CN110904066B

CN110904066B - Recombinant R-type transaminase, mutant and application thereof

Info

Publication number: CN110904066B
Application number: CN201911309350.5A
Authority: CN
Inventors: 柳志强; 贾东旭; 郑裕国; 李军良; 彭晨; 徐海鹏; 孙晨奕
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2019-12-18
Filing date: 2019-12-18
Publication date: 2021-08-27
Anticipated expiration: 2039-12-18
Also published as: CN110904066A

Abstract

The invention relates to a recombinant R-omega-transaminase and a mutant thereof, and application of the recombinant R-omega-transaminase and the mutant in asymmetric synthesis of sitagliptin. The invention screens novel R-omega-transaminase and recombines with the prior high-efficiency transaminase, the obtained recombinant has an amino acid sequence shown in SEQ ID:15, the mutant is obtained by carrying out single-site mutation or multi-site mutation on one or more of 71 th, 135 th or 292 th amino acid sequences shown in the SEQ ID:15, the optimal amino acid sequence of the R-omega-transaminase mutant is shown in the SEQ ID:17, and the corresponding nucleotide sequence is shown in the SEQ ID: 18. The invention provides the R-omega-TA mutant with higher activity (582.4U/g) and stereoselectivity (e.e. value 99.9%), which can catalyze 500mM substrate to be converted into sitagliptin, the conversion rate is up to 99%, and the R-omega-TA mutant has important significance for improving the sitagliptin biocatalytic preparation technology.

Description

Recombinant R-type transaminase, mutant and application thereof

(I) technical field

The invention relates to a recombinant R-omega-transaminase and a mutant thereof, and application of the recombinant R-omega-transaminase and the mutant in asymmetric synthesis of sitagliptin.

(II) background of the invention

Sitagliptin, the english name sitagliptin, (3R) -3-amino-1- [3- (trifluoromethyl) -5,6,7, 8-tetrahydro-1, 2, 4-triazolo [4,3-a ] pyrazin-7-yl ] -4- (2,4, 5-trifluorophenyl) butan-1-one, is a dipeptidyl peptidase-4 (DPP-4) inhibitor developed and developed by Merck and Codexis, and can control blood glucose levels by protecting endogenous incretins and enhancing their effects. Compared with sulfonylurea medicines and metformin medicines, the compound preparation has more stable hypoglycemic function, less side effect and better clinical effect, can be effectively applied to the treatment of type II diabetes, and is a treatment medicine with great potential for type II diabetes.

The sitagliptin is prepared mainly by a chemical synthesis method and an asymmetric synthesis method. The chemical synthesis method is to synthesize the 4-oxo-4- [3- (trifluoromethyl) -5, 6-dihydro- [1,2, 4-]-triazolo [4,3-a]Pyrazin-7 (8H) -yl]Formation of enamine intermediate from (E) -1- (2,4, 5-trifluorophenyl) butan-2-one with ammonium acetate by [ (COD) RhCl]₂And hydrogenating enamine by using R, S-t-Bujos as an asymmetric catalyst to obtain sitagliptin. But the method has the disadvantages of complicated process steps, harsh reaction conditions, expensive price of the used catalyst, high residual rate of metal ions, high input cost of product purification and separation, low optical purity of the product (e.e. < 97%), and serious environmental pollution. In contrast, the asymmetric synthesis method has the advantages of high stereoselectivity and regioselectivity, mild reaction conditions, high catalytic efficiency, high product yield, easiness in separation and purification of products and the like, and has advantages in replacing the traditional chemical method for asymmetric synthesis of chiral amine.

Transaminase (TA for short, EC 2.6.1.X) is a coenzyme-dependent PLP (pyridoxal 5' -phosphate) enzyme. During the reaction, PLP and pyridoxamine 5' -phosphate (PMP) undergo interconversion and simultaneously catalyze the reversible transfer of amino groups from a suitable donor to a carbonyl acceptor. TA is classified into α -TA and ω -TA according to the amino group transferred to the amino group acceptor at different positions. alpha-TA needs a carbonyl acceptor at alpha position to play the catalytic function, and omega-TA can catalyze ketone and amine with any structure, so that the application value is higher, and the catalyst is a biocatalyst with important industrial application value.

The enzyme catalyzing the preparation of sitagliptin is R-omega-TA. In 2010, Codexis company takes Arthrobacter sp. derived R-omega-TA 117 as a research object, firstly, a large pocket of a substrate binding region is modified by site-directed saturation mutation, and the obtained mutant shows catalytic activity on 1- (3- (trifluoromethyl) -5, 6-dihydro- [1,2,4] triazolo [4,3-a ] pyrazin-7 (8H) -yl) butane-1, 3-diketone (sitagliptin precursor ketone truncated substrate) (see figure 1). Then, the mutant is used as a female parent, the site-directed mutation and the combined mutation are carried out on a substrate binding region combined small pocket, and 27 sites are obtained through 11 rounds of reconstruction, so that the high-yield mutant catalyzing 1- (3- (trifluoromethyl) -5, 6-dihydro- [1,2,4] triazolo [4,3-a ] pyrazine-7 (8H) -group) -4- (2,4, 5-trifluorophenyl) butane-1, 3-diketone (sitagliptin precursor ketone) is finally obtained (see figure 2).

The DNA recombination technology is to cut, splice and combine different genetic materials in vitro to obtain new recombinant DNA, then to transfer the recombinant DNA into microorganism, plant and animal cells through a carrier for asexual propagation, and to make the needed gene express in the cells to create a large amount of needed DNA products. The recombinant DNA technology has made important breakthrough in basic research such as cell differentiation, growth and development, tumorigenesis, industrial and agricultural production, medical and health care and other practical applications. Therefore, the DNA recombination technology is applied to the development of the novel transaminase for asymmetrically synthesizing sitagliptin, and has important significance for breaking the monopoly of enzyme preparations of Codexis company and developing novel R-TA with independent intellectual property rights.

Disclosure of the invention

The invention aims to provide a recombinant R-omega-transaminase and a mutant with improved activity and substrate tolerance, and application thereof in asymmetric synthesis of sitagliptin.

The technical scheme adopted by the invention is as follows:

a recombinant R-omega-transaminase has an amino acid sequence shown in SEQ ID NO.15 (its coding gene is shown in SEQ ID NO. 16).

The invention also relates to an R-omega-transaminase mutant which is obtained by site-directed mutagenesis of amino acid with a sequence shown as SEQ ID NO.15, wherein the site of the mutagenesis is one or more of the following: (1) 71 th bit, (2) 135 th bit, and (3) 292 th bit.

Preferably, the R-omega-transaminase mutant is obtained by mutating an amino acid shown as a sequence in SEQ ID NO.15 at one or more of the following sites: (1) the 71 th bit histidine H is mutated into lysine K, threonine T alanine A or arginine R; (2) valine V at position 135 is mutated into threonine T, glycine G, leucine L, alanine A, isoleucine I, proline P, phenylalanine F or glutamic acid E; (3) glycine G at position 292 was changed to alanine a, arginine R, leucine L, cysteine C, histidine H, or isoleucine I.

Further, the R-omega-transaminase mutant is obtained by mutating amino acid shown as a sequence in SEQ ID NO.15 at one or more of the following sites: (1) the 71 th bit histidine H is mutated into threonine T; (2) valine V at position 135 is mutated into leucine L; (3) glycine G at position 292 is changed to arginine R.

More preferably, the sequence of the R-omega-transaminase mutant is shown as SEQ ID NO. 17.

The invention screens the high-efficiency R-omega-GzTA in the early stage₇On the basis, the DNA recombination technology is spliced with gene fragments of other novel R-TA, and then the molecular modification technology is utilized to obtain an R-omega-TA mutant with improved activity and substrate tolerance for asymmetric synthesis of sitagliptin.

The invention also relates to application of the R-omega-transaminase and the mutant thereof in catalyzing the asymmetric synthesis of sitagliptin from sitagliptin precursor ketone.

Specifically, the application is as follows: taking wet thalli obtained by fermentation culture of recombinant genetic engineering bacteria containing the R-omega-transaminase or mutant encoding genes or supernatant obtained by ultrasonic crushing of the wet thalli as a catalyst, taking sitagliptin precursor ketone as a substrate, taking pyridoxal phosphate as a coenzyme, taking isopropylamine as an amino donor, and reacting in triethanolamine-HCl buffer solution with the pH value of 8.0-9.0 at the temperature of 20-60 ℃ and the speed of 300-500R/min to obtain a high-concentration sitagliptin product.

Preferably, the gene sequence of the R-omega-transaminase or the mutant is shown as SEQ ID NO.16 (the coded amino acid sequence is shown as SEQ ID NO.15) or SEQ ID NO.18 (the coded amino acid sequence is shown as SEQ ID NO. 17).

The invention has the following beneficial effects: the invention provides the R-omega-TA mutant with higher activity (582.4U/g) and stereoselectivity (e.e. value 99.9%), which can catalyze 500mM substrate to be converted into sitagliptin, the conversion rate is up to 99%, and the R-omega-TA mutant has important significance for improving the sitagliptin biocatalytic preparation technology.

(IV) description of the drawings

FIG. 1 is a schematic diagram of a process for asymmetric catalysis of a sitagliptin precursor ketone truncated substrate reaction by a biological enzyme method;

FIG. 2 is a schematic diagram of the reaction process of asymmetric catalysis for producing sitagliptin by a biological enzyme method;

FIG. 3 is a schematic diagram of the optimal reaction temperature of recombinant transaminase and its mutants.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

example 1: novel omega-TA screening, stereoselectivity determination and enzyme activity accurate determination

1. Enzyme source and Gene Synthesis

Three new enzymes were obtained by gene mining from NCBI databases using gene mining technology, from Mycolicbacteriumgoodii (MgTA, Genbank accession No. WP _049743179.1), Amine transaminase HFO (HFO, Genbank accession No. AIN35005.1) and Mesorhizobium japonicumum (MjTA, Genbank accession No. WP _010910285.1), respectively. Carrying out codon optimization according to E.coli codon preference, and synthesizing nucleotide sequences of three enzymes by a whole-gene synthesis method, wherein the nucleotide sequences are respectively shown as SEQ ID NO.2, 4 and 6; the amino acid sequences of the encoded enzymes are shown in SEQ ID NO.1, 3 and 5, respectively. Adding a 6 Xhis-tag at the tail end of the nucleotide sequence, adding restriction sites Xho I and Nco I at two ends, cloning the gene to Xho I and Nco I sites corresponding to pET28b (+), and obtaining recombinant expression plasmids pET28b/MgTA, pET28b/HFO and pET28 b/MjTA.

2. Induced expression of recombinant engineering bacteria

Composition of LB liquid medium: 10g/L of peptone, 5g/L of yeast powder, 10g/L of NaCl and water as a solvent, wherein the pH value is natural; LB solid culture medium in LB liquid culture medium adding 20g/L agar; autoclaving at 121 deg.C for 20 min; kanamycin was added to a final concentration of 50. mu.g/mL prior to use.

Inoculating the genetically engineered bacteria to LB liquid medium containing 50 ug/mL kanamycin at 37 deg.C and culturing at 150r/min to OD₆₀₀About 0.6 to 0.8, obtaining a seed solution; the seed liquid was inoculated into a fresh LB medium containing 50. mu.g/mL kanamycin at a final concentration of 2% by volume, and OD was cultured at 37 ℃ and 150r/min₆₀₀And when the concentration is 0.6-0.8, adding IPTG (isopropyl thiogalactoside) with the final concentration of 1mM into the culture solution, performing induced expression for 10 hours at 28 ℃, centrifuging for 10 minutes at 4 ℃ at 8000r/min, discarding supernatant, washing wet thalli twice by using 0.85% physiological saline, and collecting the wet thalli for later use.

3. Ultrasonic disruption of recombinant engineering bacteria

And (3) crushing the wet thalli by an ultrasonic crushing method. 1g of the wet cells were collected and treated with 10mL of Na₂CO₃/NaHCO₃(pH7.5) suspending in buffer solution, performing ultrasonic disruption under 39W condition for 5min, centrifuging, and collecting the supernatant.

4. Determination of stereoselectivity of novel omega-TA

The recombinant MgTA, MjTA and HFO disrupted supernatant was subjected to the following reaction. Reaction system: 30mM 3, 4-dimethoxypropiophenone, 52mMR, S- α -methylbenzylamine, 1mL of the supernatant from the disruption (MgTA, MjTA and HFO enzyme solutions), 2mM PLP, and 0.1M Na₂CO₃/NaHCO₃(pH7.5) buffer to a total volume of 10 mL. Reaction conditions are as follows: reacting at 30 ℃ for 30min, carrying out ice bath for 10min to stop the reaction, and centrifuging at 8000r/min for 10min to obtain a reaction supernatant.

The reaction supernatant was subjected to a derivatization reaction to determine the stereoselectivity of omega-TA. And (3) a derivatization reaction system: 8mL of the reaction supernatant, 1mg of 4-isobutyloxazolidine-2, 5-dione, and 0.45M borate buffer (pH 10.4) were added to make the total volume 10 mL. And (3) derivatization reaction conditions: reacting for 2min at room temperature, adding 0.1mL of 1M HCl to terminate the reaction, centrifuging for 10min at 8000r/min, and collecting supernatant; detecting the configuration of the 3, 4-dimethoxy amphetamine by adopting High Performance Liquid Chromatography (HPLC). The analytical column was an Agilent C18 column (250X 4.6mm, 5 μm) (Agilent technologies, Inc., USA), Agilent 2414 fluorescence detector, Agilent 1525 pump, Agilent 717 sample injector. Comparing with the peak time of standard sample derivatization of R-3, 4-dimethoxy amphetamine and S-3, 4-dimethoxy amphetamine, and judging the stereoselectivity of the screened omega-TA according to the product configuration. As shown in Table 1, the catalytic products of MgTA and MjTA are in the R configuration, indicating that MgTA and MjTA belong to the group R- ω -TA.

Table 1: identification of the stereoselectivity of the respective transaminase

5. Accurate determination of 3, 4-dimethoxy propiophenone enzyme activity by MgTA and MjTA recombinant engineering bacteria

And (3) crushing the wet thalli by an ultrasonic crushing method. 1g of the prepared wet thallus is suspended by 10mL of triethanolamine-HCl (pH7.5) buffer solution, ultrasonic disruption is carried out under the condition of 39W, the effective time is 5min, and the disrupted supernatant is collected by centrifugation and used for the following reaction. Reaction system: 30mM 3, 4-dimethoxypropiophenone, 200. mu.L of the disruption supernatant (MgTA enzyme solution, MjTA enzyme solution), 50mM R-. alpha. -methylbenzylamine, 1mM PLP, and triethanolamine-HCl buffer (pH 8.0) were added to 5mL of the total. Reaction conditions are as follows: reacting at 30 deg.C for 30min, adding 6mM HCl to terminate the reaction, centrifuging at 8000r/min for 10min, and collecting the reaction supernatant; HPLC is used to detect the concentration of 3, 4-dimethoxyamphetamine, and the analytical method is the same as that of example 1 for "determining the stereoselectivity of novel omega-TA". Definition of enzyme activity: the amount of enzyme required to catalyze the formation of 1. mu. moL of R-3,4 dimethoxyamphetamine per hour at 30 ℃ and pH8.0 is defined as one enzyme activity unit (U). Through enzyme activity detection, the enzyme activity of MgTA is 84.6U/g, and the enzyme activity of MjTA is 43.8U/g.

Table 2: determination of the Activity of recombinant enzymes

Example 3: enzyme recombination and screening

Subject group application patent CN201910871261.3 discloses highly efficient R-selective Gibberellazeae TA mutant (hereinafter referred to as GzTA)₇) The activity of sitagliptin precursor ketone is 210.3U/g, and 200mM of precursor ketone can be catalyzed and converted into sitagliptin, and the conversion rate is 82.6%. (GzTA)₇The nucleotide sequence of (A) is shown as SEQ ID NO.8, and the amino acid sequence of the coding enzyme is shown as SEQ ID NO. 7). The invention respectively carries out DNA recombination with MjTA and MgTA to obtain a new mutant.

1. Clone GzTA₇MjTA and MgTA catalytic regions

(1) GztA synthesized according to need₇The primer is designed by the nucleotide sequence fragment, and the rapid PCR technology is utilized to recombine the carrier pET28b/GzTA₇As a template, GzTA was synthesized₇N-terminal catalytic region of (A)₁) The DNA fragment of (1), the primers are:

forward primer A₁：CATGGATGTCTACCATGGACAAA

Reverse primer A₁：CGGGTCCATAGAACCCGGC

And (3) PCR reaction system: 2X Phanta Max Buffer (containing Mg)²⁺)25 μ L of dNTPs10mM, forward primer A₁2. mu.L (primer concentration 5 pmol/. mu.L, the same applies below), reverse primer A₁mu.L, template DNA 1. mu.L (template concentration 20 ng/. mu.L, the same applies hereinafter), Phanta Max Super-Fidelity DNA Polymerase 50U, ddH was added₂O to 50. mu.L.

PCR amplification conditions: 3min at 95 ℃; (95 ℃ for 15s, 50 ℃ for 15s, 61 ℃ for 1min) for 30 cycles; 5min at 72 ℃.

GztA synthesized according to need₇The primer is designed by the nucleotide sequence fragment, and the rapid PCR technology is utilized to recombine the carrier pET28b/GzTA₇As a template, GzTA was synthesized₇C-terminal catalytic region of (B)₁) The DNA fragment of (1), the primers are:

forward primer B₁：ACCTACAAAAACCTGCAGTGG

Reverse primer B₁：CTGGAGTGGTGGTGGTGGTGGTGCA

And (3) PCR reaction system: 2X Phanta Max Buffer (containing Mg)²⁺)25 μ L of dNTPs10mM, forward primer B₁2 μ L, reverse primer B₁2 μ L, template DNA1 μ L, Phanta Max Super-Fidelity DNA Polymerase 50U, ddH was added₂O to 50. mu.L.

PCR amplification conditions: 3min at 95 ℃; (95 ℃ for 15s, 50 ℃ for 15s, 60 ℃ for 1min)30 cycles; 5min at 72 ℃.

(2) Designing a primer according to the nucleotide sequence fragment of MjTA to be synthesized, and synthesizing an N-terminal catalytic region (A for short) of the MjTA by using a rapid PCR technology and a recombinant vector pET28b/MjTA as a template₂) The DNA fragment of (1), the primers are:

forward primer A₂：CATGGATGGATCAAACTACCGCTACACA

Reverse primer A₂：ATTTTTAATGCTCGGATC

And (3) PCR reaction system: 2X Phanta Max Buffer (containing Mg)²⁺)25 μ L of dNTPs10mM, forward primer A₂2 μ L, reverse primer A₂2 μ L, template DNA1 μ L, Phanta Max Super-Fidelity DNA Polymerase 50U, ddH was added₂O to 50. mu.L.

PCR amplification conditions: 3min at 95 ℃; (95 ℃ for 15s, 50 ℃ for 15s, 53 ℃ for 1min)30 cycles; 5min at 72 ℃.

Designing a primer according to the nucleotide sequence fragment of MjTA to be synthesized, and synthesizing a C-terminal catalytic region (B for short) of the MjTA by using a rapid PCR technology and a recombinant vector pET28B/MjTA as a template₂) The DNA fragment of (1), the primers are:

forward primer B₂：TATCACTGGCTCGACCTAGTACGAGGTCTG

Reverse primer B₂：CTCGAATGGTGATGGTGATGGTGTGGATATTT

And (3) PCR reaction system: 2X Phanta Max Buffer (containing Mg)²⁺)25 μ L of dNTPs10mM, forward primer B₂2 μ L, reverse primer B₂2 μ L, template DNA1 μ L, Phanta Max Super-Fidelity DNApolymerase 50U, ddH was added₂O to 50. mu.L.

PCR amplification conditions: 3min at 95 ℃; (95 ℃ for 15s, 50 ℃ for 15s, 63 ℃ for 1min)30 cycles; 5min at 72 ℃.

(3) According to the nucleotide sequence fragment of MgTA to be synthesizedCounting a primer, and synthesizing an N-terminal catalytic region (A for short) of the MgTA by using a rapid PCR technology and a recombinant vector pET28b/MgTA as a template₃) DNA fragment, primer:

forward primer A₃：CATGGATGACCCTGACCAACGACGCTGGTACCTCTAACC

Reverse primer A₃：GTACATCTGTTCCAGCGGCGGGAAAACCCACAGGTA

And (3) PCR reaction system: 2X Phanta Max Buffer (containing Mg)²⁺)25 μ L of dNTPs10mM, forward primer A₃2 μ L, reverse primer A₃2 μ L, template DNA1 μ L, Phanta Max Super-Fidelity DNA Polymerase 50U, add ddH₂O to 50. mu.L.

PCR amplification conditions: 3min at 95 ℃; (95 ℃ for 15s, 50 ℃ for 15s, 61 ℃ for 1min)30 cycles; 5min at 72 ℃.

Designing a primer according to a nucleotide sequence fragment of MgTA to be synthesized, and synthesizing a C-terminal catalytic region (B for short) of the MgTA by using a rapid PCR technology and a recombinant vector pET28B/MgTA as a template₃) DNA fragment, primer:

forward primer B₃：GGTACCTCTGCTATCGTTCCGCGTCAC

Reverse primer B₃：ATAGCGTGGTGGTGGTGGTGGTGGTA

And (3) PCR reaction system: 2X Phanta Max Buffer (containing Mg)²⁺)25 μ L of dNTPs10mM, forward primer B₃2 μ L, reverse primer B₃2 μ L, template DNA1 μ L, Phanta Max Super-Fidelity DNApolymerase 50U, add ddH₂O to 50. mu.L.

2. Construction of recombinant enzyme genetically engineered bacteria

Mixing GzTA₇N-terminal catalytic region A of₁Respectively with the C-terminal catalytic region B of MgTA and MjTA₃、B₂Recombining to obtain 2 new mutants; at the same time, GZTA is added₇C-terminal catalytic region B of₁Respectively with N-terminal catalytic regions A of MgTA and MjTA₃、A₂Recombination to obtain 2 new mutants. The recombination strategy is shown in Table 3, and the specific operation is as follows.

Table 3: recombination strategies for novel mutants

With GztA₇N-terminal catalytic region forward primer A₁As a forward primer, a reverse primer B of a C-terminal catalytic region of MgTA and MjTA₃、B₂For the reverse primer, two primers are designed to be connected with A at the same time₁And B₃And A₁And B₂. The target fragments were amplified using ExTaq enzyme and GzTA was performed separately₇N-terminal catalytically active region (A)₁) C-terminal catalytically active region (B) with MgTA₃) The gene fragment of (1) fusion PCR, GzTA₇N-terminal catalytically active region (A) of (A)₁) And the C-terminal catalytically active region (B) of MjTA₂) The gene fragment of (3) was fused with PCR.

Upstream primer A₁ B₃：GCCGGGTTCTATGGACCCGTATCACTGGCTCGACCTAGTA

Downstream primer A₁ B₃：TACTAGGTCGAGCCAGTGATACGGGTCCATAGAACCCGGC

GzTA₇Fragment fusion PCR with MgTA (A)₁And B₃Fragment fusion) reaction system: 10X Phanta Max Buffer (containing Mg)²⁺)10 μ L of dNTPs10mM, forward primer A₁2 μ L, forward primer A₁B₃2 μ L, downstream primer A₁B₃2 μ L, reverse primer B₃ 2μL，GzTA₇Template 2. mu.L, MgTA template 2. mu.L, ExTaq enzyme 1. mu.L, ddH was added₂O to 100. mu.L.

Upstream primer A₁B₂：TCTATGGACCCGTATCACTGGCTCGACCTAGTACGAG

Downstream primer A₁B₂：CTCGTACTAGGTCGAGCCAGTGATACGGGTCCATAGA

GzTA₇Fragment fusion PCR with MjTA (A)₁And B₂Fragment fusion) reaction system: 10X Phanta Max Buffer (containing Mg)²⁺)10 μ L of dNTPs10mM, forward primer A₁2 μ L, forward primer A₁B₂2 μ L, downstream primer A₁B₂2 μ L, reverse primer B₂ 2μL，GzTA₇Template 2. mu.L, MjTA template 2. mu.L, ExTaq enzyme 1. mu.L, ddH₂O to 100. mu.L.

PCR amplification conditions: at 94 ℃ for 5min, 30 cycles (94 ℃ for 30s, 63 ℃ for 30s, 72 ℃ for 30s), and 7min at 72 ℃.

(2) With GztA₇C-terminal catalytic region reverse primer B₁As a reverse primer, a forward primer A is formed by the N-terminal catalytic region of MgTA and MjTA₃、A₂Two primer linkages, A3 and B1 and a2 and B1, were involved simultaneously for the forward primer. The target fragment was amplified by ExTaq enzyme to carry out MgTA N-terminal catalytic active region (A)₃) And GzTA₇C-terminal catalytically active region (B)₁) The gene fragment of (3) was fused with PCR, and the N-terminal catalytic active region of MjTA (A)₂) And GzTA₇C-terminal catalytically active region (B)₁) The gene fragment of (3) was fused with PCR.

Upstream primer A₃B₁：CCGCCGCTGGAACAGATGTACACCTACAAAAACCTGC

Downstream primer A₃B₁：GCAGGTTTTTGTAGGTGTACATCTGTTCCAGCGGCGG

GzTA₇Fragment fusion PCR with MgTA (A)₃And B₁Fragment fusion) reaction system: 10X Phanta Max Buffer (containing Mg)²⁺)10 μ L of dNTPs10mM, forward primer A₃2 μ L, forward primer A₃B₁2 μ L, downstream primer A₃B₁2 μ L reverse primer B₁ 2μL，GzTA₇Template 2. mu.L, MgTA template 2. mu.L, ExTaq enzyme 1. mu.L, ddH was added₂O to 100. mu.L.

Upstream primer A₂B₁：GATCCGAGCATTAAAAATACCTACAAAAACCTGC

Downstream primer A₂B₁：GCAGGTTTTTGTAGGTATTTTTAATGCTCGGATC

GzTA₇Fragment fusion PCR with MjTA (A)₂And B₁Fragment fusion) reaction system: 10X Phanta Max Buffer (containing Mg)²⁺)10 μ L of dNTPs10mM, forward primer A₂2 μ L, forward primer A₂B₁2 μ L, downstream primer A₂B₁2 μ L, reverse primer B₁ 2μL，GzTA₇Template 2. mu.L, MjTA template 2. mu.L, ExTaq enzyme 1. mu.L, ddH₂O to 100. mu.L.

The nucleotide sequences of 4 mutants pET28b/TAmutant-1, pET28b/TAmutant-2, pET28b/TAmutant-3, pET28b/TAmutant-4 were obtained as SEQ ID Nos. 10, 12, 14 and 16, respectively; the amino acid sequence of the coding enzyme is SEQ NO 9, 11, 13 and 15; the four recombinant genes obtained by adding 6 Xhis-tag labels to the ends of the nucleotide sequences and adding restriction enzyme sites Xho I and Nco I to the two ends of the four recombinant genes respectively are cloned to the Xho I site and the Nco I site corresponding to pET28b (+), so as to obtain recombinant expression plasmids pET28 b/TAmusant-1, pET28 b/TAmusant-2, pET28 b/TAmusant-3 and pET28 b/TAmusant-4.

1 μ L of the constructed recombinant plasmid was added to 100 μ L of the competent cell suspension in ice bath, and allowed to stand on ice for 30min, and the transformed product was heat-shocked at 42 ℃ for 90s and rapidly placed on ice for 2 min. Adding 600 mu L of LB liquid culture medium into an Ep tube, culturing at 37 ℃ for 60min at 150r/min, centrifuging at 12000r/min for 1min, discarding 600 mu L of supernatant, suspending the residual bacterial liquid, plating, after the bacterial liquid is completely absorbed by the culture medium, performing inverted culture at 37 ℃ for 12h, and selecting transformants for later use.

3. Induced expression of recombinant engineering bacteria

The same procedure as in example 1 was repeated to "induced expression of recombinant engineered bacteria".

4. Ultrasonic disruption of recombinant engineering bacteria

And (3) crushing the wet thalli by an ultrasonic crushing method. 1g of the prepared wet cells (TAmutant-1, TAmutant-2, TAmutant-3 and TAmutant-4) were suspended in 10mL of triethanolamine-HCl (pH7.5) buffer, sonicated at 39W for an effective time of 5min, and the supernatant was collected by centrifugation.

4. Accurate determination of sitagliptin precursor ketolase activity by recombinant engineering bacteria

Taking the broken supernatant of each enzyme to be used for the following reaction: 20mM sitagliptin precursor ketone, 400. mu.L of disruptorThe supernatant (enzyme solution) was minced, 80mM isopropylamine, 1mM PLP, and triethanolamine-HCl buffer (pH 8.0) was added to 10mL of the total. Reaction conditions are as follows: reacting at 30 ℃ for 24h, adding 6mM HCl to stop the reaction, centrifuging at 8000r/min for 10min, taking the reaction supernatant, and detecting the concentration of sitagliptin by HPLC. The analysis method comprises the following steps: the analytical column was an Agilent C18 column (250X 4.6mm, 5 μm) (Agilent technologies, Inc., USA). Agilent 2414 fluorescence detector, Agilent 1525 pump, Agilent 717 sample injector. Mobile phase: a mixture of acetonitrile and 10mM ammonium acetate (volume ratio 55:45), flow rate 1.5mL/min, detection wavelength 265 nm. Definition of enzyme activity: the amount of enzyme required to catalyze the formation of 1. mu. mol of sitagliptin from the sitagliptin precursor ketone per hour at 30 ℃ and pH8.0 is defined as one unit of enzyme activity (U). The enzyme activity was measured (see Table 4). GztA₇The enzyme activity to the sitagliptin precursor ketone is 210.3U/g, compared with that the recombinant mutant strain TAmutant-4 shows higher catalytic activity 213.5U/g, and other recombinant mutant strains have no activity or lower activity to the sitagliptin precursor ketone substrate.

Table 4: enzyme activity determination of sitagliptin precursor ketone by each recombinant mutant strain

5. Determination of stereoselectivity of recombinant engineering bacteria

Reaction system: 20mM of sitagliptin precursor ketone, 200. mu.L of the disruption supernatant (Tamutant-1 enzyme solution, Tamutant-2 enzyme solution, Tamutant-3 enzyme solution and Tamutant-4 enzyme solution), 50mM of R-. alpha. -methylbenzylamine, 1mM of PLP, and triethanolamine-HCl buffer (pH 8.0) was added to 5mL of the total. Reaction conditions are as follows: reacting at 30 deg.C for 30min, adding 6mM HCl to terminate the reaction, centrifuging at 8000r/min for 10min, and collecting the reaction supernatant; the configuration of sitagliptin was examined by HPLC. The analysis method comprises the following steps: analytical column Daicel Chiralpak AD-H column (4.6X 150mm,5 μm) (Daiiluol pharmaceutical chiral technologies, Inc., Shanghai, China). Ag1lent 2414 fluorescence detector, Agilent 1525 pump, Agilent 717 sample injector. The mobile phase is a mixed solution of ethanol and heptane (volume ratio 60:40), the flow rate is 0.8mL/min, and the column temperature is 35 ℃. As can be seen from Table 5, TAmutant-2, TAmutant-3, and TAmutant-4 are capable of catalyzing the formation of the R-sitagliptin product from the sitagliptin precursor ketone.

Table 5: stereoselectivity of recombinant mutants

Example 4: construction and screening of Tamutant-4 single-site mutant

1. Construction of mutants

Carrying out single-point mutation on the screened R-omega-TA in a mutation library, designing a primer for site-directed mutation according to the amino acid sequence (SEQ ID NO.15) of the TAmutant-4, and introducing the single-point mutation to the 71 th position of the amino acid sequence of the TAmutant-4 by using a rapid PCR technology and a recombinant vector pET28b/TAmutant-4 as a template, wherein the primer is as follows:

forward primer 71H: GTTCTTCCGTNNKGACGACCAC (base mutation underlined)

Reverse primer 71H: GTGGTCGTCMNNCGGAAGAAC (base mutation underlined)

And (3) PCR reaction system: 2X Phanta Max Buffer (containing Mg)²⁺)25 μ L of dNTPs10mM, forward primer 71H 2 μ L, reverse primer 71H 2 μ L, template DNA1 μ L, Phanta Max Super-Fidelity DNA Polymerase 50U, ddH was added₂O to 50. mu.L.

PCR amplification conditions were 95 ℃ for 3 min; (95 ℃ for 15s, 50 ℃ for 15s, 61 ℃ for 6.5min) for 30 cycles; 5min at 72 ℃.

mu.L of PCR product was added to 100. mu.L of ice-bath competent cell suspension, and allowed to stand on ice for 30min, and the transformed product was heat-shocked at 42 ℃ for 90s and rapidly placed on ice for 2 min. Adding 600 mu L of LB liquid culture medium into an Ep tube, culturing at 37 ℃ for 60min at 150r/min, centrifuging at 12000r/min for 1min, discarding 600 mu L of supernatant, suspending the residual bacterial liquid, plating, after the bacterial liquid is completely absorbed by the culture medium, performing inverted culture at 37 ℃ for 12h, and selecting positive transformants for later use. A single clone was cultured overnight at 37 ℃ in LB liquid medium containing 50. mu.g/mL of kanamycin.

2. High throughput screening for positive transformants

The reaction mixture consists of: 52mM o-xylylenediamine dihydrochloride, 30mM sitagliptin precursor ketone, 1mM PLP, 0.1M KOH, and deionized water were added to the total reaction system to prepare 1L.

Adding 100 μ L LB culture solution containing kanamycin to a final concentration of 50 μ g/mL into each well of a 96-well polystyrene micropore culture plate, inoculating different transformed colonies, and culturing OD at 37 ℃ and 150r/min₆₀₀And when the concentration is 0.6-0.8, adding IPTG with the final concentration of 1mM into the culture solution, performing induced expression for 10 hours at 28 ℃, centrifuging for 10 minutes at 4 ℃ and 8000r/min, and discarding the supernatant. Adding 265 μ L of the above reaction mixture into 96-well plate containing thallus, shaking with oscillator, mixing, reacting at 30 deg.C and 500r/min for 30min, and stopping reaction in ice bath for 3 min. And taking the reaction of the recombinant bacterium E.coli BL21(DE3)/pET28b/TAmutant-4 as a control, and taking a mutant strain with the color ratio E.coli BL21(DE3)/pET28b/TAmutant-4 and having deep reaction for enzyme activity determination.

3. Positive transformant fermentation enzyme production

4. Enzyme activity detection of single-site mutants on sitagliptin precursor ketones

The activity of each mutant was determined according to "precise determination of sitagliptin precursor ketolase activity by recombinant engineering bacteria" in example 3, which shows the following results: the 664 obtained recombinant transformation bacteria are primarily screened by a high-flux method, 4 mutant strains with improved enzyme activity are screened out, and the specific results are shown in table 6 after the enzyme activity is measured. Analysis confirmed that the reason why the remaining 660 recombinant enzymes remained unchanged or decreased is that histidine H at position 71 was changed to other amino acids than lysine K, threonine T, arginine R, and alanine a.

Table 6: enzyme activity detection of single-point mutation engineering bacteria

The mutant pET28 b/TAmusant-4-H71T with the most improved enzyme activity is marked as TAmusant-4₁Obtaining recombinant bacteria E.coli BL21(DE3)/pET28b/TAmutant-4₁。

Example 5: construction and screening of Tamutant-4 two-site mutant

Mutant TAmutant-4 constructed according to example 4₁Designing a mutation primer for site-directed mutagenesis by sequence design, and using a rapid PCR technology to recombine a vector pET28b/TAmutant-4₁As template, for Tamutant-4₁A single mutation is introduced into the 135 th site of the amino acid sequence, and the primers are as follows:

forward primer 135V: GAAGTTCTGNNKAACCACCTG (base mutation underlined)

Reverse primer 135V: CAGGTGGTTMNNCAGAACTTC (base mutation underlined)

The PCR reaction system was performed in the same manner as in "construction of mutant" in example 4.

PCR amplification conditions were 95 ℃ for 3 min; (95 ℃ for 15s, 57 ℃ for 20s, 72 ℃ for 7min) for 30 cycles; 10min at 72 ℃.

E.coli BL21(DE3) competent cells were transformed with the PCR product, and the colonies were picked up in LB liquid medium containing 50. mu.g/mL kanamycin and cultured overnight at 37 ℃. The mutant is preliminarily screened by the high-flux screening method, and the method is the same as the high-flux screening positive transformant of the embodiment 4, and the recombinant strain E.coli BL21(DE3)/pET28b/TAmutant-4 is used₁The reaction of (5) was compared with the color ratio E.coli BL21(DE3)/pET28b/Tamutant-4₁The enzyme activity of the deeply reacted mutant strain of (1) is measured.

And (5) detecting the enzyme activity of the preliminarily screened positive mutant strain. The results of this example are: the 759 recombinant transformed strains are screened out for the first time, 8 mutant strains with improved enzyme activity are screened out, and then the enzyme activity is detected, and the specific results are shown in table 7. Analysis confirmed that the reason why the remaining 751 strains of recombinant bacterial enzymes remained unchanged or decreased is that valine V at position 135 was mutated for amino acids other than threonine T, glycine G, leucine L, alanine A, isoleucine I, proline P, phenylalanine F and glutamic acid E.

Table 7: enzyme activity determination of two-point mutation recombinant bacteria

Mutant pET28b/TAmutant-4 with most obvious improvement of enzyme activity₁-V135L denoted TAmutant-4₂Obtaining recombinant bacteria E.coliBL21(DE3)/pET28b/TAmutant-4₂。

Example 6: construction and screening of Tamutant-4 three-site mutant

Two mutant, TAmutant-4, constructed according to example 5₂Designing a mutation primer for site-directed mutagenesis by sequence design, and using a rapid PCR technology to recombine a vector pET28b/TAmutant-4₂As template, for Tamutant-4₂Single mutation is introduced into 292 th site of the amino acid sequence, and the primer is:

forward primer 292G: AAAGTTGGCNNKGTCACTAGT (base mutation underlined)

Reverse primer 292G: ACTAGTGACMNNGCCAACTTT (base mutation underlined)

The PCR reaction system was the same as that of example 4 for "construction of mutant".

PCR amplification conditions were 95 ℃ for 3 min; (95 ℃ for 15s, 54 ℃ for 15s, 61 ℃ for 6.5min) for 30 cycles; 5min at 72 ℃.

E.coli BL21(DE3) competent cells were transformed with the PCR product, and the colonies were picked up in LB liquid medium containing 50. mu.g/mL kanamycin and cultured overnight at 37 ℃. The mutants were screened initially by the high throughput screening method mentioned above, and the "high throughput screening of positive transformants" of method example 4 was performed with the recombinant bacterium E.coli BL21(DE3)/pET28b/TAmutant-4₂The reaction of (5) was compared with the color ratio E.coli BL21(DE3)/pET28b/Tamutant-4₂The enzyme activity of the deeply reacted mutant strain of (1) is measured.

And (5) detecting the enzyme activity of the preliminarily screened positive mutant strain. The results of this example are: the 689 recombinant transformed strains are preliminarily screened by a high-flux method, 6 mutant strains with improved enzyme activity are screened out, and the enzyme activity is measured, wherein specific results are shown in table 8. Analysis confirmed that the remaining 683 recombinant enzymes remained unchanged or decreased due to the change of glycine G at position 292 to amino acids other than alanine A, leucine L, arginine R, cysteine C, histidine H, and isoleucine I.

Table 8: enzyme activity determination of three-point mutation recombinant bacteria

Mutant pET28b/TAmutant-4 with most obvious improvement of enzyme activity₂G292R (amino acid sequence is SEQ ID NO.17, coding gene sequence is SEQ ID NO.18) is marked as TAmutant-4₃Obtaining recombinant bacteria E.coliBL21(DE3)/pET28b/TAmutant-4₃。

Example 7: recombinant escherichia coli fermentation enzyme production

Respectively preparing recombinant bacteria E.coli BL21(DE3)/pET28b/TAmutant-4 and E.coli BL21(DE3)/pET28b/TAmutant-4₁、E.coliBL21(DE3)/pET28b/TAmutant-4₂、E.coliBL21(DE3)/pET28b/TAmutant-4₃Then, the mixture was inoculated into LB liquid medium containing 50. mu.g/mL kanamycin at a final concentration, and OD was cultured at 37 ℃ at 150 rpm₆₀₀About 0.6 to 0.8 to obtain a seed solution; the seed solution was inoculated into a fresh LB liquid medium containing 50. mu.g/mL kanamycin at a final concentration in an inoculum size of 2% (v/v), and OD was cultured at 37 ℃ and 150r/min₆₀₀And when the concentration is 0.6-0.8, adding IPTG (isopropyl thiogalactoside) with the final concentration of 1mM into the culture solution, performing induced expression at 28 ℃ for 12 hours, centrifuging at 4 ℃ and 8000r/min for 10min, discarding supernatant, and washing wet thalli twice with 0.85% physiological saline for later use.

Example 8: determination of optimum temperature of catalytic enzyme

1g of wet cells of the original enzyme or the mutant enzyme of example 7 were collected, suspended in 10mL of triethanolamine-HCl (pH7.5) buffer, sonicated at 39W for an effective period of 5min, and the disrupted supernatant was collected by centrifugation. Purifying with nickel-NTA agarose gel column, equilibrating the chromatographic column with equilibration buffer (20mM phosphate buffer, 300mM NaCl, 20mM imidazole, pH 8.0), eluting with eluent (50mM phosphate buffer, 300mM NaCl, 500mM imidazole, pH 8.0), and collecting corresponding eluates according to the signal response of the ultraviolet detector, namely the respective pure enzyme solutions.

The above-mentioned pure enzyme solution was used as an enzyme for conversion, and the optimum reaction temperature of the enzyme was measured. ReactantThe method comprises the following steps: 50mM sitagliptin precursor ketone, 240mM isopropylamine, 2mM PLP, 1mL of pure enzyme solution, triethanolamine-HCl buffer (pH 9.0) was added to 10mL of the total system. The activity of TA is measured at different conversion temperatures (20-60 ℃), and the measurement method is the same as that of the recombinant engineering bacteria in example 3 for accurately measuring the activity of the sitagliptin precursor ketolase, and the result is shown in figure 3. The enzyme activity at the optimum reaction temperature of each enzyme was set to 100%. Finally, E.coli BL21(DE3)/pET28b/Tamutant-4₃The optimum reaction temperature of (2) is the highest and reaches 50 ℃. The high temperature is favorable for driving the reaction equilibrium to move forward and improving the product yield, so that E.coli BL21(DE3)/pET28b/Tamutant-4₃Is more beneficial to catalytic application.

Example 9: recombinant bacterium whole cell catalyzed sitagliptin precursor ketone asymmetric synthesis sitagliptn recombinant bacteria E.coliBL21(DE3)/pET28b/TAmutant-4, E.coliBL21(DE3)/pET28b/TAmutant-4 were obtained by the method of example 7₁、E.coliBL21(DE3)/pET28b/TAmutant-4₂、E.coliBL21(DE3)/pET28b/TAmutant-4₃The wet thallus is used as a biocatalyst, and the reaction system is as follows: various concentrations of sitagliptin precursor ketone substrate (see table 9), 3 times the amount of isopropylamine, 2mM pyridoxal phosphate (PLP), 1mL of recombinant bacteria whole cells, triethanolamine-HCl buffer (pH 9.0) was added to 100mL of the total system. Reaction conditions are as follows: reacting for 24h at 45 ℃ and 400r/min, adding 6mM HCl to terminate the reaction, centrifuging for 10min at 8000r/min, taking the supernatant, detecting the concentration and e.e. value of sitagliptin by HPLC, and calculating the conversion rate. As can be seen from Table 9, E.coli BL21(DE3) pET28b/Tamutant-4₃At a substrate concentration of 500mM, the conversion was carried out for 24h with a conversion of 99%. Coli BL21(DE3) pET28b/Tamutant-4₃The obtained conversion effect is not only better than that of other mutants of the invention, but also is remarkably improved in both substrate concentration and conversion rate compared with 92% conversion rate corresponding to the fact that ATA 117 catalyzes 492mM precursor ketone reported by Codexis. (Saville C K, Janey J M, Mundorff E C, et al, biocatalytic asymmetry Synthesis of Chiral Amines from Ketones Applied to Sitagliptin Manual [ J]Science,2010,329(5989): 305-. The technology can be used for preparing sitagliptin by large-scale asymmetric synthesis.

Table 9: comparison of sitagliptin production at different substrate concentrations

Sequence listing

<110> Zhejiang industrial university

<120> recombinant R-type transaminase, mutant and application thereof

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 345

<212> PRT

<213> Mycolicibacteriumgoodii

<400> 1

Met Thr Leu Thr Asn Asp Ala Gly Thr Ser Asn Leu Val Ala Val Glu

1 5 10 15

Pro Gly Ala Ile Arg Glu Asp Thr Pro Pro Gly Ser Val Ile Arg Tyr

20 25 30

Ser Asp Tyr Glu Leu Asp Glu Ser Ser Pro Phe Ala Gly Gly Val Ala

35 40 45

Trp Ile Glu Gly Glu Tyr Val Pro Ala Ser Glu Ala Arg Ile Ser Leu

50 55 60

Phe Asp Thr Gly Phe Gly His Ser Asp Leu Thr Tyr Thr Val Ala His

65 70 75 80

Val Trp His Gly Asn Val Phe Arg Leu His Asp His Met Asp Arg Leu

85 90 95

Tyr Asp Gly Ala Ala Lys Leu Arg Leu Asp Pro Gly Met Ser Lys Leu

100 105 110

Glu Met Ala Glu Ile Gly Lys Lys Cys Val Ser Leu Ser Gln Leu Arg

115 120 125

Glu Ser Phe Leu Asn Phe Thr Ile Thr Arg Gly Tyr Gly Lys Arg Arg

130 135 140

Gly Glu Lys Asp Leu Thr Gln Leu Thr His Gln Val Tyr Val Tyr Ala

145 150 155 160

Ile Pro Tyr Leu Trp Val Phe Pro Pro Leu Glu Gln Met Tyr Gly Thr

165 170 175

Ser Ala Ile Val Pro Arg His Val Arg Arg Ala Gly Arg Asn Thr Ile

180 185 190

Asp Pro Ser Ile Lys Asn Tyr Gln Trp Gly Asp Leu Thr Ala Ala Ser

195 200 205

Phe Glu Ala Lys Asp Arg Gly Ala Arg Thr Ala Val Leu Leu Asp Ala

210 215 220

Asp Asn Cys Val Ala Glu Gly Pro Gly Phe Asn Val Cys Ile Val Lys

225 230 235 240

Asp Gly Lys Ile Ala Ser Pro Ser Arg Asn Ala Leu Pro Gly Ile Thr

245 250 255

Arg Lys Thr Val Leu Glu Ile Ala Glu Gln Met Gly Ile Glu Ala Thr

260 265 270

Leu Arg Asp Val Thr Ser His Glu Leu Tyr Glu Ala Asp Glu Leu Ile

275 280 285

Ala Cys Thr Thr Ala Gly Gly Val Thr Pro Ile Thr Ser Leu Asp Gly

290 295 300

Glu Pro Ile Gly Asn Gly Glu Pro Gly Pro Ile Thr Val Ala Ile Arg

305 310 315 320

Asp Arg Phe Trp Ala Leu Met Asp Glu Pro Gly Pro Leu Ile Glu Ala

325 330 335

Ile Asp Tyr His His His His His His

340 345

<210> 2

<211> 1035

<212> DNA

<213> Mycolicibacteriumgoodii

<400> 2

atgaccctga ccaacgacgc tggtacctct aacctggttg ctgttgaacc gggtgctatc 60

cgtgaagaca ccccgccggg ttctgttatc cgttactctg actacgaact ggacgaatct 120

tctccgttcg ctggtggtgt tgcttggatc gaaggtgaat acgttccggc ttctgaagct 180

cgtatctctc tgttcgacac cggtttcggt cactctgacc tgacctacac cgttgctcac 240

gtttggcacg gtaacgtttt ccgtctgcac gaccacatgg accgtctgta cgacggtgct 300

gctaaactgc gtctggaccc gggtatgtct aaactggaaa tggctgaaat cggtaaaaaa 360

tgcgtttctc tgtctcagct gcgtgaatct ttcctgaact tcaccatcac ccgtggttac 420

ggtaaacgtc gtggtgaaaa agacctgacc cagctgaccc accaggttta cgtttacgct 480

atcccgtacc tgtgggtttt cccgccgctg gaacagatgt acggtacctc tgctatcgtt 540

ccgcgtcacg ttcgtcgtgc tggtcgtaac accatcgacc cgtctatcaa aaactaccag 600

tggggtgacc tgaccgctgc ttctttcgaa gctaaagacc gtggtgctcg taccgctgtt 660

ctgctggacg ctgacaactg cgttgctgaa ggtccgggtt tcaacgtttg catcgttaaa 720

gacggtaaaa tcgcttctcc gtctcgtaac gctctgccgg gtatcacccg taaaaccgtt 780

ctggaaatcg ctgaacagat gggtatcgaa gctaccctgc gtgacgttac ctctcacgaa 840

ctgtacgaag ctgacgaact gatcgcttgc accaccgctg gtggtgttac cccgatcacc 900

tctctggacg gtgaaccgat cggtaacggt gaaccgggtc cgatcaccgt tgctatccgt 960

gacaggttct gggctctgat ggacgaaccg ggtccgctga tcgaagctat cgactaccac 1020

caccaccacc accac 1035

<210> 3

<211> 333

<212> PRT

<213> Amine transaminase

<400> 3

Met His His His His His His Met Ala Thr Met Asp Glu Val Phe Ala

1 5 10 15

Gly Tyr Ala Lys Arg Gln Ala Thr Leu Lys Ala Ser Thr Asn Ile Leu

20 25 30

Ser Gln Gly Ile Ala Trp Val Glu Gly Glu Leu Val Pro Leu Gln Ser

35 40 45

Ala Arg Ile Pro Leu Leu Asp Gln Gly Phe Met His Ser Asp Leu Thr

50 55 60

Tyr Asp Val Pro Ser Val Trp Asp Gly Arg Phe Phe Arg Leu Asp Asp

65 70 75 80

His Leu Asp Arg Leu Glu Ala Ser Cys Lys Lys Met Arg Leu Arg Phe

85 90 95

Pro Ile Pro Arg Glu Glu Ile Lys Lys Ile Leu Val Glu Met Val Ala

100 105 110

Lys Ser Glu Ile Lys Asp Ala Phe Val Glu Leu Ile Val Thr Arg Gly

115 120 125

Leu Lys Gly Val Arg Gly Ala Lys Pro Glu Glu Leu Leu Asn Asn Asn

130 135 140

Leu Tyr Met Phe Val Gln Pro Tyr Val Trp Val Met Asp Pro Glu Asp

145 150 155 160

Gln Tyr His Gly Gly Arg Ala Ile Val Ala Arg Thr Val Arg Arg Val

165 170 175

Pro Pro Gly Ser Ile Asp Pro Thr Ile Lys Asn Leu Gln Trp Gly Asp

180 185 190

Leu Val Arg Gly Leu Phe Glu Ala Asn Asp Arg Gly Ala Thr Tyr Pro

195 200 205

Phe Leu Thr Asp Gly Asp Ala Asn Leu Thr Glu Gly Ser Gly Phe Asn

210 215 220

Val Val Ile Ile Lys Asn Gly Val Leu Tyr Thr Pro Asp Arg Gly Val

225 230 235 240

Leu Gln Gly Ile Thr Arg Lys Ser Val Ile Asp Ala Ala Arg Ser Cys

245 250 255

Gly Tyr Glu Ile Arg Ile Glu His Val Pro Val Glu Ala Ala Tyr Gln

260 265 270

Ala Asp Glu Ile Leu Met Cys Thr Thr Ala Gly Gly Ile Met Pro Ile

275 280 285

Thr Thr Leu Asp Asp Lys Pro Val Asn Asp Gly Lys Val Gly Pro Ile

290 295 300

Thr Lys Ala Ile Trp Asp Arg Tyr Trp Ala Met His Trp Glu Asp Glu

305 310 315 320

Phe Ser Phe Lys Ile Asp Tyr His His His His His His

325 330

<210> 4

<211> 999

<212> DNA

<213> Amine transaminase

<400> 4

atgcatcacc atcaccatca catggctact atggatgaag tttttgccgg ttatgcaaaa 60

cgtcaagcga ccttaaaggc ttctacaaat attttgtccc agggcatcgc ctgggtcgag 120

ggagaacttg tacctctcca atcagcacgc atacccctac tggaccaggg gttcatgcat 180

tcggatttaa cgtacgacgt gccaagtgtt tgggatggtc gatttttccg gttggacgat 240

caccttgaca gactcgaggc gagctgtaaa aagatgaggc tacgttttcc gattcctcgc 300

gaagagatca aaaagatact ggtcgaaatg gtagctaaat ctgagattaa ggatgccttc 360

gtggaattaa tcgttactcg aggcttgaaa ggagtccggg gggcaaagcc cgaggaactt 420

ctcaacaata acctatatat gtttgtacaa ccatacgtgt gggttatgga cccggaggat 480

cagtatcatg gtggcagagc gatagtcgct aggaccgtac gtcgcgtgcc tcccggatcc 540

attgacccaa caatcaaaaa tctgcaatgg ggggatttag ttcgaggttt gttcgaagcc 600

aacgaccggg gcgcaacgta cccgtttctt actgatggag acgcgaatct caccgagggg 660

tcaggtttca acgtcgtaat aattaagaat ggcgtgctat atacacctga tagaggagtt 720

ctgcagggga tcacgaggaa atcggtcata gacgctgccc gtagttgcgg ttacgaaatt 780

cgcatcgagc acgtacccgt ggaagcagcg tatcaagctg atgagatatt aatgtgtact 840

accgccggcg gaattatgcc aatcacaacg ttggacgata agccggttaa cgacgggaaa 900

gtcggtccta taactaaggc aatttgggat cgatactggg cgatgcattg ggaagacgag 960

tttagcttca aaatcgatta tcaccaccac caccaccac 999

<210> 5

<211> 326

<212> PRT

<213> Mesorhizobiumjaponicum

<400> 5

Met Asp Gln Thr Thr Ala Thr Gln Ala Ser Lys Pro Leu Pro Thr Val

1 5 10 15

Gly Asp Arg His Val Asp Pro His Ser Tyr Pro Asp Gly Ile Ala Phe

20 25 30

Leu Asp Gly Gln Tyr Leu Pro Met Ser Gln Ala Lys Val Ser Val Leu

35 40 45

Asp Trp Gly Phe Leu His Ser Asp Ala Thr Tyr Asp Thr Val His Val

50 55 60

Trp Asn Gly Arg Phe Phe Arg Leu Asp Leu His Leu Asp Arg Phe Phe

65 70 75 80

Gly Gly Leu Glu Lys Leu Arg Met Thr Ile Pro Phe Asp Arg Asp Gly

85 90 95

Val Ala Glu Ile Leu His Asn Cys Val Ala Leu Ser Gly His Arg Ala

100 105 110

Ala Tyr Val Glu Met Leu Cys Thr Arg Gly Ala Ser Pro Thr Phe Ser

115 120 125

Arg Asp Pro Arg Gln Ala Ile Asn Arg Phe Met Ala Phe Ala Val Pro

130 135 140

Phe Gly Ser Val Ala Asn Ala Glu Gln Leu Gln Arg Gly Leu Arg Val

145 150 155 160

Ala Ile Ser Asp Lys Val Arg Ile Pro Pro Ala Ser Val Asp Pro Ser

165 170 175

Ile Lys Asn Tyr His Trp Leu Asp Leu Val Arg Gly Leu Tyr Asp Ala

180 185 190

Tyr Asp Ser Gly Ala Glu Thr Ala Leu Ile Leu Asp Phe Asn Gly Asn

195 200 205

Val Ala Glu Gly Pro Gly Phe Asn Val Phe Cys Val Lys Asp Gly Lys

210 215 220

Leu Ser Thr Pro Ala Ile Gly Val Leu Pro Gly Ile Thr Arg Arg Thr

225 230 235 240

Val Phe Asp Leu Cys Ala Glu Glu Gly Leu Ala Ala Ala Ala Ala Asp

245 250 255

Val Ser Val Ala Ala Leu Lys Ala Ala Asp Glu Val Phe Ile Thr Ser

260 265 270

Thr Ala Gly Gly Ile Met Pro Val Thr Glu Ile Asp Gly Ala Ala Ile

275 280 285

Ala Asp Gly Lys Val Gly Pro Val Thr Ser Arg Leu Met Ala Leu Tyr

290 295 300

Trp Gln Lys His Asp Asp Pro Ala Trp Ser Ser Gln Val Lys Tyr Pro

305 310 315 320

His His His His His His

325

<210> 6

<211> 978

<212> DNA

<213> Mesorhizobiumjaponicum

<400> 6

atggatcaaa ctaccgctac acaggcctct aaacctttac ccacggttgg tgaccgtcat 60

gtcgatccac actcctatcc ggacggcatt gcatttttgg atggacaata ccttcctatg 120

tcacaggcga aggtatcggt gctcgactgg gggttcctac atagtgatgc tacttatgac 180

accgttcacg tctggaatgg tcgctttttc cgactggatt tacatttgga ccggtttttc 240

ggcggacttg aaaaactcag aatgacaatc ccctttgata gggacggggt agccgagata 300

ctacacaact gtgtggcact gagcggtcat cgtgcggctt acgttgaaat gttatgcacg 360

cgcggcgcct ctccaacttt ctcccgagat ccgcggcaag caattaatag atttatggcg 420

ttcgctgtcc cttttggatc agtagccaac gcagagcagt tgcaaagggg gcttcgtgtg 480

gcgatctcgg acaaggttcg cataccccca gctagtgtcg atccgagcat taaaaattat 540

cactggctcg acctagtacg aggtctgtac gatgcctatg actctggcgc agaaaccgcg 600

ttaatcttgg atttcaacgg aaatgtggct gaggggcctg gttttaacgt tttctgtgtc 660

aaggacggca aactttccac acccgccata ggagtactcc cagggattac gcggagaact 720

gtgtttgatc tatgcgcaga agagggtctg gcggctgccg cagcggacgt ttcagtcgct 780

gccttaaagg cagcggatga agtattcatc acctcgacag ctggcggaat aatgccggtg 840

acggagattg acggggccgc aatcgcggat ggtaaagttg gccctgtcac tagtaggttg 900

atggctcttt actggcagaa gcatgacgat cccgcctgga gctctcaagt aaaatatcca 960

caccatcacc atcaccat 978

<210> 7

<211> 331

<212> PRT

<213> Artificial sequence (unkown)

<400> 7

Met Ser Thr Met Asp Lys Ile Phe Ala Gly His Ala Gln Arg Gln Ala

1 5 10 15

Thr Leu Val Ala Ser Asp Asn Ile Phe Ala Asn Gly Ile Ala Trp Ile

20 25 30

Gln Gly Glu Leu Val Pro Leu Asn Glu Ala Arg Ile Pro Leu Met Asp

35 40 45

Gln Gly Phe Met His Gly Asp Leu Thr Tyr Asp Asn Pro Ala Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Asp Arg Leu Glu Ala

65 70 75 80

Ser Val Lys Lys Met Arg Met Gln Phe Pro Ile Pro Arg Asp Glu Ile

85 90 95

Arg Met Thr Leu Leu Asp Met Leu Ala Lys Ser Gly Ile Lys Asp Ala

100 105 110

Tyr Val Glu Leu Ile Val Thr Arg Gly Leu Lys Pro Val Arg Glu Ala

115 120 125

Lys Pro Gly Glu Val Leu Asn Asn His Leu Tyr Leu Ile Val Gln Pro

130 135 140

Tyr Met Trp Val Met Ser Pro Glu Ala Gln Tyr Val Gly Gly Asn Ala

145 150 155 160

Val Ile Ala Arg Thr Val Arg Arg Ile Pro Pro Gly Ser Met Asp Pro

165 170 175

Thr Tyr Lys Asn Leu Gln Trp Ser Asp Pro Thr Arg Gly Met Phe Glu

180 185 190

Ala Tyr Asp Arg Gly Ala Gln Tyr Pro Phe Leu Thr Asp Gly Asp Thr

195 200 205

Asn Ile Thr Glu Gly Met Gly Phe Asn Val Val Phe Val Lys Asn Asn

210 215 220

Val Ile Tyr Thr Pro Asn Arg Gly His Leu Gln Gly Ile Thr Arg Lys

225 230 235 240

Ser Val Ile Asp Ala Ala Lys Trp Cys Gly His Glu Val Arg Val Glu

245 250 255

Tyr Val Pro Val Glu Met Ala Tyr Glu Ala Asp Glu Ile Phe Met Cys

260 265 270

Thr Thr Ala Gly Gly Ile Met Pro Ile Thr Thr Met Asp Gly Lys Pro

275 280 285

Val Lys Asp Gly Lys Val Gly Pro Val Thr Lys Ala Ile Trp Asp Arg

290 295 300

Tyr Trp Ala Met His Trp Glu Asp Glu Phe Ser Phe Lys Ile Asp Tyr

305 310 315 320

Gln Lys Leu Lys Leu His His His His His His

325 330

<210> 8

<211> 993

<212> DNA

<213> Artificial sequence (unkown)

<400> 8

atgtctacca tggacaaaat cttcgctggt cacgctcagc gtcaggctac cctggttgct 60

tctgacaaca tcttcgctaa cggtatcgct tggatccagg gtgaactggt tccgctgaac 120

gaagctcgta tcccgctgat ggaccagggt ttcatgcacg gtgacctgac ctacgacaat 180

ccagctgtgt gggacggcag gttcttccgt ctggacgacc acctggaccg tctggaagct 240

tctgttaaaa aaatgcgtat gcagttcccg atcccgcgtg acgaaatccg tatgaccctg 300

ctggacatgc tggctaaatc tggtatcaaa gacgcttacg ttgaactgat cgttacccgt 360

ggtctgaaac cggttcgtga agctaaaccg ggtgaagttc tgaacaacca cctgtacctg 420

atcgttcagc catacatgtg ggtaatgtct ccggaagctc agtacgttgg tggtaacgct 480

gttatcgctc gtaccgttcg tcgtatcccg ccgggttcta tggacccgac ctacaaaaac 540

ctgcagtggt ctgacccaac ccgtggtatg ttcgaagctt acgaccgtgg tgctcagtac 600

ccgttcctga ccgacggtga caccaacatc accgaaggta tgggtttcaa cgttgttttc 660

gttaaaaaca acgttatcta caccccgaac cgtggtcacc tgcagggtat cacccgtaaa 720

tctgttatcg acgctgctaa atggtgcggt cacgaagttc gtgttgaata cgttccggtt 780

gaaatggctt acgaagctga cgaaatcttc atgtgcacca ccgctggtgg tatcatgccg 840

atcaccacca tggacggtaa accggttaaa gacggtaaag ttggtccggt taccaaagct 900

atctgggacc gttactgggc tatgcactgg gaagacgaat tctctttcaa aatcgactac 960

cagaaactga aactgcacca ccaccaccac cac 993

<210> 9

<211> 329

<212> PRT

<213> Artificial sequence (unkown)

<400> 9

Met Thr Leu Thr Asn Asp Ala Gly Thr Ser Asn Leu Val Ala Val Glu

1 5 10 15

Pro Gly Ala Ile Arg Glu Asp Thr Pro Pro Gly Ser Val Ile Arg Tyr

20 25 30

Ser Asp Tyr Glu Leu Asp Glu Ser Ser Pro Phe Ala Gly Gly Val Ala

35 40 45

Trp Ile Glu Gly Glu Tyr Val Pro Ala Ser Glu Ala Arg Ile Ser Leu

50 55 60

Phe Asp Thr Gly Phe Gly His Ser Asp Leu Thr Tyr Thr Val Ala His

65 70 75 80

Val Trp His Gly Asn Val Phe Arg Leu His Asp His Met Asp Arg Leu

85 90 95

Tyr Asp Gly Ala Ala Lys Leu Arg Leu Asp Pro Gly Met Ser Lys Leu

100 105 110

Glu Met Ala Glu Ile Gly Lys Lys Cys Val Ser Leu Ser Gln Leu Arg

115 120 125

Glu Ser Phe Leu Asn Phe Thr Ile Thr Arg Gly Tyr Gly Lys Arg Arg

130 135 140

Gly Glu Lys Asp Leu Thr Gln Leu Thr His Gln Val Tyr Val Tyr Ala

145 150 155 160

Ile Pro Tyr Leu Trp Val Phe Pro Pro Leu Glu Gln Met Tyr Thr Tyr

165 170 175

Lys Asn Leu Gln Trp Ser Asp Pro Thr Arg Gly Met Phe Glu Ala Tyr

180 185 190

Asp Arg Gly Ala Gln Tyr Pro Phe Leu Thr Asp Gly Asp Thr Asn Ile

195 200 205

Thr Glu Gly Met Gly Phe Asn Val Val Phe Val Lys Asn Asn Val Ile

210 215 220

Tyr Thr Pro Asn Arg Gly His Leu Gln Gly Ile Thr Arg Lys Ser Val

225 230 235 240

Ile Asp Ala Ala Lys Trp Cys Gly His Glu Val Arg Val Glu Tyr Val

245 250 255

Pro Val Glu Met Ala Tyr Glu Ala Asp Glu Ile Phe Met Cys Thr Thr

260 265 270

Ala Gly Gly Ile Met Pro Ile Thr Thr Met Asp Gly Lys Pro Val Lys

275 280 285

Asp Gly Lys Val Gly Pro Val Thr Lys Ala Ile Trp Asp Arg Tyr Trp

290 295 300

Ala Met His Trp Glu Asp Glu Phe Ser Phe Lys Ile Asp Tyr Gln Lys

305 310 315 320

Leu Lys Leu His His His His His His

325

<210> 10

<211> 987

<212> DNA

<213> Artificial sequence (unkown)

<400> 10

atgaccctga ccaacgacgc tggtacctct aacctggttg ctgttgaacc gggtgctatc 60

cgtgaagaca ccccgccggg ttctgttatc cgttactctg actacgaact ggacgaatct 120

tctccgttcg ctggtggtgt tgcttggatc gaaggtgaat acgttccggc ttctgaagct 180

cgtatctctc tgttcgacac cggtttcggt cactctgacc tgacctacac cgttgctcac 240

gtttggcacg gtaacgtttt ccgtctgcac gaccacatgg accgtctgta cgacggtgct 300

gctaaactgc gtctggaccc gggtatgtct aaactggaaa tggctgaaat cggtaaaaaa 360

tgcgtttctc tgtctcagct gcgtgaatct ttcctgaact tcaccatcac ccgtggttac 420

ggtaaacgtc gtggtgaaaa agacctgacc cagctgaccc accaggttta cgtttacgct 480

atcccgtacc tgtgggtttt cccgccgctg gaacagatgt acacctacaa aaacctgcag 540

tggtctgacc caacccgtgg tatgttcgaa gcttacgacc gtggtgctca gtacccgttc 600

ctgaccgacg gtgacaccaa catcaccgaa ggtatgggtt tcaacgttgt tttcgttaaa 660

aacaacgtta tctacacccc gaaccgtggt cacctgcagg gtatcacccg taaatctgtt 720

atcgacgctg ctaaatggtg cggtcacgaa gttcgtgttg aatacgttcc ggttgaaatg 780

gcttacgaag ctgacgaaat cttcatgtgc accaccgctg gtggtatcat gccgatcacc 840

accatggacg gtaaaccggt taaagacggt aaagttggtc cggttaccaa agctatctgg 900

gaccgttact gggctatgca ctgggaagac gaattctctt tcaaaatcga ctaccagaaa 960

ctgaaactgc accaccacca ccaccac 987

<210> 11

<211> 347

<212> PRT

<213> Artificial sequence (unkown)

<400> 11

Met Ser Thr Met Asp Lys Ile Phe Ala Gly His Ala Gln Arg Gln Ala

1 5 10 15

Thr Leu Val Ala Ser Asp Asn Ile Phe Ala Asn Gly Ile Ala Trp Ile

20 25 30

Gln Gly Glu Leu Val Pro Leu Asn Glu Ala Arg Ile Pro Leu Met Asp

35 40 45

Gln Gly Phe Met His Gly Asp Leu Thr Tyr Asp Asn Pro Ala Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Leu Asp Asp His Leu Asp Arg Leu Glu Ala

65 70 75 80

Ser Val Lys Lys Met Arg Met Gln Phe Pro Ile Pro Arg Asp Glu Ile

85 90 95

Arg Met Thr Leu Leu Asp Met Leu Ala Lys Ser Gly Ile Lys Asp Ala

100 105 110

Tyr Val Glu Leu Ile Val Thr Arg Gly Leu Lys Pro Val Arg Glu Ala

115 120 125

Lys Pro Gly Glu Val Leu Asn Asn His Leu Tyr Leu Ile Val Gln Pro

130 135 140

Tyr Met Trp Val Met Ser Pro Glu Ala Gln Tyr Val Gly Gly Asn Ala

145 150 155 160

Val Ile Ala Arg Thr Val Arg Arg Ile Pro Pro Gly Ser Met Asp Pro

165 170 175

Gly Thr Ser Ala Ile Val Pro Arg His Val Arg Arg Ala Gly Arg Asn

180 185 190

Thr Ile Asp Pro Ser Ile Lys Asn Tyr Gln Trp Gly Asp Leu Thr Ala

195 200 205

Ala Ser Phe Glu Ala Lys Asp Arg Gly Ala Arg Thr Ala Val Leu Leu

210 215 220

Asp Ala Asp Asn Cys Val Ala Glu Gly Pro Gly Phe Asn Val Cys Ile

225 230 235 240

Val Lys Asp Gly Lys Ile Ala Ser Pro Ser Arg Asn Ala Leu Pro Gly

245 250 255

Ile Thr Arg Lys Thr Val Leu Glu Ile Ala Glu Gln Met Gly Ile Glu

260 265 270

Ala Thr Leu Arg Asp Val Thr Ser His Glu Leu Tyr Glu Ala Asp Glu

275 280 285

Leu Ile Ala Cys Thr Thr Ala Gly Gly Val Thr Pro Ile Thr Ser Leu

290 295 300

Asp Gly Glu Pro Ile Gly Asn Gly Glu Pro Gly Pro Ile Thr Val Ala

305 310 315 320

Ile Arg Asp Arg Phe Trp Ala Leu Met Asp Glu Pro Gly Pro Leu Ile

325 330 335

Glu Ala Ile Asp Tyr His His His His His His

340 345

<210> 12

<211> 1041

<212> DNA

<213> Artificial sequence (unkown)

<400> 12

atgtctacca tggacaaaat cttcgctggt cacgctcagc gtcaggctac cctggttgct 60

tctgacaaca tcttcgctaa cggtatcgct tggatccagg gtgaactggt tccgctgaac 120

gaagctcgta tcccgctgat ggaccagggt ttcatgcacg gtgacctgac ctacgacaat 180

ccagctgtgt gggacggcag gttcttccgt ctggacgacc acctggaccg tctggaagct 240

tctgttaaaa aaatgcgtat gcagttcccg atcccgcgtg acgaaatccg tatgaccctg 300

ctggacatgc tggctaaatc tggtatcaaa gacgcttacg ttgaactgat cgttacccgt 360

ggtctgaaac cggttcgtga agctaaaccg ggtgaagttc tgaacaacca cctgtacctg 420

atcgttcagc catacatgtg ggtaatgtct ccggaagctc agtacgttgg tggtaacgct 480

gttatcgctc gtaccgttcg tcgtatcccg ccgggttcta tggacccggg tacctctgct 540

atcgttccgc gtcacgttcg tcgtgctggt cgtaacacca tcgacccgtc tatcaaaaac 600

taccagtggg gtgacctgac cgctgcttct ttcgaagcta aagaccgtgg tgctcgtacc 660

gctgttctgc tggacgctga caactgcgtt gctgaaggtc cgggtttcaa cgtttgcatc 720

gttaaagacg gtaaaatcgc ttctccgtct cgtaacgctc tgccgggtat cacccgtaaa 780

accgttctgg aaatcgctga acagatgggt atcgaagcta ccctgcgtga cgttacctct 840

cacgaactgt acgaagctga cgaactgatc gcttgcacca ccgctggtgg tgttaccccg 900

atcacctctc tggacggtga accgatcggt aacggtgaac cgggtccgat caccgttgct 960

atccgtgaca ggttctgggc tctgatggac gaaccgggtc cgctgatcga agctatcgac 1020

taccaccacc accaccacca c 1041

<210> 13

<211> 334

<212> PRT

<213> Artificial sequence (unkown)

<400> 13

Met Asp Gln Thr Thr Ala Thr Gln Ala Ser Lys Pro Leu Pro Thr Val

1 5 10 15

Gly Asp Arg His Val Asp Pro His Ser Tyr Pro Asp Gly Ile Ala Phe

20 25 30

Leu Asp Gly Gln Tyr Leu Pro Met Ser Gln Ala Lys Val Ser Val Leu

35 40 45

Asp Trp Gly Phe Leu His Ser Asp Ala Thr Tyr Asp Thr Val His Val

50 55 60

Trp Asn Gly Arg Phe Phe Arg Leu Asp Leu His Leu Asp Arg Phe Phe

65 70 75 80

Gly Gly Leu Glu Lys Leu Arg Met Thr Ile Pro Phe Asp Arg Asp Gly

85 90 95

Val Ala Glu Ile Leu His Asn Cys Val Ala Leu Ser Gly His Arg Ala

100 105 110

Ala Tyr Val Glu Met Leu Cys Thr Arg Gly Ala Ser Pro Thr Phe Ser

115 120 125

Arg Asp Pro Arg Gln Ala Ile Asn Arg Phe Met Ala Phe Ala Val Pro

130 135 140

Phe Gly Ser Val Ala Asn Ala Glu Gln Leu Gln Arg Gly Leu Arg Val

145 150 155 160

Ala Ile Ser Asp Lys Val Arg Ile Pro Pro Ala Ser Val Asp Pro Ser

165 170 175

Ile Lys Asn Thr Tyr Lys Asn Leu Gln Trp Ser Asp Pro Thr Arg Gly

180 185 190

Met Phe Glu Ala Tyr Asp Arg Gly Ala Gln Tyr Pro Phe Leu Thr Asp

195 200 205

Gly Asp Thr Asn Ile Thr Glu Gly Met Gly Phe Asn Val Val Phe Val

210 215 220

Lys Asn Asn Val Ile Tyr Thr Pro Asn Arg Gly His Leu Gln Gly Ile

225 230 235 240

Thr Arg Lys Ser Val Ile Asp Ala Ala Lys Trp Cys Gly His Glu Val

245 250 255

Arg Val Glu Tyr Val Pro Val Glu Met Ala Tyr Glu Ala Asp Glu Ile

260 265 270

Phe Met Cys Thr Thr Ala Gly Gly Ile Met Pro Ile Thr Thr Met Asp

275 280 285

Gly Lys Pro Val Lys Asp Gly Lys Val Gly Pro Val Thr Lys Ala Ile

290 295 300

Trp Asp Arg Tyr Trp Ala Met His Trp Glu Asp Glu Phe Ser Phe Lys

305 310 315 320

Ile Asp Tyr Gln Lys Leu Lys Leu His His His His His His

325 330

<210> 14

<211> 1002

<212> DNA

<213> Artificial sequence (unkown)

<400> 14

atggatcaaa ctaccgctac acaggcctct aaacctttac ccacggttgg tgaccgtcat 60

gtcgatccac actcctatcc ggacggcatt gcatttttgg atggacaata ccttcctatg 120

tcacaggcga aggtatcggt gctcgactgg gggttcctac atagtgatgc tacttatgac 180

accgttcacg tctggaatgg tcgctttttc cgactggatt tacatttgga ccggtttttc 240

ggcggacttg aaaaactcag aatgacaatc ccctttgata gggacggggt agccgagata 300

ctacacaact gtgtggcact gagcggtcat cgtgcggctt acgttgaaat gttatgcacg 360

cgcggcgcct ctccaacttt ctcccgagat ccgcggcaag caattaatag atttatggcg 420

ttcgctgtcc cttttggatc agtagccaac gcagagcagt tgcaaagggg gcttcgtgtg 480

gcgatctcgg acaaggttcg cataccccca gctagtgtcg atccgagcat taaaaatacc 540

tacaaaaacc tgcagtggtc tgacccaacc cgtggtatgt tcgaagctta cgaccgtggt 600

gctcagtacc cgttcctgac cgacggtgac accaacatca ccgaaggtat gggtttcaac 660

gttgttttcg ttaaaaacaa cgttatctac accccgaacc gtggtcacct gcagggtatc 720

acccgtaaat ctgttatcga cgctgctaaa tggtgcggtc acgaagttcg tgttgaatac 780

gttccggttg aaatggctta cgaagctgac gaaatcttca tgtgcaccac cgctggtggt 840

atcatgccga tcaccaccat ggacggtaaa ccggttaaag acggtaaagt tggtccggtt 900

accaaagcta tctgggaccg ttactgggct atgcactggg aagacgaatt ctctttcaaa 960

atcgactacc agaaactgaa actgcaccac caccaccacc ac 1002

<210> 15

<211> 323

<212> PRT

<213> Artificial sequence (unkown)

<400> 15

Met Ser Thr Met Asp Lys Ile Phe Ala Gly His Ala Gln Arg Gln Ala

1 5 10 15

Thr Leu Val Ala Ser Asp Asn Ile Phe Ala Asn Gly Ile Ala Trp Ile

20 25 30

Gln Gly Glu Leu Val Pro Leu Asn Glu Ala Arg Ile Pro Leu Met Asp

35 40 45

Gln Gly Phe Met His Gly Asp Leu Thr Tyr Asp Asn Pro Ala Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg His Asp Asp His Leu Asp Tyr Leu Glu Ala

65 70 75 80

Ser Val Lys Lys Met Arg Met Gln Phe Pro Ile Pro Arg Asp Glu Ile

85 90 95

Arg Met Thr Leu Leu Asp Met Leu Ala Lys Ser Gly Ile Lys Asp Ala

100 105 110

Tyr Val Glu Leu Ile Val Thr Arg Gly Leu Lys Pro Val Arg Glu Ala

115 120 125

Lys Pro Gly Glu Val Leu Val Asn His Leu Tyr Leu Ile Val Gln Pro

130 135 140

Tyr Met Trp Val Met Ser Pro Glu Ala Gln Tyr Val Ala Gly Asn Ala

145 150 155 160

Val Ile Ala Arg Thr Val Arg Arg Ile Pro Pro Gly Ser Met Asp Pro

165 170 175

Tyr His Trp Leu Asp Leu Val Arg Gly Leu Tyr Asp Ala Tyr Asp Ser

180 185 190

Gly Ala Glu Thr Ala Leu Ile Leu Asp Phe Asn Gly Asn Val Ala Glu

195 200 205

Gly Pro Gly Phe Asn Val Phe Cys Val Lys Asp Gly Lys Leu Ser Thr

210 215 220

Pro Ala Ile Gly Val Leu Pro Gly Ile Thr Arg Arg Thr Val Phe Asp

225 230 235 240

Leu Cys Ala Glu Glu Gly Leu Ala Ala Ala Ala Ala Asp Val Ser Val

245 250 255

Ala Ala Leu Lys Ala Ala Asp Glu Val Phe Ile Thr Ser Thr Ala Gly

260 265 270

Gly Ile Met Pro Val Thr Glu Ile Asp Gly Ala Ala Ile Ala Asp Gly

275 280 285

Lys Val Gly Gly Val Thr Ser Arg Leu Met Ala Leu Tyr Trp Gln Lys

290 295 300

His Asp Asp Pro Ala Trp Ser Ser Gln Val Lys Tyr Pro His His His

305 310 315 320

His His His

<210> 16

<211> 969

<212> DNA

<213> Artificial sequence (unkown)

<400> 16

atgtctacca tggacaaaat cttcgctggt cacgctcagc gtcaggctac cctggttgct 60

tctgacaaca tcttcgctaa cggtatcgct tggatccagg gtgaactggt tccgctgaac 120

gaagctcgta tcccgctgat ggaccagggt ttcatgcacg gtgacctgac ctacgacaat 180

ccagctgtgt gggacggcag gttcttccgt catgacgacc acctgtaccg tctggaagct 240

tctgttaaaa aaatgcgtat gcagttcccg atcccgcgtg acgaaatccg tatgaccctg 300

ctggacatgc tggctaaatc tggtatcaaa gacgcttacg ttgaactgat cgttacccgt 360

ggtctgaaac cggttcgtga agctaaaccg ggtgaagttc tggtgaacca cctgtacctg 420

atcgttcagc catacatgtg ggtaatgtct ccggaagctc agtacgttgc gggtaacgct 480

gttatcgctc gtaccgttcg tcgtatcccg ccgggttcta tggacccgta tcactggctc 540

gacctagtac gaggtctgta cgatgcctat gactctggcg cagaaaccgc gttaatcttg 600

gatttcaacg gaaatgtggc tgaggggcct ggttttaacg ttttctgtgt caaggacggc 660

aaactttcca cacccgccat aggagtactc ccagggatta cgcggagaac tgtgtttgat 720

ctatgcgcag aagagggtct ggcggctgcc gcagcggacg tttcagtcgc tgccttaaag 780

gcagcggatg aagtattcat cacctcgaca gctggcggaa taatgccggt gacggagatt 840

gacggggccg caatcgcgga tggtaaagtt ggcggcgtca ctagtaggtt gatggctctt 900

tactggcaga agcatgacga tcccgcctgg agctctcaag taaaatatcc acaccatcac 960

catcaccat 969

<210> 17

<211> 323

<212> PRT

<213> Artificial sequence (unkown)

<400> 17

Met Ser Thr Met Asp Lys Ile Phe Ala Gly His Ala Gln Arg Gln Ala

1 5 10 15

Thr Leu Val Ala Ser Asp Asn Ile Phe Ala Asn Gly Ile Ala Trp Ile

20 25 30

Gln Gly Glu Leu Val Pro Leu Asn Glu Ala Arg Ile Pro Leu Met Asp

35 40 45

Gln Gly Phe Met His Gly Asp Leu Thr Tyr Asp Asn Pro Ala Val Trp

50 55 60

Asp Gly Arg Phe Phe Arg Thr Asp Asp His Leu Asp Tyr Leu Glu Ala

65 70 75 80

Ser Val Lys Lys Met Arg Met Gln Phe Pro Ile Pro Arg Asp Glu Ile

85 90 95

Arg Met Thr Leu Leu Asp Met Leu Ala Lys Ser Gly Ile Lys Asp Ala

100 105 110

Tyr Val Glu Leu Ile Val Thr Arg Gly Leu Lys Pro Val Arg Glu Ala

115 120 125

Lys Pro Gly Glu Val Leu Leu Asn His Leu Tyr Leu Ile Val Gln Pro

130 135 140

Tyr Met Trp Val Met Ser Pro Glu Ala Gln Tyr Val Ala Gly Asn Ala

145 150 155 160

Val Ile Ala Arg Thr Val Arg Arg Ile Pro Pro Gly Ser Met Asp Pro

165 170 175

Tyr His Trp Leu Asp Leu Val Arg Gly Leu Tyr Asp Ala Tyr Asp Ser

180 185 190

Gly Ala Glu Thr Ala Leu Ile Leu Asp Phe Asn Gly Asn Val Ala Glu

195 200 205

Gly Pro Gly Phe Asn Val Phe Cys Val Lys Asp Gly Lys Leu Ser Thr

210 215 220

Pro Ala Ile Gly Val Leu Pro Gly Ile Thr Arg Arg Thr Val Phe Asp

225 230 235 240

Leu Cys Ala Glu Glu Gly Leu Ala Ala Ala Ala Ala Asp Val Ser Val

245 250 255

Ala Ala Leu Lys Ala Ala Asp Glu Val Phe Ile Thr Ser Thr Ala Gly

260 265 270

Gly Ile Met Pro Val Thr Glu Ile Asp Gly Ala Ala Ile Ala Asp Gly

275 280 285

Lys Val Gly Arg Val Thr Ser Arg Leu Met Ala Leu Tyr Trp Gln Lys

290 295 300

His Asp Asp Pro Ala Trp Ser Ser Gln Val Lys Tyr Pro His His His

305 310 315 320

His His His

<210> 18

<211> 969

<212> DNA

<213> Artificial sequence (unkown)

<400> 18

atgtctacta tggataaaat ttttgctggt catgcccaac gtcaggcaac cttagttgcg 60

tccgacaata tcttcgctaa cggcatagcc tggattcaag gagaattggt ccctcttaat 120

gaggcacgca tccccctcat ggatcagggg tttatgcacg gtgacctaac atatgataac 180

ccagcggtat gggacggccg attctttcgg acggatgacc atctggatta cttagaagct 240

tcagtgaaga aaatgagaat gcaattcccg atacctaggg acgagattcg tatgactttg 300

cttgatatgc tcgccaagtc gggaatcaaa gacgcatatg ttgaactaat agtcacccgc 360

gggctgaagc ccgtacgaga ggcgaaacca ggtgaagtgt tattgaatca cctttacctc 420

attgttcagc cgtatatgtg ggtcatgagt cctgaggctc aatacgtagc cggcaacgca 480

gtgatcgcgc ggacagttag aaggataccc ccaggaagca tggatccgta tcattggcta 540

gacctggtcc gtgggttata cgatgcttat gactctggtg ccgaaacggc attgattctt 600

gattttaatg gcaacgtagc ggagggacct gggttcaatg tgttttgtgt taaggacggt 660

aaactctcca ctcccgctat cggcgtccta ccaggaataa cccgccgaac agtattcgat 720

ctgtgcgccg aagaggggtt agcagcggct gccgcagacg tgtcagttgc ggctttgaag 780

gccgcagatg aagtctttat tacgtcgact gcgggtggca tcatgccggt aaccgagata 840

gacggagctg ccattgcaga tgggaaagtg ggtcgggtta caagtagact tatggcgctc 900

tactggcaga agcacgacga tcctgcttgg agctctcaag tcaaatatcc ccatcaccat 960

caccatcac 969

Claims

1. RecombinationR- ω -transaminase, whose amino acid sequence is shown in SEQ ID number 15.

2. A kind ofR-a ω -transaminase mutant, obtained by mutating an amino acid having the sequence shown in SEQ ID number 15, said mutation being one of the following: (1) histidine at bit 71 is mutated to threonine; (2) the 71 th histidine is mutated into threonine, and the 135 th valine is mutated into glycine, leucine, alanine, isoleucine or proline; (3) histidine 71 is mutated to threonine, valine 135 to leucine, and glycine 292 to alanine, arginine, leucine, cysteine, or histidine.

3. The method of claim 2R- ω -transaminase mutants characterized in that they areRThe-omega-transaminase mutant is obtained by mutating amino acid with the sequence shown as SEQ ID number 15 by one of the following steps: (1) histidine at bit 71 is mutated to threonine; (2) histidine 71 is mutated to threonine and valine 135 is mutated to leucine; (3) histidine 71 was mutated to threonine, valine 135 to leucine, and glycine 292 to arginine.

4. The method of claim 3R- ω -transaminase mutants characterized in that they areRThe sequence of the-omega-transaminase mutant is shown as SEQ ID number 17.

5. The method of claim 1R- ω -transaminase or one of claims 2 to 4RApplication of the-omega-transaminase mutant in catalyzing asymmetric synthesis of sitagliptin from sitagliptin precursor ketone.

6. The use according to claim 5, characterized in that the use is: to contain saidRWet thalli obtained by fermentation culture of recombinant genetic engineering bacteria of the-omega-transaminase or mutant encoding genes or supernatant obtained by ultrasonic crushing of the wet thalli are used as a catalyst, sitagliptin precursor ketone is used as a substrate, pyridoxal phosphate is used as a coenzyme, isopropylamine is used as an amino donor, the reaction is carried out in triethanolamine-HCl buffer solution with the pH value of 8.0-9.0 at the temperature of 20-60 ℃ at the speed of 300-500 r/min, and after the reaction is finished, reaction liquid is separated and purified to obtain sitagliptin.

7. Use according to claim 6, characterized in that saidRThe sequence of the encoding gene of the-omega-transaminase or the mutant is shown as SEQ ID number 16 or SEQ ID number 18.