A genomic DNA sample in peripheral Blood of a deaf patient is extracted by using a QIAmp Blood Kit, the 260/280 ratio of the sample is ensured to reach more than 1.8, and the sample is placed at the temperature of minus 20 ℃ for storage.
The Dnajc17 expression sequence is amplified by PCR, and the reaction system is as follows:
5×PrimeSTAR Buffer (Mg 2+ Plus) 10 μl
dNTP mixture (2.5 mM each) 4 μl
Dnajc17 primer1 (10 μM) 1 μl
Dnajc17 primer2 (10 μM) 1 μl
gDNA template (100ng/μl) 1 μl
PrimeSTAR HS DNA Polymerase 0.5 μl
dd H 2 O 32.5 μl
PCR conditions were as follows: 5min at 95 ℃ (30s, 55 ℃ 30s, 2 min at 72 ℃ for 40 cycles), 5min at 72 ℃.
Sequencing and result analysis:
the PCR reaction product of Dnajc17 is sent to a biological company for sequence determination, the obtained sequence is compared with a reference sequence to find out the mutant base in the sequence, the mutant base is compared with a wild type Dnajc17 reference sequence (SEQ ID: NO: 1), and if the Dnajc17 of a sample to be detected has base mutation corresponding to the mutant Dnajc17 (SEQ ID: NO: 2), the sample to be detected is judged to be positive for the hereditary hearing loss disease.
Example 4
A diagnostic gene chip of autosomal dominant Dnajc17 gene mutant has a probe for detecting the Dnajc17 gene mutant of the nucleotide sequence shown in SEQ ID NO. 2.
The probe sequences of the Dnajc17 gene mutant are shown in SEQ ID NO. 6 and SEQ ID NO. 7.
As described above, the reference sequence of the wild type Dnajc17 is shown in SEQ ID NO: 1:
SEQ ID:NO:1：
ATGGCAGTGACCAAGGAGCTCTTACAGATGGACCTGTACGCGCTGCTAGGCATTGAGGAGAAGGCAGCGGACAAAGAGGTAAAGAAGGCGTATAGGCAGAAGGCCCTCTCCTGCCACCCAGACAAAAATCCAGATAATCCCAGAGCAGCTGAACTCTTCCACCAGCTTTCTCAGGCCTTGGAGGTGCTGACCGATGCTGCAGCCAGGGCTGCATATGACAAGGTCAGGAAAGCCAAGAAGCAAGCAGCAGAGAGGACCCAGAAACTTGATGAGAAAAGGAAGAAAGTGAAGCTTGACCTGGAGGCCCGGGAGCGGCAGGCCCAGGCCCAGGAGAGTGAGGAGGAAGAGGAGAGCCGGAGCACCAGGACACTAGAGCAAGAGATCGAACGCCTGAGAGAAGAGGGTTCCCGGCAGCTGGAGGAACAGCAGAGGCTCATCCGGGAGCAGATACGCCAGGAGCGTGACCAGAGGTTGAGAGGAAAGGCAGAAAATACTGAAGGCCAAGGAACCCCCAAACTAAAGCTAAAATGGAAGTGCAAGAAGGAGGATGAGTCAAAAGGTGGCTACTCCAAAGACGTCCTCCTACGGCTTTTGCAGAAGTATGGTGAGGTTCTCAACCTGGTGCTTTCCAGTAAGAAGCCAGGCACTGCTGTGGTGGAGTTTGCAACCGTCAAGGCAGCGGAGCTGGCTGTCCAGAATGAAGTTGGCCTGGTGGATAACCCTCTGAAGATTTCCTGGTTGGAGGGACAGCCCCAGGATGCCGTGGGCCGCAGCCACTCAGGACTGTCAAAGGGCTCAGTGCTGTCAGAGAGGGACTACGAGAGCCTCGTCATGATGCGCATGCGCCAGGCGGCCGAGCGGCAACAGCTGATCGCACGGATGCAGCAGGAAGACCAGGAGGGGCCGCCTACGTAG
the nucleotide sequence of the mutant is shown as SEQ ID NO: 2:
SEQ ID:NO:2：
ATGGCAGTGACCAAGGAGCTCTTACAGATGGACCTGTACGCGCTGCTAGGCATTGAGGAGAAGGCAGCGGACAAAGAGGTAAAGAAGGCGTATAGGCAGAAGGCCCTCTCCTGCCACCCAGACAAAAATCCAGATAATCCCAGAGCAGCTGAACTCTTCCACCAGCTTTCTCAGGCCTTGGAGGTGCTGACCGATGCTGCAGCCAGGGCTGCATATGACAAGGTCAGGAAAGCCAAGAAGCAAGCAGCAGAGAGGACCCAGAAACTTGATGAGAAAAGGAAGAAAGTGAAGCTTGACCTGGAGGCCCGGGAGCGGCAGGCCCAGGCCCAGGAGAGTGAGGAGGAAGAGGAGAGCCGGAGCACCAGGACACTAGAGCAAGAGATCGAACGCCTGAGAGAAGCGGGTTCCCGGCAGCTGGAGGAACAGCAGAGGCTCATCCGGGAGCAGATACGCCAGGAGCGTGACCAGAGGTTGAGAGGAAAGGCAGAAAATACTGAAGGCCAAGGAACCCCCAAACTAAAGCTAAAATGGAAGTGCAAGAAGGAGGATGAGTCAAAAGGTGGCTACTCCAAAGACGTCCTCCTACGGCTTTTGCAGAAGTATGGTGAGGTTCTCAACCTGGTGCTTTCCAGTAAGAAGCCAGGCACTGCTGTGGTGGAGTTTGCAACCGTCAAGGCAGCGGAGCTGGCTGTCCAGAATGAAGTTGGCCTGGTGGATAACCCTCTGAAGATTTCCTGGTTGGAGGGACAGCCCCAGGATGCCGTGGGCCGCAGCCACTCAGGACTGTCAAAGGGCTCAGTGCTGTCAGAGAGGGACTACGAGAGCCTCGTCATGATGCGCATGCGCCAGGCGGCCGAGCGGCAACAGCTGATCGCACGGATGCAGCAGGAAGACCAGGAGGGGCCGCCTACGTAG
the sequence of the specific amplification upstream primer of the Dnajc17 gene mutant is shown as SEQ ID NO: 3:
SEQ ID:NO:3：5' ATGGCAGTGACCAAGGAGC 3'
the sequence of the specific amplification downstream primer of the Dnajc17 gene mutant is shown as SEQ ID NO: 4:
SEQ ID:NO:4：5' CTACGTAGGCGGCCCCTC 3'
the sequencing primer sequence of the Dnajc17 gene mutant is shown in SEQ ID NO: 5:
SEQ ID:NO:5：5' CCTTGGAGGTGCTGACCGATGC 3'
the probe sequences of the Dnajc17 gene mutant are shown in SEQ ID NO. 6 and SEQ ID NO. 7:
SEQ ID:NO:6：5' TGAGAGAAGAGGGTTCCCGG 3'
SEQ ID:NO:7：5' TGAGAGAAGCGGGTTCCCGG 3'
the above description is only of the preferred embodiments of the present invention, and it should be noted that: it will be apparent to those skilled in the art that various modifications and adaptations can be made without departing from the principles of the invention and these are intended to be within the scope of the invention.
Sequence listing
<110> university of southeast Tong
<120> autosomal dominant Dnajc17 gene mutant and application thereof, diagnostic kit and diagnostic gene chip
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 915
<212> DNA
<213> wild type Dnajc17 reference sequence (human)
<400> 1
atggcagtga ccaaggagct cttacagatg gacctgtacg cgctgctagg cattgaggag 60
aaggcagcgg acaaagaggt aaagaaggcg tataggcaga aggccctctc ctgccaccca 120
gacaaaaatc cagataatcc cagagcagct gaactcttcc accagctttc tcaggccttg 180
gaggtgctga ccgatgctgc agccagggct gcatatgaca aggtcaggaa agccaagaag 240
caagcagcag agaggaccca gaaacttgat gagaaaagga agaaagtgaa gcttgacctg 300
gaggcccggg agcggcaggc ccaggcccag gagagtgagg aggaagagga gagccggagc 360
accaggacac tagagcaaga gatcgaacgc ctgagagaag agggttcccg gcagctggag 420
gaacagcaga ggctcatccg ggagcagata cgccaggagc gtgaccagag gttgagagga 480
aaggcagaaa atactgaagg ccaaggaacc cccaaactaa agctaaaatg gaagtgcaag 540
aaggaggatg agtcaaaagg tggctactcc aaagacgtcc tcctacggct tttgcagaag 600
tatggtgagg ttctcaacct ggtgctttcc agtaagaagc caggcactgc tgtggtggag 660
tttgcaaccg tcaaggcagc ggagctggct gtccagaatg aagttggcct ggtggataac 720
cctctgaaga tttcctggtt ggagggacag ccccaggatg ccgtgggccg cagccactca 780
ggactgtcaa agggctcagt gctgtcagag agggactacg agagcctcgt catgatgcgc 840
atgcgccagg cggccgagcg gcaacagctg atcgcacgga tgcagcagga agaccaggag 900
gggccgccta cgtag 915
<210> 2
<211> 915
<212> DNA
<213> nucleotide sequence of Dnajc17 Gene mutant (human)
<400> 2
atggcagtga ccaaggagct cttacagatg gacctgtacg cgctgctagg cattgaggag 60
aaggcagcgg acaaagaggt aaagaaggcg tataggcaga aggccctctc ctgccaccca 120
gacaaaaatc cagataatcc cagagcagct gaactcttcc accagctttc tcaggccttg 180
gaggtgctga ccgatgctgc agccagggct gcatatgaca aggtcaggaa agccaagaag 240
caagcagcag agaggaccca gaaacttgat gagaaaagga agaaagtgaa gcttgacctg 300
gaggcccggg agcggcaggc ccaggcccag gagagtgagg aggaagagga gagccggagc 360
accaggacac tagagcaaga gatcgaacgc ctgagagaag cgggttcccg gcagctggag 420
gaacagcaga ggctcatccg ggagcagata cgccaggagc gtgaccagag gttgagagga 480
aaggcagaaa atactgaagg ccaaggaacc cccaaactaa agctaaaatg gaagtgcaag 540
aaggaggatg agtcaaaagg tggctactcc aaagacgtcc tcctacggct tttgcagaag 600
tatggtgagg ttctcaacct ggtgctttcc agtaagaagc caggcactgc tgtggtggag 660
tttgcaaccg tcaaggcagc ggagctggct gtccagaatg aagttggcct ggtggataac 720
cctctgaaga tttcctggtt ggagggacag ccccaggatg ccgtgggccg cagccactca 780
ggactgtcaa agggctcagt gctgtcagag agggactacg agagcctcgt catgatgcgc 840
atgcgccagg cggccgagcg gcaacagctg atcgcacgga tgcagcagga agaccaggag 900
gggccgccta cgtag 915
<210> 3
<211> 19
<212> DNA
<213> upstream primer sequence for specific amplification of Dnajc17 Gene mutant (human)
<400> 3
atggcagtga ccaaggagc 19
<210> 4
<211> 18
<212> DNA
<213> downstream primer sequence for specific amplification of Dnajc17 Gene mutant (human)
<400> 4
ctacgtaggc ggcccctc 18
<210> 5
<211> 22
<212> DNA
<213> sequencing primer sequence of Dnajc17 Gene mutant (human)
<400> 5
ccttggaggt gctgaccgat gc 22
<210> 6
<211> 20
<212> DNA
<213> Probe sequence of Dnajc17 Gene mutant (human)
<400> 6
tgagagaaga gggttcccgg 20
<210> 7
<211> 20
<212> DNA
<213> Probe sequence of Dnajc17 Gene mutant (human)
<400> 7
tgagagaagc gggttcccgg 20

Claims (3)

1. An autosomal dominant Dnajc17 gene mutant, characterized by: the nucleotide sequence of the mutant is shown as SEQ ID NO. 2.
2. The autosomal dominant Dnajc17 gene mutant according to claim 1, wherein: the mutation site is that the 401 th nucleotide A of the Dnajc17 gene coding region on the 15 th chromosome of a human is mutated into C, which is recorded as C, 401A and > C, so that the 134 th amino acid of a protein sequence is mutated into alanine A from glutamic acid E, which is recorded as p, E134A.
3. A diagnostic gene chip of autosomal dominant Dnajc17 gene mutant, characterized in that: the diagnostic gene chip is provided with a probe for detecting Dnajc17 gene mutant of a nucleotide sequence shown in SEQ ID NO. 2;
the probe sequences of the Dnajc17 gene mutant are shown in SEQ ID NO. 6 and SEQ ID NO. 7.
CN201911164469.8A 2019-11-25 2019-11-25 Autosomal dominant Dnajc17 gene mutant and application thereof, diagnostic kit and diagnostic gene chip Active CN110904210B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911164469.8A CN110904210B (en) 2019-11-25 2019-11-25 Autosomal dominant Dnajc17 gene mutant and application thereof, diagnostic kit and diagnostic gene chip

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911164469.8A CN110904210B (en) 2019-11-25 2019-11-25 Autosomal dominant Dnajc17 gene mutant and application thereof, diagnostic kit and diagnostic gene chip

Publications (2)

Publication Number Publication Date
CN110904210A CN110904210A (en) 2020-03-24
CN110904210B true CN110904210B (en) 2023-04-14

Family

ID=69819336

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911164469.8A Active CN110904210B (en) 2019-11-25 2019-11-25 Autosomal dominant Dnajc17 gene mutant and application thereof, diagnostic kit and diagnostic gene chip

Country Status (1)

Country Link
CN (1) CN110904210B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111893177B (en) * 2020-08-19 2022-10-04 南通大学 Mutation screening method and mutation detection kit for hereditary hearing loss inducing gene

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109852685A (en) * 2019-02-18 2019-06-07 南通大学 HPR1 gene mutation body and its application in the deaf diagnostic reagent of preparation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109852685A (en) * 2019-02-18 2019-06-07 南通大学 HPR1 gene mutation body and its application in the deaf diagnostic reagent of preparation

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
《A locus on mouse chromosome 2 is involved in susceptibility to congenital hypothyroidism and contains an essential gene expressed in thyroid》;Elena Amendola等;《Endocrinology》;20100216;第151卷(第4期);第1948-1958页 *
《DNAJC17 is localized in nuclear speckles and interacts with splicing machinery components》;A Pascarella等;《Scientific Reports》;20180517;第8卷(第1期);第7794篇 *
《Evidence for differential alternative splicing in blood of young boys with autism spectrum disorders》;Boryana S Stamova等;《Molecular Autism》;20130904;第4卷(第1期);第30篇 *
《Expanding the clinical, allelic, and locus heterogeneity of retinal dystrophies》;Nisha Patel等;《Genetics in Medicine》;20150910;第18卷(第6期);第554-562页 *
《热休克蛋白基因突变与神经系统遗传病》;张付峰等;《卒中与神经疾病》;20051226;第12卷(第6期);第374-376页 *

Also Published As

Publication number Publication date
CN110904210A (en) 2020-03-24

Similar Documents

Publication Publication Date Title
Gratacòs et al. A polymorphic genomic duplication on human chromosome 15 is a susceptibility factor for panic and phobic disorders
Thiffault et al. Diversity of ARSACS mutations in French-Canadians
CN110541025B (en) Detection method, primer composition and kit for Duchenne muscular dystrophy gene defect
Tsai et al. Characterization of MTM1 mutations in 31 Japanese families with myotubular myopathy, including a patient carrying 240 kb deletion in Xq28 without male hypogenitalism
KR20130049771A (en) Genetic marker for the diagnosis of dementia with lewy bodies
CN106834434B (en) Nucleic acid, kit and method for detecting COX-1, COX-2 and GPIIIa gene polymorphism
CN110904210B (en) Autosomal dominant Dnajc17 gene mutant and application thereof, diagnostic kit and diagnostic gene chip
CN109852685B (en) HPR1 gene mutant and application thereof in preparing deafness diagnostic reagent
CN115927356B (en) SLC45A2 pathogenic mutant gene, pathogenic mutant and application thereof in preparation of eye skin albinism IV type diagnostic kit
US20200131573A1 (en) Genetic variants associated with human-directed hyper-social behavior in domestic dogs
US20210262033A1 (en) Set of Pathogenic Genes of Neuropsychiatric Retardation and Advanced Cognitive Disorder and Detection Primer and Kit Thereof
US20140141432A1 (en) Method and kit for diagnosing glaucoma in dogs
Fu et al. Investigation of JAK1 and STAT3 polymorphisms and their gene–gene interactions in nonspecific digestive disorder of rabbits
CN111893177B (en) Mutation screening method and mutation detection kit for hereditary hearing loss inducing gene
CN115873861B (en) PAH pathogenic mutant and application thereof in preparation of phenylketonuria diagnostic kit
CN113265461B (en) Primer group, probe group and kit for detecting high-frequency gene pathogenic variation
CN107523629A (en) Sperm disease Disease-causing gene new mutation without a head and its application
WO2009078726A1 (en) Means and methods for typing a cell isolate of an individual suffering from a psychiatric disorder or at risk of suffering there from
KR100456282B1 (en) Primers for diagnosis of schizophrenia
CN114774552A (en) Diagnosis marker and diagnosis reagent for nevoid basal cell carcinoma syndrome and application
CN116004788A (en) Application of Angelman syndrome pathogenic gene UBE3A mutation site and diagnostic reagent thereof
CN114540480A (en) Application of miR-501-3p as schizophrenia diagnosis marker
CN116445597A (en) Human CMT pathogenic gene SARS1 with 1187 position mutation and its application
EP3008180A2 (en) Methods and kits for treating and classifying individuals
EP1384777B1 (en) Genomic dnas participating in rheumatoid arthritis, method of diagnosing the same, method of judging onset risk thereof and diagnostic kit for detecting the same

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant