CN110904208B - SNP (single nucleotide polymorphism) site related to CV-A6 type hand-foot-and-mouth disease severe susceptibility and application thereof - Google Patents

SNP (single nucleotide polymorphism) site related to CV-A6 type hand-foot-and-mouth disease severe susceptibility and application thereof Download PDF

Info

Publication number
CN110904208B
CN110904208B CN201911050218.7A CN201911050218A CN110904208B CN 110904208 B CN110904208 B CN 110904208B CN 201911050218 A CN201911050218 A CN 201911050218A CN 110904208 B CN110904208 B CN 110904208B
Authority
CN
China
Prior art keywords
foot
mouth disease
hand
severe
snp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201911050218.7A
Other languages
Chinese (zh)
Other versions
CN110904208A (en
Inventor
黄娇
魏晟
熊田甜
吴泰顺
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong University of Science and Technology
Original Assignee
Huazhong University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong University of Science and Technology filed Critical Huazhong University of Science and Technology
Priority to CN201911050218.7A priority Critical patent/CN110904208B/en
Publication of CN110904208A publication Critical patent/CN110904208A/en
Application granted granted Critical
Publication of CN110904208B publication Critical patent/CN110904208B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to an SNP locus related to CV-A6 type hand-foot-and-mouth disease severe susceptibility and application thereof, wherein the SNP locus is rs10879355, and the invention further comprises application of the SNP locus in preparation of products for detecting, identifying or screening CV-A6 infected hand-foot-and-mouth disease severe patients. The invention provides a technical method for screening CV-A6 severe susceptible people infected with hand-foot-and-mouth disease, which can be used for early screening CV-A6 infected patients with hand-foot-and-mouth disease, identifying risks of severe hand-foot-and-mouth disease as early as possible, taking intervention measures in time to prevent further development of disease conditions, effectively reducing the fatality rate of severe hand-foot-and-mouth disease, and has important significance for protecting the health of children suffering from hand-foot-and-mouth disease.

Description

SNP (single nucleotide polymorphism) site related to CV-A6 type hand-foot-and-mouth disease severe susceptibility and application thereof
Technical Field
The invention relates to the field of biomedicine, and particularly relates to a CV-A6 type hand-foot-and-mouth disease severe auxiliary screening SNP marker and application thereof.
Background
The hand-foot-and-mouth disease is the most common infectious disease in children under 5 years old in China and poses serious threats to the health of children in China. Hand-foot-and-mouth disease can be caused by a variety of enterovirus serotypes including EV-A71, CV-A16, CV-A6, CV-A10 and the like. In 2008-2012, EV-A71 and CV-A16 infections account for about 80% of all hand-foot-and-mouth diseases in China. In recent years, an increasing proportion of non-EV 71 non-CA 16 enterovirus infections has been reported individually. After the EV71 vaccine comes into the market at the end of 2016, the number of cases of hand-foot-and-mouth disease infected by EV-A71 is further reduced, and CV-A6 replaces EV-A71 to become one of the dominant serotypes of the hand-foot-and-mouth disease epidemic; and CV-a6 infection is one of the major serotypes of severe hand-foot-and-mouth disease. Although most patients with hand-foot-and-mouth disease can recover in about one week, severe patients often have serious illness and even die. Therefore, the risk of the severe hand-foot-and-mouth disease should be recognized as early as possible, and corresponding measures should be taken in time to prevent the hand-foot-and-mouth disease from developing into severe disease.
Although various factors such as enterovirus infection types, age and the like are associated with severe hand-foot-and-mouth disease, research indicates that genetic susceptibility exists in severe hand-foot-and-mouth disease. For example, Chang LY et al found that HLA-A2 gene is associated with the occurrence of hand-foot-and-mouth disease and heart-lung failure. The scholars of Zhang N and the like find that the allele frequency of IL-10-592C of a patient with severe hand-foot-and-mouth disease is higher than that of a patient with mild hand-foot-and-mouth disease, and the IL-10 level in the serum of a patient carrying IL-10-592 AC and CC genotypes is higher than that of a patient carrying AA genotypes. However, the research on the severe susceptibility of the hand-foot-and-mouth disease focuses on the infection of the hand-foot-and-mouth disease by EV-A71. Currently, research on severe susceptibility of CV-A6 infected hand-foot-and-mouth disease is lacked.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides an SNP locus related to CV-A6 type hand-foot-and-mouth disease severe susceptibility and application thereof.
The technical scheme for solving the technical problems is as follows:
and (3) an SNP site related to CV-A6 type hand-foot-and-mouth disease severe susceptibility, wherein the SNP site is rs 10879355.
Further, the SNP locus is applied to preparation of products for detecting, identifying or screening CV-A6 infected patients with the severe hand-foot-and-mouth disease.
The invention has the beneficial effects that: the invention provides a technical method for screening CV-A6 severe susceptible people infected with hand-foot-and-mouth disease, which can be used for early screening CV-A6 infected patients with hand-foot-and-mouth disease, identifying risks of severe hand-foot-and-mouth disease as early as possible, taking intervention measures in time to prevent further development of disease conditions, effectively reducing the fatality rate of severe hand-foot-and-mouth disease, and has important significance for protecting the health of children suffering from hand-foot-and-mouth disease.
Drawings
FIG. 1 application of QuantStaudioTMA screenshot of rs10879355 locus of 96 samples (94 samples to be tested and 2 negative controls) was genotyped by Real-Time PCR Software.
In FIG. 1, the X-axis represents the VIC fluorescence intensity and the Y-axis represents the FAM fluorescence intensity. Genotyping results: 1 represents T/T homozygote, 2 represents C/T heterozygote, 3 represents C/C homozygote, black ▇ represents negative control (NTC), and black X represents no detection.
Detailed Description
The principles and features of this invention are described below in conjunction with examples which are set forth to illustrate, but are not to be construed to limit the scope of the invention.
The technical scheme for solving the technical problems is as follows:
the technical scheme for solving the problems comprises the following steps: (1) the system collects the demographic data, anal swab or stool sample and blood sample of the tested object which meets the standard; (2) screening potential Single Nucleotide Polymorphism (SNP) sites related to severe CV-A6 infected hand-foot-and-mouth disease by adopting a whole genome association research based on a mixed DNA strategy; (3) and verifying the screened positive related SNP in an independent sample to judge the robustness of the relationship.
Specifically, the research method of the present invention mainly includes the following contents:
first, case and control enrollment criteria
The invention selects 364 laboratory-diagnosed CV-A6 infected hand-foot-and-mouth disease cases accepted in Shenzhen, Baoan people Hospital as research objects. 115 severe patients were selected as a case group, and the inclusion criteria were: (1) detecting the infection of the nucleic acid sample of the anal swab or the excrement with CV-A6 by adopting a CV-A6 nucleic acid detection kit (PCR-fluorescent probe method) (Daan Gen Ltd of Zhongshan university); (2) the patient has papules or herpes, with or without fever, in the hands, feet, mouth or buttocks, etc., and any of the neurological complications (aseptic meningitis, encephalitis, brainstem encephalitis, encephalomyelitis, acute flaccid muscle paralysis, autonomic dysfunction) or cardiopulmonary complications (pulmonary edema or hemorrhage, cardiopulmonary failure). 249 patients with mild symptoms are used as a control group, and the inclusion criteria are as follows: (1) detecting the nucleic acid sample of the anal swab or the excrement as CV-A6 infection by adopting a CV-A6 nucleic acid detection kit (a PCR-fluorescent probe method); (2) the patient presents with papules or herpes, with or without fever, and without complications of the nervous system or the cardiopulmonary system, in the hands, feet, mouth, or buttocks, etc. Both cases and controls were of the Han nationality in mainland China.
We divided the study into two categories: (1) genome-wide association analysis population based on mixed DNA strategy: 115 cases and 115 controls matched to cases 1:1 individuals (within 6 months of age, same gender); (2) individual genotyping: 115 cases and 249 controls. The basic situation of the study subjects is shown in table 1.
TABLE 1 basic information on the study
Figure GDA0003197794370000031
Figure GDA0003197794370000041
Second, genome-wide association analysis of mixed DNA strategies
Genomic DNA was extracted from peripheral blood samples of the subjects using a whole genome DNA extraction kit (Beijing Baitach Biotechnology Co., Ltd.). The concentration and quality of the DNA was determined using NanoDrop ND-1000. 100ng of DNA was extracted from genomic DNA of 115 controls matched with 115 cases and 1:1 individuals to construct pooled sample pools, 4 pooled sample pools (2 males and 2 females) in case groups and 4 pooled sample pools (2 males and 2 females) in control groups, and the amount of sample in each pooled sample pool was 20 to 37. SNP detection was performed by using Illumina Human Omni ZhongHua-8 Beadchip (Illumina, San Diego, USA) according to the instructions of the chip, and the detection signal was read and Relative Allele Signal (RAS) intensity value was calculated. In order to ensure the detection quality, three parallel repeated operations are adopted to ensure the detection reliability. Duplicate measurement analysis of variance was used to compare the difference in frequency of each SNP site in case and control based on RAS of the pools. The first 30 SNPs with the largest difference in the minimum allele frequencies were selected and tested for their possible biological function in SNPinfo. SNPs were excluded from data analysis if they were not mapped on autosomes, or the Minimum Allele Frequency (MAF) <0.01, or failed responses in individual genotyping.
Thirdly, individual genotyping
For 4 SNPs selected in the whole genome association analysis based on the mixed DNA strategy (rs1558206,rs6927647, rs9375728 and rs10879355) were further validated in 364 patients with CV-a6 infected hand-foot-and-mouth disease (115 cases and 249 controls). Adopting Taqman genotyping technology (QuantStudio)TMReal-Time PCR system, Applied Biosystems), PCR reaction systems and reaction conditions as in tables 2 and 3.
TABLE 2 reaction system (5. mu.l)
Figure GDA0003197794370000051
Adding corresponding TaqMan SNP Genotyping Assay according to the SNP to be detected. TaqPathTM ProAmpTMMaster Mix and TaqMan SNP Genotyping Assay were both purchased from Life Technologies.
TABLE 3 circulation conditions
Figure GDA0003197794370000061
The information of TaqMan SNP Genotyping Assay for 4 SNPs is shown in Table 4.
TABLE 4 TaqMan SNP Genotyping Assay information for SNPs
Figure GDA0003197794370000062
Fourthly, the result
We used an unconditional logistic regression model to calculate the association of four SNP sites with the severe susceptibility to CV-A6 infection hand-foot-and-mouth disease, and correct the effects of age, sex, parity, complications at birth, breast feeding and peak body temperature, with the results as shown in Table 5. The results of the study indicated that individuals carrying the rs10879355 CC genotype were at a 2.48-fold greater risk of developing severe disease in the recessive model than individuals carrying the rs10879355 TC and TT genotypes (95% CI:1.34, 4.56).
The rs10879355 chromosome position chr12:72019229 belongs to Intron variation (Intron Variant), the SNP is completely linked with rs4290270 in Chinese population, and the rs4290270 chromosome position chr12:72022455 belongs to Synonymous variation (synonymus Variant), so that the rs4290270 is used as the SNP locus of CV-A6 infection of the severe hand-foot-and-mouth disease.
The sequence information of rs4290270 is:
gcaagcaagaagggcaactgcgggc[a/t]tatggagcaggactcctttcctcca
——SEQ ID NO：1、2；
TABLE 5.4 relationships between SNPs and the risk of severe hand-foot-and-mouth disease with CV-A6 infection
Figure GDA0003197794370000071
Figure GDA0003197794370000081
Correction of age, sex, birth times, complications at birth, breastfeeding and peak body temperature
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Sequence listing
<110> university of science and technology in Huazhong
<120> SNP site related to CV-A6 type hand-foot-and-mouth disease severe susceptibility and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 51
<212> DNA
<213> human (Homo sapiens)
<400> 1
gcaagcaaga agggcaactg cgggcatatg gagcaggact cctttcctcc a 51
<210> 2
<211> 51
<212> DNA
<213> human (Homo sapiens)
<400> 2
gcaagcaaga agggcaactg cgggcttatg gagcaggact cctttcctcc a 51

Claims (1)

1. The application of the detection reagent of the SNP locus rs10879355 in preparing products for detecting, identifying or screening CV-A6 infected patients with the hand-foot-and-mouth disease.
CN201911050218.7A 2019-10-31 2019-10-31 SNP (single nucleotide polymorphism) site related to CV-A6 type hand-foot-and-mouth disease severe susceptibility and application thereof Active CN110904208B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911050218.7A CN110904208B (en) 2019-10-31 2019-10-31 SNP (single nucleotide polymorphism) site related to CV-A6 type hand-foot-and-mouth disease severe susceptibility and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911050218.7A CN110904208B (en) 2019-10-31 2019-10-31 SNP (single nucleotide polymorphism) site related to CV-A6 type hand-foot-and-mouth disease severe susceptibility and application thereof

Publications (2)

Publication Number Publication Date
CN110904208A CN110904208A (en) 2020-03-24
CN110904208B true CN110904208B (en) 2021-10-29

Family

ID=69816152

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911050218.7A Active CN110904208B (en) 2019-10-31 2019-10-31 SNP (single nucleotide polymorphism) site related to CV-A6 type hand-foot-and-mouth disease severe susceptibility and application thereof

Country Status (1)

Country Link
CN (1) CN110904208B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111554347B (en) * 2020-04-20 2023-10-31 深圳华大因源医药科技有限公司 Method for constructing model for classifying hand-foot-mouth samples and application of method
CN111598865B (en) * 2020-05-14 2023-05-16 上海锘科智能科技有限公司 Hand-foot-mouth disease detection method, device and system based on thermal infrared and RGB double-shooting

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2069541A4 (en) * 2006-08-01 2010-05-19 Univ Ohio State Res Found Polymorphisms in genes affecting cns disorders and uses thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Genome-wide association study identifies TPH2 variant as a novel locus for severe CV-A6-associated hand, foot, and mouth disease in Han Chinese;Yu Meng等;《Int J Infect Dis》;20200629;第98卷;全文 *
rs4290270;Ensembl genome browser;《Ensembl genome browser》;20120530;全文 *

Also Published As

Publication number Publication date
CN110904208A (en) 2020-03-24

Similar Documents

Publication Publication Date Title
Sniekers et al. Genome-wide association meta-analysis of 78,308 individuals identifies new loci and genes influencing human intelligence
Tan et al. Association of GWAS-linked loci with late-onset Alzheimer's disease in a northern Han Chinese population
Fischer et al. Identification of immune-relevant factors conferring sarcoidosis genetic risk
Asai et al. Genome-wide association study and meta-analysis in multiple populations identifies new loci for peanut allergy and establishes C11orf30/EMSY as a genetic risk factor for food allergy
Gao et al. Genetic variants in thymic stromal lymphopoietin are associated with atopic dermatitis and eczema herpeticum
Tillmann et al. A polymorphism near IL28B is associated with spontaneous clearance of acute hepatitis C virus and jaundice
Solberg et al. Sex-and lineage-specific inheritance of depression-like behavior in the rat
Haralambieva et al. 2′-5′-Oligoadenylate synthetase single-nucleotide polymorphisms and haplotypes are associated with variations in immune responses to rubella vaccine
Song et al. Genetic variation in the TNF gene is associated with susceptibility to severe sepsis, but not with mortality
Sonzogni et al. Polymorphisms of microsomal epoxide hydrolase gene and severity of HCV-related liver disease
Shen et al. A functional promoter polymorphism of IFITM3 is associated with susceptibility to pediatric tuberculosis in Han Chinese population
Alkelai et al. Identification of new schizophrenia susceptibility loci in an ethnically homogeneous, family‐based, Arab‐Israeli sample
Valkanas et al. Phenotypic evolution of UNC80 loss of function
Rizk et al. Genetic polymorphisms of ICAM 1 and IL28 as predictors of liver fibrosis severity and viral clearance in hepatitis C genotype 4
CN110904208B (en) SNP (single nucleotide polymorphism) site related to CV-A6 type hand-foot-and-mouth disease severe susceptibility and application thereof
CN110699446B (en) SNP marker rs3174298 related to non-syndrome cleft lip and palate diagnosis and application thereof
WO2020015387A1 (en) Set of pathogenic genes for mental retardation and advanced cognitive impairment and detection primer and kit therefor
CN104630374A (en) Rheumatoid-arthritis-related single-gene single nucleotide polymorphism site and application thereof
Lau et al. Non-invasive screening of HLA-DPA1 and HLA-DPB1 alleles for persistent hepatitis B virus infection: susceptibility for vertical transmission and toward a personalized approach for vaccination and treatment
Kukshal et al. Genetics of schizophrenia from a clinicial perspective
Li et al. The association between sixteen genome-wide association studies-related allergic diseases loci and childhood allergic rhinitis in a Chinese Han population
Liao et al. Deletion of conserved non‐coding sequences downstream from NKX2‐1: A novel disease‐causing mechanism for benign hereditary chorea
Liang et al. Association of IL18 genetic polymorphisms with increased risk of Biliary atresia susceptibility in Southern Chinese children
Pecioska et al. Association between type 2 diabetes loci and measures of fatness
CN104937113A (en) Method for predicting the onset of extrapyramidal symptoms (EPS) induced by an antipsychotic-based treatment

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant