CN110904014A

CN110904014A - Pseudomonas marginalis and application thereof in preparation of 2, 5-furandicarboxylic acid

Info

Publication number: CN110904014A
Application number: CN201911338634.7A
Authority: CN
Inventors: 郑兆娟; 谭黄虹; 周凤; 欧阳嘉; 邹丽花; 徐茜茜
Original assignee: Nanjing Forestry University
Current assignee: Nanjing Forestry University
Priority date: 2019-12-23
Filing date: 2019-12-23
Publication date: 2020-03-24
Anticipated expiration: 2039-12-23
Also published as: CN110904014B

Abstract

The invention discloses Pseudomonas marginalis and application thereof in preparation of 2, 5-furandicarboxylic acid, wherein the Pseudomonas marginalis is classified and named as Pseudomonas marginalis (Pseudomonas marginalis), has a strain name of 19Z, is preserved in China Center for Type Culture Collection (CCTCC) with a preservation number of M2019984, and has a preservation date of 2019, 11 and 28 months. The invention has the advantages that: (1) the research adopts multi-cell sequence catalysis for the first time, and FDCA is synthesized by two steps in one pot. (2) The synthesis method can obviously improve the yield, the yield and the productivity of the FDCA, and can realize the high-efficiency conversion from HMF to the FDCA only by simple cell culture and sequence catalysis; and expensive cofactors are not needed, the process is simple and controllable, and the method has good practicability and is easy to industrialize.

Description

Pseudomonas marginalis and application thereof in preparation of 2, 5-furandicarboxylic acid

Technical Field

The invention relates to the field of biocatalytic conversion, and particularly relates to pseudomonas marginalis and application thereof in preparation of 2, 5-furandicarboxylic acid.

Background

With the increasing scarcity of fossil resources and the increasing global warming, the development and utilization of bio-based energy and platform compounds are gaining attention on a global scale. Biomass is a renewable carbon source with abundant sources and low price, and the realization of high-value utilization of the biomass is an important direction for the development of the biomass in the future. 5-hydroxymethyl furfural (HMF) is an important bio-based platform compound and can be prepared from biomass such as starch, cellulose and the like through hydrolysis, dehydration and other reactions. The downstream products of HMF bio-oxidation are numerous, with 2, 5-furandicarboxylic acid (FDCA) being of particular interest to researchers because of its potential to replace the petroleum-based bulk chemical, terephthalic acid.

FDCA is a bio-based aromatic monomer that can be used to synthesize high performance polyesters, polyamides, and epoxies, and is identified by the united states department of energy as one of the 12 most potential bio-based platform compounds, also known as "sleeping giant". Currently, FDCA is produced primarily by chemical catalysis of 5-HMF, e.g., Pasini et al, in Au-Cu/TiO using molecular oxygen as the oxidant₂Under the co-catalysis of the two, the HMF realizes efficient selective oxidation, and 99% of FDCA is generated (Green Chemistry,2011,13: 2091). Although the chemical method for synthesizing FDCA achieves certain progress, the chemical method usually takes heavy metal as a catalyst, is expensive, has rigorous reaction conditions and is not environment-friendly, and breaks the development strategy of green chemical engineering. In addition, part of chemical catalysts have poor selectivity, and are easy to cause excessive oxidation of active hydroxyl or aldehyde groups, so that a large amount of byproducts are generated, and the subsequent separation and purification of target products are influenced.

The reaction condition for synthesizing FDCA by biological catalysis is mild, the selectivity is high, the process is simple, and the method is green and environment-friendly. But the field is still in the beginning. Dijkman et al reported that an HMF oxidase derived from Methylovorus sp. MP688 was able to catalyze the oxidation of HMF, and that HMF (5mM) was completely converted at room temperature for 24h with an FDCA yield of 95%. Carro et al, coupled with an aryl alcohol oxidase and a non-specific heme oxidase, convert HMF (3mM) to FDCA in two steps, but the coupling reaction is inefficient and takes a long time (120h) to achieve high FDCA yields (91%). At present, the method for synthesizing FDCA by using microbial cells as a catalyst and catalyzing by a multicellular sequence has not been reported.

Disclosure of Invention

The purpose of the invention is as follows: the technical problem to be solved by the invention is to provide a Pseudomonas marginalis strain and a method for catalytic synthesis of 2, 5-furandicarboxylic acid (FDCA) by utilizing a Pseudomonas marginalis multicellular sequence, so as to simplify the production process and improve the yield, the yield and the productivity of the FDCA.

The invention idea is as follows: fig. 1 shows a pathway for 5-hydroxymethylfurfural to synthesize 2, 5-furandicarboxylic acid, in which HMF, if converted to HMFCA, is ultimately not converted to FDCA. As there is currently no good biocatalyst that can rapidly convert HMFCA to FFCA as well as FDCA. However, the strains screened in the invention can specifically oxidize aldehyde groups (including HMF to HMFCA, DFF to FFCA, FFCA to FDCA) and can not oxidize hydroxymethyl groups (including HMF to DFF, HMFCA to FFCA). In the present application, in the first step, tungstate is added to a culture medium to make the medium lose the oxidizing ability from HMF to HMFCA, and at the same time, the medium is genetically modified to make the medium have the ability from HMF to DFF; second, the wild-type bacteria achieve DFF to FDCA.

In order to solve the technical problems, the invention discloses a Pseudomonas marginalis, which is classified and named as Pseudomonas marginalis (Pseudomonas marginalis), has a strain name of 19Z, is preserved in China center for type culture Collection with a preservation date of 2019, 11 and 28 months, has a preservation number of CCTCC NO: M2019984, and has a preservation address of: wuhan university in Wuhan, China.

The application of the pseudomonas marginalis and the recombinant pseudomonas marginalis prepared by taking the pseudomonas marginalis as a starting bacterium in the preparation of the 2, 5-furandicarboxylic acid is also within the protection scope of the invention.

Wherein, the application comprises the following steps:

(1) carrying out genetic modification on pseudomonas marginalis CCTCC NO: M2019984 to obtain recombinant pseudomonas marginalis, inoculating a seed solution prepared from the recombinant pseudomonas marginalis into a culture medium for culture to obtain a first fermentation solution, separating, and collecting a first thallus cell;

(2) catalyzing 5-hydroxymethylfurfural conversion by using the first thallus cell obtained in the step (1) to obtain a conversion solution of an oxidation intermediate product;

(3) inoculating seed liquid prepared from pseudomonas marginalis CCTCC NO: M2019984 into a culture medium for culture to obtain second fermentation liquid, separating, and collecting second thallus cells;

(4) mixing the second bacterial cells obtained in the step (3) with the transformation liquid obtained in the step (2), and adding CaCO₃Carrying out catalytic reaction to obtain the 2, 5-furandicarboxylic acid.

In the step (1), the genetic modification is to overexpress a gene which oxidizes the hydroxymethyl group of 5-hydroxymethylfurfural to an aldehyde group intracellularly, which oxidizes the hydroxymethyl group of 5-hydroxymethylfurfural to an aldehyde group.

Wherein, the gene is preferably galactose oxidase mutant, and the nucleotide sequence of the gene is shown as SEQ ID NO. 1.

Wherein the galactose oxidase mutant gene sequence is synthesized by conventional molecular biology method

Cloning of the Uni SEAmless Cloning and Assembly Kit (from all-trans gold) into the pBBR1MCS-1 plasmid (from Addge). The specific operation is as follows:

(i) two pairs of primers were designed for amplification of the target gene and plasmid, respectively.

(ii) The primers for amplifying the target gene are as follows:

an upstream primer: TTTTAACAAAATATTAACGCTTACTGGGTCACACGAATGGT

A downstream primer: TTTCACACAGGAAACAGCTATGGCAAGTGCCCCGATTGGT

(iii) The primers for amplifying the plasmid were:

an upstream primer: CATAGCTGTTTCCTGTGTGAAAT

A downstream primer: GCGTTAATATTTTGTTAAAATTC

(iv) purifying the PCR product with a purification kit,then follow according to

The Uni Seamless cloning Assembly Kit Manual of operation ligates the fragment of interest and the plasmid.

(v) The resulting recombinant plasmid was electrically transformed into pseudomonas marginalis competent cells. Pseudomonas marginalis was cultured in LB medium to mid-log phase, the cells were harvested by centrifugation (4 ℃, 6000rpm, 10min) and washed twice with running buffer (10% glycerol, 1mM HEPES, 0.3M sucrose, pH 7.0), and the resulting cells were competent cells. mu.L of plasmid at a concentration of 100 ng/. mu.L was mixed with 100. mu.L of competent cells, and the mixture was added to an electric cuvette (inner diameter: 2mm), and then electric shock was applied thereto under 2400V, 25. mu.F, 200. omega. conditions, and immediately thereafter 500. mu.L of LB medium was added. Transferring the bacterial liquid in the electric rotating cup to a centrifuge tube, and culturing on a shaking table at 30 ℃ for 1h for cell recovery. And (4) screening the recovered cells on an LB solid plate containing the kanamycin resistance to obtain the recombinant human immunodeficiency virus (CANA).

In the step (1), the seed solution is prepared by inoculating recombinant pseudomonas marginalis in an LB culture medium (NaCl: 10 g/L; tryptone: 10 g/L; yeast extract powder: 5 g/L; and water as a solvent) and activating at 25-40 ℃ and 100-200 r/min for 8-14 h.

In the step (1), the culture medium comprises 0.1-10 mM LB culture medium of tungstate.

In the step (1), inoculating the seed solution into an LB culture medium according to the inoculation amount of 0.5-10 v/v%; the culture is carried out for 8-14 h after the culture is carried out for a logarithmic period under the conditions of 25-40 ℃ and 100-200 r/min;

wherein, when the culture reaches the middle logarithmic phase, isopropyl thiogalactoside with the final concentration of 1mM is added.

In the step (2), the 5-hydroxymethylfurfural is a buffer solution containing 5-hydroxymethylfurfural; the pH value of the buffer solution is 5.0-9.0, and the buffer solution is any one of phosphate buffer solution, Tris-HCl buffer solution, citrate buffer solution and acetate buffer solution; the content of 5-hydroxymethylfurfural in the buffer solution is 10-300 mM; the mass-volume ratio of the first thallus cells to the buffer solution is 3-50 g of stem cellsL; simultaneously, Cu is added to the mixture of the first bacterial cells and the buffer solution²⁺Horseradish peroxidase and catalase to Cu²⁺The concentration of the enzyme is 0.5-1 mM, the concentration of horseradish peroxidase is 5-15U/mL, and the concentration of catalase is 50-100U/mL; the reaction conditions are 15-50 ℃, 50-300 r/min and 10-12 h.

Horseradish peroxide was purchased from Sigma and enzyme activity was measured according to the instructions. Specific enzyme activity determination conditions are as follows: the reaction system was 3mL, potassium phosphate buffer (14mM, pH 6.0), H₂O₂(0.027% (v/v)), pyrogallol (0.5% (w/v)), horseradish peroxidase in proper amounts, and the change in absorbance at 420nm was monitored. Definition of enzyme activity: the amount of enzyme required to oxidize 1. mu. mol of pyrogallol per 20s at 25 ℃ at pH 6.0 is defined as 1U.

Catalase was purchased from Sigma and enzyme activity was measured according to the instructions. Specific enzyme activity determination conditions are as follows: the reaction system was 3mL, sodium phosphate buffer (50mM, pH 7.0), H₂O₂(0.036% (w/w)), catalase was added in an appropriate amount, and the change in absorbance was monitored at 240 nm. Definition of enzyme activity: decompose 1. mu. mol H per minute at 25 ℃ at pH 7.0₂O₂The amount of enzyme required was defined as 1U.

In the step (3), the seed solution is prepared by inoculating Pseudomonas marginalis CCTCC NO: M2019984 in LB culture medium (NaCl: 10 g/L; tryptone: 10 g/L; yeast extract powder: 5g/L) and activating at 25-40 ℃ and 100-200 r/min for 8-14 h.

In the step (3), inoculating the seed solution into an LB culture medium according to the inoculation amount of 0.5-10 v/v%; the culture is carried out for 6-12 h after the culture is carried out for a period of 6-12 h at 25-40 ℃ and 100-200 r/min.

Wherein, when the culture reaches the middle logarithmic phase, an inducer is added; wherein the inducer is any one of 5-hydroxymethylfurfural, furfural, 2, 5-furandicarboxylic acid and furfuryl alcohol; adding an inducer to the solution to a concentration of 0.5 to 6 mM.

In the step (4), the mass-to-volume ratio of the second bacterial cells to the product obtained in the step (2) is 3-50 g of stem cells/L of conversion solution; the addition amount of calcium carbonate is 2-8 g/L of the conversion solution; the catalytic reaction conditions are 15-50 ℃, 50-300 r/min reaction time is 10 min-12 h, the pH of the reaction system is monitored and controlled in real time to be not less than 4.5, and the conversion solution containing FDCA is obtained.

The first bacterial cells may or may not be removed before the reaction in step (4).

After the reaction in the step (4) is finished, removing the second bacterial cells added in the step (4) from the obtained conversion solution containing the FDCA in a centrifugal mode, diluting the obtained clear solution by a proper multiple, and performing HPLC detection; however, if the first bacterial cells are not removed before the reaction in step (4), they need to be removed in this step.

Has the advantages that: compared with the prior art, the invention has the advantages that:

(1) the pure chemical method for producing FDCA is usually carried out under the conditions of high temperature and high pressure, a noble metal catalyst and a toxic solvent are required to be used, although biocatalysis is environment-friendly, the research is still in the initial stage, and the production method is still incomplete. At present, a few research reports of the FDCA produced by multi-enzyme coupling exist, and the research firstly adopts multi-cell sequence catalysis and synthesizes the FDCA in two steps by one pot.

(2) The synthesis method can obviously improve the yield, the yield and the productivity of the FDCA, and can realize the high-efficiency conversion from HMF to the FDCA only by simple cell culture and sequence catalysis.

(3) The method has the advantages of higher concentration of the substrate capable of catalytic conversion, higher yield of FDCA, high reaction rate, no need of expensive cofactors, simple and controllable process, good practicability and easy industrialization.

Drawings

Fig. 1 shows the route of synthesis of FDCA by HMF.

FIG. 2 is a schematic diagram of the process of catalytic synthesis of FDCA by a multicellular sequence.

FIG. 3 is a graph showing the change of each material composition during the synthesis of FDCA from HMF 50mM catalyzed by multicellular sequences.

Detailed Description

The invention will be better understood from the following examples. However, those skilled in the art will readily appreciate that the description of the embodiments is only for illustrating the present invention and should not be taken as limiting the invention as detailed in the claims.

In the invention, the Chinese meaning of each English abbreviation is as follows:

HMF: 5-hydroxymethylfurfural

BHMF: 2, 5-dihydroxymethylfuran

DFF: 2, 5-Furan-Dicldehyde

FFCA: 5-Formylfuroic acid

FDCA: 2, 5-furandicarboxylic acid.

Example 1: selection and preservation of Pseudomonas marginalis

A soil sample was collected from the hind mountain of Nanjing forestry university, and 1g of the mixed soil sample was mixed with 9mL of sterile physiological saline, and 500. mu.L of the mixture was inoculated into 50mL of LB medium containing 10mM DFF, and cultured at 30 ℃ at 200r/min for 24 hours. 500 microliters of the culture medium was inoculated into 50mL of LB medium containing 20mM DFF, and cultured at 30 ℃ at 200r/min for 24 hours. The culture solution is added with 10 percent^-2、10^-3、10^-4Three dilutions were plated on solid LB medium containing 20mM DFF and incubated at 30 ℃ until microbial colonies appeared. A single colony was picked, inoculated into 50mL of fresh LB medium, and after 2 hours, 3mM MF was added, and the culture was continued for 12 hours. The cells were collected by centrifugation and resuspended in 100mM phosphate buffer at pH 6.0, mixed with 50mM DFF, catalyzed at 30 ℃ for 3 hours at 200r/min, and the product yield was preliminarily judged by pH of the reaction mixture, and a positive primary-screened strain was determined. And then measuring the content of the FDCA produced by catalysis of the primarily screened strain by using HPLC, and selecting the strain with the highest FDCA production for storage and later use. This strain can convert all 50mM DFF to FDCA.

The strain identification result shows that the strain of the invention is Pseudomonas marginalis (Pseudomonas marginalis)19Z, the strain is preserved in China center for type culture Collection (CCTCC for short, Wuchang Lodojia mountain in Wuhan City, Hubei province) in 11-28 days in 2019, and the preservation number is as follows: CCTCC NO: M2019984. The strain is the biocatalyst B of the invention.

Example 2: genetic modification of Pseudomonas marginalis

The chemically synthesized galactose oxidase mutant gene sequence has the gene nucleotide sequence shown in SEQ ID No. 1. And according to conventional molecular biological methods, using

(1) two pairs of primers were designed for amplification of the target gene and plasmid, respectively.

(2) The primers for amplifying the target gene are as follows:

an upstream primer: TTTTAACAAAATATTAACGCTTACTGGGTCACACGAATGGT

A downstream primer: TTTCACACAGGAAACAGCTATGGCAAGTGCCCCGATTGGT

(3) The primers for amplifying the plasmid were:

an upstream primer: CATAGCTGTTTCCTGTGTGAAAT

A downstream primer: GCGTTAATATTTTGTTAAAATTC

(4) The PCR product was purified with a purification kit, followed by

(5) The resulting recombinant plasmid was electrically transformed into pseudomonas marginalis competent cells. Pseudomonas marginalis was cultured in LB medium to mid-log phase, the cells were harvested by centrifugation (4 ℃, 6000rpm, 10min) and washed twice with running buffer (10% glycerol, 1mM HEPES, 0.3M sucrose, pH 7.0), and the resulting cells were competent cells. mu.L of plasmid at a concentration of 100 ng/. mu.L was mixed with 100. mu.L of competent cells, and the mixture was added to an electric cuvette (inner diameter: 2mm), and then electric shock was applied thereto under 2400V, 25. mu.F, 200. omega. conditions, and immediately thereafter 500. mu.L of LB medium was added. Transferring the bacterial liquid in the electric rotating cup to a centrifuge tube, and culturing on a shaking table at 30 ℃ for 1h for cell recovery. After recovery, the cells are screened on an LB solid plate containing resistance to Carna, and the obtained strain is the biocatalyst A.

Example 3: oxidation of HMF Using biocatalyst A

(1) Taking a ring of thalli from an agar slant culture medium for storing the biocatalyst A, inoculating the thalli to an LB liquid culture medium, and culturing for 12h under the conditions of 30 ℃ and 200r/min to activate strains;

(2) inoculating the activated seed solution into LB culture medium containing 1mM sodium tungstate according to the volume percentage of 2%, culturing at 30 ℃ and 200r/min to the middle logarithmic phase, adding IPTG with the final concentration of 1mM, and continuously culturing for 12h to proliferate cells;

(3) centrifugally collecting thallus cells, washing thallus for 3 times by using normal saline, and separating to obtain complete microbial cells;

(4) mixing the biocatalyst A collected in step (3) with a phosphate buffer solution (100mM, pH 6.0) containing HMF such that the concentration of HMF in the mixture is 50mM and the concentration of biocatalyst is 10g dry cells/L, and simultaneously, adding Cu to the mixture²⁺Horseradish peroxidase and catalase to Cu²⁺Reacting at the concentration of 1mM, the concentration of horseradish peroxidase of 10U/mL and the concentration of catalase of 80U/mL for 80min at 30 ℃ and 200r/min to obtain a conversion solution;

(5) and (4) centrifuging the conversion solution in the step (4) at 6000r/min for 30min, removing the biocatalyst added in the step (4), diluting the obtained clear solution by 20 times, and then carrying out HPLC detection.

(6) Detection of products in conversion solution

HPLC detection shows that no HMF remains in the conversion solution, and the product comprises DFF and FFCA in a ratio of 9: 1.

Example 4: oxidation of HMF Using biocatalyst A

(1) Taking a ring of thalli from an agar slant culture medium for storing the biocatalyst A, inoculating the thalli to an LB liquid culture medium, and culturing for 14h at the temperature of 25 ℃ and at the speed of 200r/min to activate strains;

(2) inoculating the activated seed solution into LB culture medium containing 0.1mM sodium tungstate according to the volume percentage of 10%, culturing to the middle logarithmic phase under the conditions of 25 ℃ and 200r/min, adding IPTG with the final concentration of 1mM, and continuously culturing for 14h to proliferate cells;

(4) mixing the biocatalyst A collected in step (3) with a phosphate buffer solution (100mM, pH 7.0) containing HMF such that the concentration of HMF in the mixture is 10mM and the concentration of biocatalyst is 3g dry cells/L, and simultaneously, adding Cu to the mixture²⁺Horseradish peroxidase and catalase to Cu²⁺Reacting at 25 deg.C and 200r/min for 20min to obtain conversion solution, wherein the concentration is 1mM, the concentration of horseradish peroxidase is 15U/mL, and the concentration of catalase is 100U/mL;

(5) and (4) centrifuging the conversion solution in the step (4) at 6000r/min for 30min, removing the biocatalyst added in the step (4), and diluting the obtained clear solution by 2 times for HPLC detection.

(6) Detection of products in conversion solution

HPLC detection shows that no HMF remains in the conversion solution, and the product comprises DFF and FFCA in a ratio of 8: 1.

Example 5: oxidation of HMF Using biocatalyst A

(1) Taking a ring of thalli from an agar slant culture medium for storing the biocatalyst A, inoculating the thalli to an LB liquid culture medium, and culturing for 10 hours at 40 ℃ and 100r/min to activate strains;

(2) inoculating the activated seed solution into LB culture medium containing 10mM sodium tungstate according to the volume percentage of 1%, culturing to the middle logarithmic phase at the temperature of 40 ℃ and the speed of 100r/min, adding IPTG with the final concentration of 1mM, and continuously culturing for 10h to proliferate cells;

(4) mixing the biocatalyst A collected in step (3) with a Tris-HCl buffer solution (100mM, pH7.5) containing HMF such that the concentration of HMF in the mixture is 20mM and the concentration of biocatalyst is 5g stem cells/L, and simultaneously, adding Cu to the mixture²⁺Horseradish peroxidase and catalase to Cu²⁺The concentration was 0.Reacting for 20min at 40 ℃ and 100r/min with 5mM of horseradish peroxidase and 50U/mL of catalase to obtain a conversion solution;

(5) and (4) centrifuging the conversion solution in the step (4) at 6000r/min for 30min, removing the biocatalyst added in the step (4), and diluting the obtained clear solution by 10 times for HPLC detection.

(6) Detection of products in conversion solution

The conversion solution was free of HMF by HPLC, and the product included DFF and FFCA in a ratio of 8.5: 1.

Example 6: the multicellular sequences catalyze the synthesis of FDCA, and FIG. 2 shows the process of the present invention for the catalytic synthesis of FDCA.

(1) Taking a ring of thalli from an agar slant culture medium for storing the biocatalyst A, inoculating the thalli to an LB liquid culture medium, and culturing for 10h at 37 ℃ and 150r/min to activate strains;

(2) inoculating the activated seed solution into LB culture medium containing 2mM sodium tungstate according to the volume percentage of 1%, culturing to the middle logarithmic phase at the temperature of 37 ℃ and the speed of 150r/min, adding IPTG with the final concentration of 1mM, and continuously culturing for 10h to proliferate cells;

(4) mixing the biocatalyst A collected in step (3) with a phosphate buffer solution (100mM, pH 6.5) containing HMF such that the concentration of HMF in the mixture is 300mM and the concentration of biocatalyst is 50g dry cells/L, and simultaneously, adding Cu to the mixture²⁺Horseradish peroxidase and catalase to Cu²⁺Reacting for 6h at 37 ℃ and 150r/min with the concentration of 1mM, the concentration of horseradish peroxidase being 15U/mL and the concentration of catalase being 100U/mL to obtain a conversion solution;

(5) taking a ring of thalli from an agar slant culture medium for storing the biocatalyst B, inoculating the thalli to an LB culture medium, and culturing for 10 hours at 37 ℃ and 150r/min to activate strains;

(6) inoculating the activated seed liquid into a fresh LB liquid culture medium according to the volume percentage of 1 percent, culturing to the middle logarithmic phase at the temperature of 37 ℃ and under the condition of 150r/min, adding furfural with the concentration of 2mM, and continuously culturing for 10h to proliferate cells;

(7) centrifugally collecting thallus cells, washing thallus for 3 times by using normal saline, and separating to obtain complete microbial cells;

(8) mixing the biocatalyst B prepared in the step (7) with the conversion solution obtained in the step (4) to enable the concentration of the biocatalyst B in the mixture to be 50g of dry cells/L, adding 30g/L of calcium carbonate, and reacting for 4h at 37 ℃ and 150r/min to obtain the conversion solution containing FDCA.

(9) And (4) centrifuging the conversion solution in the step (8) for 5min at 12000r/min, removing the biocatalyst and the residual calcium carbonate added in the step (8), and diluting the obtained clear solution by 80 times for HPLC detection.

(10) Detection of products in conversion solution

The conversion of HMF was 84.5% by HPLC and the product was all FDCA.

Example 7: catalytic synthesis of FDCA by using multicellular sequences

(1) Taking a ring of thalli from an agar slant culture medium for storing the biocatalyst A, inoculating the thalli to an LB liquid culture medium, and culturing for 8 hours at 35 ℃ and 150r/min to activate strains;

(2) inoculating the activated seed solution into LB culture medium containing 1.5mM sodium tungstate according to the volume percentage of 3%, culturing to the middle logarithmic phase under the conditions of 35 ℃ and 150r/min, adding IPTG with the final concentration of 1mM, and continuously culturing for 11h to proliferate cells;

(4) mixing the biocatalyst A collected in step (3) with an acetate buffer (100mM, pH 6.0) containing HMF such that the concentration of HMF in the mixture is 100mM and the concentration of biocatalyst is 10g stem cells/L, and simultaneously, adding Cu to the mixture²⁺Horseradish peroxidase and catalase to Cu²⁺Reacting for 3h at 35 ℃ and 150r/min with the concentration of 1mM, the concentration of horseradish peroxidase being 10U/mL and the concentration of catalase being 80U/mL to obtain a conversion solution;

(5) centrifuging the conversion solution obtained in the step (4) for 5min at 10000r/min, and removing the biocatalyst A added in the step (4);

(6) taking a ring of thalli from an agar slant culture medium for storing the biocatalyst B, inoculating the thalli to an LB liquid culture medium, and culturing for 8 hours at 35 ℃ and 150r/min to activate strains;

(7) inoculating the activated seed solution into a fresh LB culture medium according to the volume percentage of 3%, culturing to a logarithmic phase under the conditions of 35 ℃ and 150r/min, adding HMF with the concentration of 3mM, and continuously culturing for 11h to proliferate cells;

(8) centrifugally collecting thallus cells, washing thallus for 3 times by using normal saline, and separating to obtain complete microbial cells;

(9) and (3) mixing the biocatalyst B prepared in the step (8) with the conversion solution obtained in the step (5) to enable the concentration of the biocatalyst B in the mixture to be 10g of dry cells/L, adding 10g/L of calcium carbonate, and reacting for 1h at 35 ℃ under the condition of 150r/min to obtain the conversion solution containing FDCA.

(10) And (4) centrifuging the conversion solution in the step (9) for 5min at 12000r/min, removing the biocatalyst and the residual calcium carbonate added in the step (9), and diluting the obtained clear solution by 30 times for HPLC detection.

(10) Detection of products in conversion solution

The conversion of HMF was 100% by HPLC and the product was all FDCA.

Example 8: catalytic synthesis of FDCA by using multicellular sequences

(1) Taking a ring of thalli from an agar slant culture medium for storing the biocatalyst A, inoculating the thalli to an LB liquid culture medium, and culturing for 12h under the conditions of 30 ℃ and 150r/min to activate strains;

(2) inoculating the activated seed solution into LB culture medium containing 1mM sodium tungstate according to the volume percentage of 1%, culturing to the middle logarithmic phase under the conditions of 30 ℃ and 150r/min, adding IPTG with the final concentration of 1mM, and continuously culturing for 9h to proliferate cells;

(4) mixing the biocatalyst A collected in step (3) with HMF-containingPhosphate buffer (100mM, pH 6.0) was mixed so that the concentration of HMF in the mixture was 50mM and the concentration of biocatalyst was 5g dry cells/L, and at the same time, Cu was added to the mixture²⁺Horseradish peroxidase and catalase to Cu²⁺Reacting at 35 deg.C and 150r/min for 80min with the concentration of 0.8mM, horseradish peroxidase concentration of 12U/mL, and catalase concentration of 80U/mL to obtain conversion solution;

(5) centrifuging the conversion solution in the step (4) for 5min at 8000r/min, and removing the biocatalyst A added in the step (4);

(6) taking a ring of thalli from an agar slant culture medium for storing the biocatalyst B, inoculating the thalli to an LB liquid culture medium, and culturing for 12h under the conditions of 30 ℃ and 150r/min to activate strains;

(7) inoculating the activated seed solution into a fresh LB culture medium according to the volume percentage of 1%, culturing to a middle logarithmic phase under the conditions of 30 ℃ and 150r/min, adding HMF with the concentration of 3mM, and continuously culturing for 9h to proliferate cells;

(9) and (3) mixing the biocatalyst B prepared in the step (8) with the conversion solution obtained in the step (5) to enable the concentration of the biocatalyst B in the mixture to be 5g of dry cells/L, adding 5g/L of calcium carbonate, and reacting for 60min at 35 ℃ under the condition of 150r/min to obtain the conversion solution containing FDCA.

(10) And (4) centrifuging the conversion solution in the step (9) for 5min at 8000r/min, removing the biocatalyst and the residual calcium carbonate added in the step (9), and diluting the obtained clear solution by 20 times for HPLC detection.

(11) Detection of substances in process of conversion solution

The multi-cell sequence catalytic process comprises two parts, wherein the first part is 80min of the step (4), and the second part is 60min of the step (9). The whole process lasts 140min, and samples are taken every 20min to detect the change of the substance concentration, and the process curve is shown in FIG. 3. Finally, the conversion of HMF was 100% and the product was all FDCA.

Comparative example 1: the culture medium of the biocatalyst A is not added with tungstate

(2) inoculating the activated seed solution into LB culture medium according to the volume percentage of 1%, culturing to the middle logarithmic phase under the conditions of 30 ℃ and 150r/min, adding IPTG with the final concentration of 1mM, and continuously culturing for 9h to proliferate cells;

(4) mixing the biocatalyst A collected in step (3) with a phosphate buffer solution (100mM, pH 6.0) containing HMF such that the concentration of HMF in the mixture is 50mM and the concentration of biocatalyst is 5g dry cells/L, and simultaneously, adding Cu to the mixture²⁺Horseradish peroxidase and catalase to Cu²⁺Reacting at 35 deg.C and 150r/min for 80min with the concentration of 0.8mM, horseradish peroxidase concentration of 12U/mL, and catalase concentration of 80U/mL to obtain conversion solution;

(9) and (3) mixing the biocatalyst prepared in the step (8) with the conversion solution obtained in the step (5), enabling the concentration of the biocatalyst B in the mixture to be 5g of dry cells/L, adding 5g/L of calcium carbonate, and reacting for 60min at 35 ℃ under the condition of 150r/min to obtain the final conversion solution.

(11) Detection of substances in process of conversion solution

The conversion of HMF was 100% by HPLC, and the product was a mixture of HMFCA and FDCA in a ratio of 49: 1.

Comparative example 2: adding permanganate into culture medium of biocatalyst A

(2) inoculating the activated seed solution into LB culture medium containing 1mM potassium permanganate according to the volume percentage of 1%, culturing to the middle logarithmic phase under the conditions of 30 ℃ and 150r/min, adding IPTG with the final concentration of 1mM, and continuously culturing for 9h to proliferate cells;

(5) centrifuging the conversion solution obtained in the step (4) at 8,000r/min for 5min, and removing the biocatalyst A added in the step (4);

(10) And (4) centrifuging the conversion solution in the step (9) for 5min at 8,000r/min, removing the biocatalyst and the residual calcium carbonate added in the step (9), and diluting the obtained clear solution by 20 times for HPLC detection.

(11) Detection of substances in process of conversion solution

The product was a mixture of HMFCA and FDCA in a ratio of 49:1 by HPLC.

Comparative example 3: adding molybdate to the culture medium of the biocatalyst A

(2) inoculating the activated seed solution into LB culture medium containing 1mM sodium molybdate according to the volume percentage of 1%, culturing to the middle logarithmic phase under the conditions of 30 ℃ and 150r/min, adding IPTG with the final concentration of 1mM, and continuously culturing for 9h to proliferate cells;

(11) Detection of substances in process of conversion solution

The product was a mixture of HMFCA and FDCA in a ratio of 49:1 by HPLC.

Comparative example 4:

(1) inoculating a ring of thallus from an agar slant culture medium for storing wild type pseudomonas marginalis to an LB liquid culture medium, and culturing for 12 hours at the temperature of 30 ℃ and at the speed of 150r/min to activate strains;

(4) mixing the biocatalyst collected in step (3) with a phosphate buffer (100mM, pH 6.0) containing HMF and allowing HMF in the mixture to settleThe concentration was 50mM, the biocatalyst concentration was 5g stem cells/L, and Cu was added to the mixture²⁺Horseradish peroxidase and catalase to Cu²⁺Reacting at 35 deg.C and 150r/min for 80min with the concentration of 0.8mM, horseradish peroxidase concentration of 12U/mL, and catalase concentration of 80U/mL to obtain conversion solution;

(5) centrifuging the conversion solution obtained in the step (4) at 8,000r/min for 5min, and removing the biocatalyst added in the step (4);

(11) Detection of substances in process of conversion solution

HMF was not converted as detected by HPLC.

The present invention provides a method and a concept for a method of synthesizing FDCA by multi-cellular sequence catalysis, and a method and a way for implementing the technical scheme are many, and the above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, a plurality of modifications and embellishments can be made without departing from the principle of the present invention, and these modifications and embellishments should be regarded as the protection scope of the present invention. All the components not specified in the present embodiment can be realized by the prior art.

Sequence listing

<110> Nanjing university of forestry

<120> Pseudomonas marginalis and application thereof in preparation of 2, 5-furandicarboxylic acid

<160>1

<170>SIPOSequenceListing 1.0

<210>1

<211>1917

<212>DNA

<213> Galactose oxidase mutant (Galactose oxidase mutant)

<400>1

gcctcagcac ctatcggaag cgccattccg cgcaacaact gggccgtcac ttgcgacagt 60

gcacagtcgg gaaatgaatg caacaaggcc attgatggca acaaggatac cttttggcac 120

acattctatg gcgccaacgg ggatccaaag ccccctcaca catacacgat tgacatgaag 180

acaactcaga acgtcaacgg cttgtctgtt ctgcctcgac aggatggtaa ccaaaacggc 240

tggatcggtc gccatgaggt ttatctaagc tcagatggca caaactgggg cagccctgtt 300

gcgtcaggta gttggttcgc cgactctact acaaaatact ccaactttga aactcgccct 360

gctcgctatg ttcgtcttgt cgctatcact gaagcgaatg gccagccgtg gactagcatt 420

gcagagatca acgtcttcca agctagttct tacacagccc cccagcctgg tcttggacgc 480

tggggtccga ctattgactt accgattgtt cctgcggctg cagcaattga accgacatcg 540

ggacgagtcc ttatgtggtc ttcatatcgc aatgatgcat ttgaaggatc ccctggtggt 600

atcactttga cgtcttcctg ggatccatcc actggtattg tttccgaccg cactgtgaca 660

gtcaccaagc atgatatgtt ctgccctggt atctccatgg atggtaacgg tcagatcgta 720

gtcacaggtg gcaacgatgc caagaagacc agtttgtatg attcatctag cgatagctgg 780

atcccgggac ctgacatgca agtggctcgt gggtatcagt catcagctac catgtcagac 840

ggtcgtgttt ttaccattgg aggctccttt agcggtggcg tatttgagaa gaatggcgaa 900

gtctatagcc catcttcaaa gacatggacg tccctaccca atgccaaggt caacccaatg 960

ttgacggctg acaagcaagg attgtacatg tcagacaacc acgcgtggct ctttggatgg 1020

aagaagggtt cggtgttcca agcgggacct agcacagcca tgaactggta ctataccagt 1080

ggaagtggtg atgtgaagtc agccggaaaa cgccagtcta accgtggtgt agcccctgat 1140

gccatgtgcg gaaacgctgt catgtacgac gccgttaaag gaaagatcct gacctttggc 1200

ggctccccag attataccga ctctgacgcc acaaccaacg cccacatcat caccctcggt 1260

gaacccggaa catctcccaa cactgtcttt gctagcaatg ggttgtactt tgcccgaacg 1320

tttcacacct ctgttgttct tccagacgga agcacgttta ttacaggagg ccaacgacgt 1380

ggaattccgt tcgaggattc aaccccggta tttacacctg agatctacgt ccctgaacaa 1440

gacactttct acaagcagaa ccccaactcc attgttcgcg cataccatag catttccctt 1500

ttgttacctg atggcagggt atttaacggt ggtggtggtc tttgtggcga ttgtaccacg 1560

aatcatttcg acgcgcaaat ctttacgcca aactatcttt acgatagcaa cggcaatctc 1620

gcgacacgtc ccaagattac cagaacctct acacagagcg tcaaggtcgg tggcagaatt 1680

acaatctcga cggattcttc gattagcaag gcgtcgttga ttcgctatgg tacagcgaca 1740

cacacggtta atactgacca gcgccgcatt cccctgactc tgacaaacaa tggaggaaat 1800

agctattctt tccaagttcc tagcgactct ggtgttgctt tgcctggcta ctggatgttg 1860

ttcgtgatga actcggccgg tgttcctagt gtggcttcga cgattcgcgt tactcag 1917

Claims

1. The Pseudomonas marginalis is classified and named as Pseudomonas marginalis (Pseudomonas marginalis), has a strain name of 19Z, is preserved in China Center for Type Culture Collection (CCTCC) with a preservation number of M2019984 and is preserved for 11-28 months in 2019.

2. The use of Pseudomonas marginalis as claimed in claim 1, and of recombinant Pseudomonas marginalis produced using Pseudomonas marginalis as starting bacteria, for the production of 2, 5-furandicarboxylic acid.

3. Use according to claim 2, characterized in that it comprises the following steps:

4. The use according to claim 3, wherein in step (1), the genetic modification is intracellular overexpression of a gene that oxidizes the hydroxymethyl group of 5-hydroxymethylfurfural to an aldehyde group.

5. The use according to claim 3, wherein in step (1), the culture medium comprises 0.1-10 mM LB medium of tungstate.

6. The use according to claim 3, wherein in the step (1), the seed solution is inoculated into the culture medium at an inoculum size of 0.5-10 v/v%; the culture is carried out for 8-14 h after the culture is carried out for a logarithmic period under the conditions of 25-40 ℃ and 100-200 r/min;

wherein isopropyl thiogalactoside was added to a final concentration of 1mM during the medium log phase of the culture.

7. The use according to claim 3, wherein in step (2), the 5-hydroxymethylfurfural is a buffer solution containing 5-hydroxymethylfurfural; the pH value of the buffer solution is 5.0-9.0; the content of 5-hydroxymethylfurfural in the buffer solution is 10-300 mM; the mass volume ratio of the first bacterial cells to the buffer solution is 3-50 g of stem cells/L; the reaction conditions are 15-50 ℃, 50-300 r/min and 10-12 h.

8. The use according to claim 3, wherein in the step (3), the seed solution is inoculated into the culture medium at an inoculum size of 0.5-10 v/v%; the culture is carried out for 6-12 h after the culture is carried out for a period of 6-12 h at 25-40 ℃ and 100-200 r/min.

9. Use according to claim 8, characterized in that the inducer is added when the culture is in mid-log phase; wherein the inducer is any one of 5-hydroxymethylfurfural, furfural, 2, 5-furandicarboxylic acid and furfuryl alcohol; the addition amount of the inducer is controlled so that the concentration of the inducer is 0.5 to 6 mM.

10. The use according to claim 3, wherein in the step (4), the mass-to-volume ratio of the second bacterial cells to the product obtained in the step (2) is 3-50 g of dry cells/L of the transformation solution; the addition amount of calcium carbonate is 2-8 g/L of the conversion solution; the catalytic reaction conditions are 15-50 ℃ and 50-300 r/min for 10 min-12 h.