CN110904011B - Prothioconazole efficient degrading bacterium W313, microbial inoculum and application - Google Patents
Prothioconazole efficient degrading bacterium W313, microbial inoculum and application Download PDFInfo
- Publication number
- CN110904011B CN110904011B CN201911314176.3A CN201911314176A CN110904011B CN 110904011 B CN110904011 B CN 110904011B CN 201911314176 A CN201911314176 A CN 201911314176A CN 110904011 B CN110904011 B CN 110904011B
- Authority
- CN
- China
- Prior art keywords
- prothioconazole
- degrading
- strain
- bacterium
- hydrolase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/38—Pseudomonas
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D3/00—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances
- A62D3/02—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances by biological methods, i.e. processes using enzymes or microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D2101/00—Harmful chemical substances made harmless, or less harmful, by effecting chemical change
- A62D2101/04—Pesticides, e.g. insecticides, herbicides, fungicides or nematocides
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D2101/00—Harmful chemical substances made harmless, or less harmful, by effecting chemical change
- A62D2101/20—Organic substances
- A62D2101/28—Organic substances containing oxygen, sulfur, selenium or tellurium, i.e. chalcogen
Abstract
The invention provides a prothioconazole efficient degrading bacterium W313, a microbial inoculum and application, and relates to the technical field of biology. The prothioconazole efficient degrading bacterium W313 is classified and named as Pseudomonas (Pseudomonas sp.) and is preserved in China general microbiological culture collection center in 11 days 09 and 2019, with the preservation number of CGMCC No. 18486. The prothioconazole efficient degrading bacterium W313 has the beneficial effects of higher prothioconazole tolerance, better prothioconazole degrading activity and prothioconazole hydrolase activity production.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a prothioconazole efficient degrading bacterium W313, a microbial inoculum and application thereof.
Background
China is the first major country in the world for producing and using pesticides, the chemical control area is 70 hundred million mu each year, and the annual usage amount of the pesticides reaches more than 200 million. In which prothioconazole is a novel broad-spectrum triazolethione bactericide developed by Bayer corporation, and is used for preventing and treating diseases caused by ascomycetes, basidiomycetes and deuteromycetes, and the action mechanism of the prothioconazole is to inhibit the demethylation action on the 14-position of lanosterol or 2, 4-methylenedihydrolanosterol which is a precursor of mycosterol, namely a demethylation inhibitor. The main metabolite in crops and soil is its desulfurization product, desulfotriazole. It has high reproductive toxicity and developmental toxicity to human body, and has severe teratogenicity to embryo.
The prothioconazole is used in a backpack manual spraying scene, the application dosage is calculated according to 0.2kg ai/ha, and when the target crops are middle-height crops such as wheat and the like, under the condition of lacking the conversion rate of converting prothioconazole into prothioconazole, the prothioconazole is completely converted into prothioconazole desulfurated, so that the evaluation is carried out, and the health risk of the applicator is unacceptable. Therefore, the problem of the residue of prothioconazole in the environment is to be solved urgently.
In view of the above, the present invention is particularly proposed.
Disclosure of Invention
The first purpose of the invention is to provide a prothioconazole efficient degrading bacterium W313 which is classified and named as Pseudomonas sp, is preserved in China general microbiological culture collection center on 11/09 and 2019 with the preservation number of CGMCC No. 18486.
The second purpose of the invention is to provide a microbial inoculum, which comprises the prothioconazole efficient degrading bacterium W313 and optional auxiliary materials.
The third object of the present invention is to provide a prothioconazole hydrolase obtained by separating prothioconazole hydrolase from said prothioconazole highly effective degrading bacterium W313.
The fourth purpose of the invention is to provide the prothioconazole efficient degrading bacterium W313, the microbial inoculum and the application of prothioconazole hydrolase.
In order to solve the technical problems, the invention adopts the following technical scheme:
according to one aspect of the invention, the invention provides a prothioconazole efficient degrading bacterium W313 which is classified and named as Pseudomonas (Pseudomonas sp.) and is preserved in China general microbiological culture Collection center (CGMCC No. 18486) on 11 days 09 and 2019.
According to another aspect of the invention, the invention also provides a microbial inoculum, which comprises the prothioconazole efficient degrading bacterium W313.
According to another aspect of the present invention, there is also provided a prothioconazole hydrolase isolated from said prothioconazole efficient degrading bacterium W313.
According to another aspect of the present invention, the present invention also provides a method for producing prothioconazole hydrolase, comprising producing the prothioconazole hydrolase by fermenting with the prothioconazole high efficiency degrading bacterium W313.
According to another aspect of the invention, the invention also provides an intracellular total protein extract of the prothioconazole high-efficiency degrading bacterium W313.
According to another aspect of the present invention, there is also provided a method for degrading prothioconazole, comprising degrading prothioconazole using the high efficiency prothioconazole degrading bacterium W313, the microbial inoculum, the prothioconazole hydrolase or the total intracellular protein extract.
According to another aspect of the invention, the invention also provides the prothioconazole efficient degrading bacterium W313, the bacterium agent, the prothioconazole hydrolase, a production method of the prothioconazole hydrolase or an application of the intracellular total protein extract in preparation of a prothioconazole degrading product.
According to another aspect of the invention, the invention also provides a prothioconazole degrading product, which comprises the prothioconazole efficient degrading bacterium W313, the bacterium agent, the prothioconazole hydrolase or the intracellular total protein extract.
According to another aspect of the invention, the invention also provides the prothioconazole efficient degrading bacterium W313, the bacterium agent, the prothioconazole hydrolase, a production method of the prothioconazole hydrolase or application of the intracellular total protein extract in preparing a product for degrading a pesticide.
According to another aspect of the invention, the invention also provides a product for degrading pesticides, which comprises the prothioconazole efficient degrading bacterium W313, the microbial inoculum, the prothioconazole hydrolase or the intracellular total protein extract.
Compared with the prior art, the invention has the following beneficial effects:
the prothioconazole efficient degrading bacterium W313 provided by the invention is screened out from activated sludge, is a new species of Pseudomonas (Pseudomonas), can normally grow on a culture medium with prothioconazole concentration of 200mg/L, and has high tolerance to prothioconazole. When the prothioconazole efficient degrading bacterium W313 takes prothioconazole as a unique carbon source, the degradation rate of prothioconazole after 48 hours of culture can reach 61%, which indicates that the bacterium has better prothioconazole degrading activity. The enzyme activity of the intracellular total protein prothioconazole hydrolase can reach 2.32U/mg total protein after 60 hours of intracellular total protein discovery by separating the prothioconazole high-efficiency degrading bacterium W313, which indicates that the prothioconazole high-efficiency degrading bacterium W313 has the activity of producing prothioconazole hydrolase.
Based on the beneficial effects of the prothioconazole high-efficiency degrading bacterium W313, the invention also provides a microbial inoculum containing the prothioconazole high-efficiency degrading bacterium W313, an intracellular total protein extract and prothioconazole hydrolase of the prothioconazole high-efficiency degrading bacterium W313 and applications thereof, and the products and applications based on the prothioconazole high-efficiency degrading bacterium W313 have the beneficial effects of the prothioconazole high-efficiency degrading bacterium W313. In particular, the prothioconazole efficient degrading bacterium W313, the related product thereof and the method for applying the prothioconazole efficient degrading bacterium W313 to degrade prothioconazole and prepare a product for degrading pesticides can effectively eliminate prothioconazole pollution in the environment and pesticide residues of pesticides containing prothioconazole, the removing effect is good, no secondary pollution is generated in the removing process, and the method is an ideal method for removing pesticide residues in the environment.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1 is a colony morphology of the W313 strain provided by the present invention;
FIG. 2 is a gram stain of the W313 strain provided by the present invention;
FIG. 3 is a phylogenetic tree of the W313 strain provided by the present invention;
FIG. 4 is a W313 strain grown with prothioconazole as the sole carbon source at a prothioconazole concentration of 20 ppm;
FIG. 5 is a W313 strain grown with prothioconazole as the sole carbon source at a prothioconazole concentration of 200 ppm;
FIG. 6 is a growth degradation curve of the W313 strain provided by the present invention.
Detailed Description
The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments, and it should be understood that the described embodiments are some, but not all, embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
According to one aspect of the invention, the invention provides a prothioconazole efficient degrading bacterium W313 (hereinafter referred to as W313 strain). The preservation date of the strain is 09 and 11 in 2019; the preservation number is CGMCC No. 18486; the classification is named as Pseudomonas (Pseudomonas sp.), and the name of a depository is as follows: china general microbiological culture Collection center, address: west road No.1, north chen, chaoyang district, beijing, zip code: 100101.
the W313 strain provided by the invention is screened out from activated sludge, the growth of bacterial colonies on an inorganic salt culture medium is slow, and after the bacterial colonies are cultured for 2 days at the temperature of 30 ℃, the diameter of the bacterial colonies is 2-3 mm, the morphology of the bacterial colonies is different, the edges are uneven, the bacterial colonies are flat and moist, and the bacterial colonies are grayish green; the strain grows in a culture medium which takes prothioconazole as a unique carbon source, has higher tolerance and utilization rate to prothioconazole, can normally grow on the culture medium with the prothioconazole concentration of 700mg/L at the highest, and shows that the prothioconazole of the strain has higher tolerance.
The rDNA Internal Transcribed Spacer (ITS) sequence of the W313 strain provided by the invention is shown in SEQ ID NO.1, the similarity with the known ITS sequences of the Pseudomonas aeruginosa strain and the Pseudomonas otitidis strain is over 90 percent, and the new Pseudomonas strain is determined by combining the morphological characteristics of the ITS sequences, and is classified into Pseudomonas.
The W313 strain provided by the invention is inoculated in a liquid culture medium which takes prothioconazole as a unique carbon source, the utilization rate of prothioconazole in the culture medium is researched, and the result shows that: the W313 strain was subjected to liquid fermentation at 30 ℃ and 180rpm/min in a liquid medium (pH 6.4) containing prothioconazole as a carbon source at a prothioconazole concentration of 20mg/L, and a sample was taken every day to examine the change in prothioconazole content. The growth enters a logarithmic growth phase after a lag phase of 20 hours, after 20 hours, the strain enters a stationary growth phase, and the strain is in the lag phase of prothioconazole degradation within 20-40 hours; the concentration of the prothioconazole is rapidly reduced after 40 hours, and the degradation rate reaches 61% after 48 hours, which shows that the prothioconazole has better degradation activity.
The enzyme amount required for degrading 1 mu mol of prothioconazole per minute is defined as 1 enzyme activity unit by taking the W313 strain intracellular total protein sample liquid provided by the invention, and the enzyme activity of the intracellular total protein prothioconazole hydrolase can reach 2.32U/mg total protein after 60 hours, which indicates that the W313 strain has prothioconazole hydrolase activity.
In conclusion, the W313 strain provided by the invention is a new strain of a Pseudomonas (Pseudomonas), has higher prothioconazole tolerance, better prothioconazole degradation activity and beneficial effects of producing prothioconazole hydrolase activity.
Based on the W313 strain provided by the invention, the invention also provides a microbial inoculum containing the W313 strain, and the microbial inoculum and the W313 strain are based on the same inventive concept, so that the microbial inoculum has all the beneficial effects of the W313 strain, and the details are not repeated.
The microbial inoculum provided by the invention can also comprise other types of microorganisms, can be used as an active substance together with the W313 strain, and can also comprise a strain for efficiently degrading organophosphorus or pyrethroid pesticides, for example, but the invention is not limited to this.
The microbial inoculum provided by the invention can also comprise optional auxiliary materials except microorganisms used as active ingredients, wherein the optional auxiliary materials can be contained in the microbial inoculum or not contained in the microbial inoculum. The auxiliary material refers to a component which does not influence the physiological and biochemical activity of microorganisms in the microbial inoculum and can improve the performance of the microbial inoculum. Examples of adjuvants include, but are not limited to, desiccants, pH adjusters, dispersants, nutrients, and the like. The adjuvant may further include a carrier for adsorbing the microorganisms, and examples of the carrier include, but are not limited to, calcium carbonate, zeolite, montmorillonite, rice hull, diatomaceous earth, polyvinyl alcohol, polyethylene glycol, polyurethane, and the like. The auxiliary material may further include a substance for providing nutrition to the microorganisms in the microbial agent, and examples of the substance for providing nutrition include, but are not limited to, a nitrogen source, a carbon source, trace elements, amino acids, microorganisms, and the like.
Based on the characteristic that the W313 strain provided by the invention has the activity of producing prothioconazole hydrolase, the invention also provides prothioconazole hydrolase, and the prothioconazole hydrolase is a hydrolase which is separated from the W313 strain and can effectively hydrolyze prothioconazole. Accordingly, the present invention also provides an intracellular total protein extract of the W313 strain, which has an effect of hydrolyzing prothioconazole as well because it contains a hydrolase of prothioconazole.
The invention also provides a production method of the prothioconazole hydrolase, and the prothioconazole hydrolase is produced by fermenting the W313 strain. The fermentation of the prothioconazole efficient degrading bacterium W313 can adopt a culture method of microorganisms which is conventional in the field, such as a fermentation method of a pseudomonas microorganism, and then obtains an intracellular total protein extract of the W313 strain, namely, prothioconazole hydrolase.
Based on the fact that the W313 strain provided by the invention has prothioconazole tolerance and degrading activity, the invention also provides a method for degrading prothioconazole, and the method uses the W313 strain, the microbial inoculum, the prothioconazole hydrolase or the intracellular total protein extract of the W313 strain to degrade prothioconazole. The method for degrading prothioconazole provided by the invention is a Bioremediation method, and Bioremediation is a biological means for effectively removing various pollutants in the environment by using living organisms such as bacteria and the like and degrading enzymes produced by the living organisms. The method for degrading prothioconazole provided by the invention can be used for degrading pesticides taking prothioconazole as a main active ingredient, is an ideal method for removing pesticide residues in the environment, and has the beneficial effects of high efficiency and no secondary pollution.
The invention also provides the application of the W313 strain, a microbial inoculum containing the W313 strain, prothioconazole hydrolase, an intracellular total protein extract of the W313 strain or a production method of the prothioconazole hydrolase in preparing products for degrading prothioconazole and in preparing products for degrading pesticides. The W313 strain, microbial inoculum containing the same, prothioconazole hydrolase and intracellular total protein extract of the W313 strain all have the function of degrading prothioconazole, so that the strain can be used as an active ingredient for preparing products for degrading prothioconazole and products for preparing pesticides. The process for producing prothioconazole hydrolase can be used for producing prothioconazole hydrolase and thus can be used as a step in the production steps of prothioconazole-degrading products and pesticide-degrading products.
The W313 strain and related products thereof are used for preparing products for degrading prothioconazole, can be used for removing pesticide residues with prothioconazole as a main active ingredient, can also be used for researching the metabolism of prothioconazole, and is beneficial to further research on prothioconazole. The W313 strain and related products thereof are used for preparing products for degrading pesticides, so that the products for removing pesticide residues by using a bioremediation method are developed, and the beneficial effects of effectively removing pesticide residues and not causing secondary environmental pollution are achieved.
The invention also provides a product for degrading prothioconazole and a product for degrading pesticide, which respectively and independently comprise the W313 strain, a microbial inoculum containing the W313 strain, prothioconazole hydrolase or an intracellular total protein extract of the W313 strain. The above products have all their beneficial effects because they have the W313 strain or products related thereto as the main active ingredient, and thus are not described herein again.
The product for degrading the pesticide provided by the invention degrades the pesticide by a biological means, has good removal effect, avoids secondary pollution in the process of degrading the pesticide, is an ideal product for removing pesticide residues in the environment, has unique advantages in the aspect of environmental remediation, and relieves the problem of pesticide residues.
The technical solution and the advantages of the present invention will be further explained with reference to the preferred embodiments.
Example 1
Separating and screening strains: collecting activated sludge from wastewater treatment pool of certain pesticide plant containing prothioconazole, and taking 5mL of culture solution into 100mL of inorganic salt liquid culture medium (K) with prothioconazole as unique carbon source by adopting continuous enrichment culture method2HPO4·3H2O 1.00g/L、MgSO4·7H2O 2.00g/L、CaSO4 0.40g/L、NaCl 0.50g/L、FeSO4·7H2O 0.01g/L、(NH4)2SO41.00g/L) and culturing in a constant temperature incubator at 30 ℃ for 48 hours; and (2) streaking and inoculating a culture solution in a 700mg/L prothioconazole inorganic salt culture medium on a solid culture medium, separating and purifying to obtain a prothioconazole efficient degrading bacterium, namely W313, and storing on a slant.
Example 2 identification of W313 Strain
1. Morphological identification: the initial morphological identification of the strain is according to the bacterial identification handbook; as shown in FIG. 1, the colony of the W313 strain grows slowly on the inorganic salt medium, and the surface of the colony is flat, wet and grey-green; the W313 strain can grow in a culture medium with prothioconazole as a unique carbon source, has higher tolerance and utilization rate on prothioconazole, and shows that the strain has higher prothioconazole degradation activity. The gram stain results of the W313 strain are shown in FIG. 2.
2. And (3) identifying the strain in molecular biology: DNA extraction, PCR amplification and sequence analysis of the amplified product of the W313 strain: extracting the W313 strain genome DNA by using fresh thalli cultured for 4d as a DNA extraction material by a urea extraction method, and detecting the purity by 0.8% agarose gel electrophoresis; PCR was carried out using the total DNA extracted above as a template and primers ITS1/ITS 4; the PCR product is sent to Shanghai biological engineering Co., Ltd for sequencing, and the sequencing result is as follows:
5’-CATGCAAGTCGAGCGGATGAGTGGAGCTTGCTCCATGATTCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAAGTGGGGGATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGGGGTAATGGCCCACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATGTGAAAGCCCCGGGCTCAACCTGGGAATTGCATCCAAAACTACTGAGCTAGAGTACGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGACTAGCCGTTGGGATCCTTGAGATCTTAGTGGCGCAGCTAACGCGATAAGTCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCTGGGCTTG-3’(SEQ ID NO.1)
homology alignment in the GenBank database revealed that the W313 strain had over 90% similarity to the ITS sequences of both the known Pseudomonas aeruginosa strain and the Pseudomonas otitidis strain, as shown in FIG. 3.
The strain is determined to be a new Pseudomonas strain by combining the morphological characteristics, and is classified into Pseudomonas (Pseudomonas) and named as W313.
Example 3
Tolerance test of W313 strain to prothioconazole on plates:
the W313 strain is inoculated on a solid plate with prothioconazole as the only nutrient source, wherein the concentration of the prothioconazole is respectively 10mg/L, 50mg/L, 100mg/L and 200mg/L, and the result shows that the W313 strain normally grows on a culture medium with the concentration of the prothioconazole of 200mg/L, and the results are shown in fig. 4 and fig. 5, wherein the concentration of the prothioconazole is 20ppm in fig. 4, and the concentration of the prothioconazole is 200ppm in fig. 5, which indicates that the prothioconazole of the strain has higher tolerance.
Example 4
Testing of the degradation rate of prothioconazole in liquid medium:
the W313 strain was inoculated into 200mL of a fermentation medium (formulation: glucose 5g/L, prothioconazole 20mg/L, MgSO)4·7H2O 0.5g/L、KCl 0.5g/L、FeSO4·7H2O 0.01g/L、K2HPO41g/L), culturing at 30 ℃ and 180rpm by a shaking table; the prothioconazole content was determined by HPLC.
Preparation of a prothioconazole standard curve: respectively sucking a proper amount of 5000ppm of prothioconazole standard solution, and diluting the prothioconazole standard solution by using methanol in a gradient manner until the final concentration of prothioconazole is 10ppm, 5ppm, 2ppm, 1ppm and 0.5 ppm; each sample was measured for its absorption peak at 144.6, 68.5, 27.4, 12.9 and 7.1 respectively, with the standard curve equation being y-14.497 x-1.538; r2＝0.9993。
HPLC detection conditions: TC-C18 chromatographic column, 4.6X 250mm, 5 μm; column temperature: 30 ℃; ultraviolet wavelength: 270 nm; flow rate: 1.0 mL/min; sample introduction amount: 20 mu L of the solution; mobile phase: acetonitrile: phosphate buffer 65:35 (v/v). The experimental result is shown in fig. 6, the growth enters a logarithmic growth phase after a lag phase of 20h, the strain enters a stable growth phase after 20h, and the strain is in the lag phase of prothioconazole degradation within 20-40 h; the concentration of the prothioconazole is rapidly reduced after 40 hours, and the degradation rate reaches 67% after 72 hours, which indicates that the W313 strain has better prothioconazole degradation activity.
Example 5
Determination of prothioconazole hydrolase activity: the W313 strain was inoculated into 200mL of a fermentation medium (formulation: glucose 5g/L, prothioconazole 20mg/L, MgSO)4·7H2O 0.5g/L、KCl 0.5g/L、FeSO4·7H2O 0.01g/L、K2HPO41g/L), 30 ℃, 180rpm, shaking for 60h, filtering and collecting the thalli, rinsing twice with deionized water, and slowing with PBS (pH7.4)Rinsing with flushing liquid once; adding 10mL of 4 ℃ precooled buffer solution into each gram of wet thalli, ultrasonically crushing the thalli for 1h in an ice bath, and pausing for 10 seconds every 5 seconds of ultrasonic treatment; taking out, centrifuging at 12000rpm for 10min, and taking the supernatant as the intracellular total protein sample liquid of the W313 strain.
The enzyme catalysis reaction system is 800 mu L, 500 mu L of 0.1 mol.L is taken firstly-1Tris-HCl buffer, pH7.4, 60. mu.L 0.1 mol. L-1The NaCl solution and 40 mu L of the prothioconazole solution with the concentration of 50ppm are uniformly mixed in a 1.5mL centrifuge tube and preheated for 5min at the temperature of 30 ℃; adding 200 μ L crude protein sample solution, preheating at 30 deg.C for 5min, starting enzyme catalysis reaction, and timing in 30 deg.C water bath; taking reaction solution at 0min, 10min and 30min respectively, adding 10 μ L concentrated hydrochloric acid to terminate enzyme system reaction; under the condition, the enzyme amount required for degrading 1 mu mol of prothioconazole per minute is defined as 1 enzyme activity unit; the content change of the prothioconazole in the sample is determined by HPLC, and the result shows that the enzyme activity of the intracellular total protein prothioconazole hydrolase can reach 2.32U/mg total protein after the W313 is fermented for 60 hours; this indicates that W313 of the present invention has prothioconazole hydrolase activity.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
SEQUENCE LISTING
<110> agriculture university of Anhui
<120> prothioconazole high-efficiency degrading bacterium W313, microbial inoculum and application
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 933
<212> DNA
<213> Pseudomonas sp (Pseudomonas sp.)
<400> 1
catgcaagtc gagcggatga gtggagcttg ctccatgatt cagcggcgga cgggtgagta 60
atgcctagga atctgcctgg tagtggggga taacgtttcg aaaggaacgc taataccgca 120
tacgtcctac gggagaaagt gggggatctt cggacctcac gctatcagat gagcctaggt 180
cggattagct agttggtggg gtaatggccc accaaggcga cgatccgtaa ctggtctgag 240
aggatgatca gtcacactgg aactgagaca cggtccagac tcctacggga ggcagcagtg 300
gggaatattg gacaatgggc gaaagcctga tccagccatg ccgcgtgtgt gaagaaggtc 360
ttcggattgt aaagcacttt aagttgggag gaagggcagt aagttaatac cttgctgttt 420
tgacgttacc aacagaataa gcaccggcta acttcgtgcc agcagccgcg gtaatacgaa 480
gggtgcaagc gttaatcgga attactgggc gtaaagcgcg cgtaggtggt tcagcaagtt 540
ggatgtgaaa gccccgggct caacctggga attgcatcca aaactactga gctagagtac 600
ggtagagggt ggtggaattt cctgtgtagc ggtgaaatgc gtagatatag gaaggaacac 660
cagtggcgaa ggcgaccacc tggactgata ctgacactga ggtgcgaaag cgtggggagc 720
aaacaggatt agataccctg gtagtccacg ccgtaaacga tgtcgactag ccgttgggat 780
ccttgagatc ttagtggcgc agctaacgcg ataagtcgac cgcctgggga gtacggccgc 840
aaggttaaaa ctcaatgaat tgacgggggc ccgcacaagc ggtggagcat gtggtttaat 900
tcgaagcaac gcgaagaacc ttacctgggc ttg 933
Claims (7)
1. One strain of efficient prothioconazole degrading bacteria W313 which is classified and named as pseudomonas (pseudomonas) ((pseudomonas))Pseudomonas sp.) And the strain is preserved in the China general microbiological culture Collection center on 11 th 09 month in 2019, and the preservation number is CGMCC No. 18486.
2. A microbial agent comprising the prothioconazole highly effective degrading bacterium W313 according to claim 1.
3. A method for producing a prothioconazole hydrolase, which comprises producing the prothioconazole hydrolase by fermentation using the high-efficiency prothioconazole degrading bacterium W313 according to claim 1.
4. The intracellular total protein extract of prothioconazole high efficiency degrading bacterium W313 of claim 1.
5. A method for degrading prothioconazole, which comprises degrading prothioconazole by using the bacterium agent of claim 1 which is highly effective as prothioconazole W313, the bacterium agent of claim 2 which is highly effective as prothioconazole W313, or the total protein extract in cells of prothioconazole which is highly effective as prothioconazole W313.
6. Use of the prothioconazole efficient degrading bacterium W313 of claim 1, the microbial inoculum of claim 2, the method for producing prothioconazole hydrolase of claim 3 or the intracellular total protein extract of prothioconazole efficient degrading bacterium W313 of claim 4 in the preparation of prothioconazole-degrading products.
7. A prothioconazole-degrading product comprising the prothioconazole-degrading bacterium W313 of claim 1, the microbial inoculum of claim 2 or the total protein extract in cells of the prothioconazole-degrading bacterium W313 of claim 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911314176.3A CN110904011B (en) | 2019-12-19 | 2019-12-19 | Prothioconazole efficient degrading bacterium W313, microbial inoculum and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911314176.3A CN110904011B (en) | 2019-12-19 | 2019-12-19 | Prothioconazole efficient degrading bacterium W313, microbial inoculum and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110904011A CN110904011A (en) | 2020-03-24 |
| CN110904011B true CN110904011B (en) | 2021-04-23 |
Family
ID=69826720
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911314176.3A Active CN110904011B (en) | 2019-12-19 | 2019-12-19 | Prothioconazole efficient degrading bacterium W313, microbial inoculum and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110904011B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109152367A (en) * | 2016-02-09 | 2019-01-04 | 巴斯夫欧洲公司 | Mixture and composition comprising bacillus genus bacterial strain or its metabolin and other biological pesticides |
| CN109315408A (en) * | 2017-07-30 | 2019-02-12 | 张萃华 | A kind of Pesticidal combination containing prothioconazoles and chlortoluron |
| CN110072390A (en) * | 2016-12-16 | 2019-07-30 | 拜耳作物科学股份公司 | Use the method for carboxamides derivatives prevention and treatment bacterial diseases of plants |
| CN110325040A (en) * | 2017-02-28 | 2019-10-11 | 三井化学Agro株式会社 | Plant disease control composition and apply its plant disease the method for control |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080167374A1 (en) * | 2007-01-09 | 2008-07-10 | Loveland Products, Inc. | Pesticide composition and method of use |
| AR103290A1 (en) * | 2014-12-29 | 2017-04-26 | Fmc Corp | COMPOSITIONS OF BACILLUS AMYLOLIQUEFACIENS RTI301 AND METHODS OF USE TO BENEFIT THE GROWTH OF PLANTS AND THE TREATMENT OF PLANT DISEASES |
| CN107568239A (en) * | 2017-09-08 | 2018-01-12 | 江西中迅农化有限公司 | A kind of bactericidal composition containing rosickyite azoles and benziothiazolinone |
-
2019
- 2019-12-19 CN CN201911314176.3A patent/CN110904011B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109152367A (en) * | 2016-02-09 | 2019-01-04 | 巴斯夫欧洲公司 | Mixture and composition comprising bacillus genus bacterial strain or its metabolin and other biological pesticides |
| CN110072390A (en) * | 2016-12-16 | 2019-07-30 | 拜耳作物科学股份公司 | Use the method for carboxamides derivatives prevention and treatment bacterial diseases of plants |
| CN110325040A (en) * | 2017-02-28 | 2019-10-11 | 三井化学Agro株式会社 | Plant disease control composition and apply its plant disease the method for control |
| CN109315408A (en) * | 2017-07-30 | 2019-02-12 | 张萃华 | A kind of Pesticidal combination containing prothioconazoles and chlortoluron |
Non-Patent Citations (3)
| Title |
|---|
| 2012年美国生物农药专利研究与启示;吴厚斌等;《农药科学与管理》;20130715;第16-18页 * |
| Removal of prothioconazole using screened microorganisms and identification of biodegradation products via UPLC-QqTOF-MS;Yanhong Shi等;《Ecotoxicology and Environmental Safety》;20200828;第1-9页 * |
| 小麦产毒病原菌及其毒素防控的研究进展;王刘庆等;《食品安全质量检测学报》;20170925;第3396-3402页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110904011A (en) | 2020-03-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111849815B (en) | Plant growth promoting rhizosphere strain Gxun-20 and application thereof in plant growth promotion | |
| Pepi et al. | Tannic acid degradation by bacterial strains Serratia spp. and Pantoea sp. isolated from olive mill waste mixtures | |
| CN109897804B (en) | Zoebelia with nitrification and denitrification functions and application thereof | |
| CN104845920A (en) | Marine zobellella sp. and application thereof | |
| Frikha Dammak et al. | Antagonistic properties of some halophilic thermoactinomycetes isolated from superficial sediment of a solar saltern and production of cyclic antimicrobial peptides by the novel isolate Paludifilum halophilum | |
| CN101948782A (en) | Rhodopseudomonas spheroides strain and liquid inoculant thereof as well as preparation method and application thereof | |
| CN1869199A (en) | A strain denitrogen paracoccus and its culturing method and application | |
| CN111154685A (en) | Klebsiella variicola for degrading tetracycline and application thereof | |
| JP2019037192A (en) | Isolation method of genus raoultella microbe, production method of vegetable waste treatment agent and vegetable waste treatment method | |
| CN110129218B (en) | Demethylated nicotine degrading bacterium and microbial inoculum produced by same | |
| CN110904011B (en) | Prothioconazole efficient degrading bacterium W313, microbial inoculum and application | |
| Russell et al. | Demonstration of the use of Scenedesmus and Carteria biomass to drive bacterial sulfate reduction by Desulfovibrio alcoholovorans isolated from an artificial wetland | |
| CN109762755B (en) | Klebsiella pneumoniae FH-1 for degrading atrazine and soil bioremediation agent containing same | |
| CN113980852B (en) | Microbial composition for synergistic degradation of benzonitrile herbicide and microbial agent produced by same | |
| CN107828679B (en) | Rhodococcus roseus strain XHRR1 for purifying ammonia in aquaculture water and application thereof | |
| CN114703069B (en) | Epicoccus nigrum fermentation product, preparation method and application thereof | |
| CN114164140B (en) | Efficient phosphorus-dissolving bacteria MQR6 and fermentation product and application thereof | |
| CN106947697B (en) | Phomopsis fungus strain E41 and application thereof | |
| CN115820496A (en) | Cadmium-resistant rice endophytic asprella fusca and application thereof | |
| JP2002301494A (en) | Activated sludge and wastewater disposal method | |
| Emtsev et al. | Protective effect of Klebsiella bacteria on lawn grasses under conditions of soil salinization | |
| CN111662939B (en) | Method for promoting burkholderia to synthesize toxic flavine by using signal molecules | |
| CN114231448A (en) | Burkholderia contamination with indole degradation capability and application thereof | |
| CN109182216B (en) | Marine streptomyces SCFJ-05 with inhibition effect on succulent plant stem rot | |
| CN116478879B (en) | Bacterial strain for degrading diflubenzuron and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20211224 Address after: 230000 circular economy demonstration park in Hefei, Anhui Province Patentee after: ANHUI JIUYI AGRICULTURE Co.,Ltd. Address before: Anhui Agricultural University, 130 Changjiang West Road, Shushan District, Hefei City, Anhui Province 230000 Patentee before: Anhui Agricultural University |