CN110903390B - Anti-procalcitonin nano antibody and application thereof - Google Patents

Abstract

The invention discloses an anti-procalcitonin nano antibody, which has unique 3 complementarity determining regions CDR1, CDR2 and CDR3, and also provides an expression vector containing the coding sequence of the variable region of the nano antibody, a host cell containing the expression vector, a fusion protein of the nano antibody and alkaline phosphatase, and application of the nano antibody in preparing a procalcitonin detection kit. The anti-procalcitonin nano antibody provided by the invention has specific recognition and binding capacity on procalcitonin, the affinity with antigen can reach 7.429E-9, and an excellent detection effect is obtained in procalcitonin detection, particularly in the application of a double-antibody sandwich method.

Description

Anti-procalcitonin nano antibody and application thereof

Technical Field

The invention discloses a nano antibody, and belongs to the technical field of polypeptides.

Background

Procalcitonin (PCT) is a hormone-inactive calcitonin propeptide material consisting of a calcitonin, an N-terminal residue fragment and having a relative molecular weight of 13 KDa. Calcitonin is only produced when thyroid C cells are stimulated by hormones, whereas PCT can be secreted by different cell types of many organs after being stimulated by pro-inflammatory responses, particularly by bacteria.

PCT can be an important marker that specifically distinguishes between bacterial infections and inflammatory responses due to other causes, and its levels in plasma are elevated when severe bacterial, fungal, parasitic infections, as well as sepsis and multi-organ failure. Clinical data show that when the concentration of PCT is more than 0.1ng/ml, clinically relevant bacterial infection exists, and antibiotics are required to be used for treatment; when PCT concentrations are greater than 0.5ng/ml, the risk that the patient may develop severe sepsis or septic shock is considered. PCT reflects the activity of the systemic inflammatory response. Factors that influence PCT levels include the size and type of the organ being infected, the type of bacteria, the degree of inflammation and the status of the immune response. The change of the PCT concentration in a case is detected, thereby being beneficial to judging the bacterial infection condition of an organism and judging the health condition of the organism and having important significance for clinical and basic researches.

Since the last 80 s, the immunological detection technology has rapidly developed with the maturity of monoclonal antibodies, artificially synthesized polypeptides, genetically engineered expressed antigens and various labeling technologies, and conventional immunoprecipitation and immunoagglutination are gradually replaced by immunoturbidimetry, rate-scattering turbidimetry, latex-enhanced transmission turbidimetry and chemiluminescence analysis technology, so that the detection is faster. At present, there are many methods for detecting PCT, and the PCT can be not only qualitative but also quantitative. The following methods are commonly used:

1. radioimmunoassay: the method utilizes the polyclonal antibody which is artificially synthesized to specifically recognize and connect to synthesize the amino acid procalcitonin. The method can detect the serum PCT of normal people with the sensitivity of 4pm/ml, and detect the mixture of free PCT, bound PCT and calcitonin gene-related peptide precursor, but can not distinguish the three substances. And the detection of the method takes 19-22h and has the risk of radioactive element pollution.

2. A colloidal gold colorimetric method: the method utilizes colloidal gold labeled anti-PCT monoclonal antibodies and anti-PCT polyclonal antibodies for coating. When serum or plasma is added to the sample wells, the gold-labeled monoclonal antibodies bind to PCT in the sample, forming gold-labeled antigen-antibody complexes. The complex migrates on the reaction membrane and binds to the anti-PCT antibody immobilized on the membrane to form a larger complex. When the concentration of PCT exceeds 0.5ng/ml, the composite shows red, the shade of red is proportional to the concentration of PCT, and the concentration range of PCT can be obtained by comparing with a standard colorimetric plate. However, this method is prone to large errors in the color contrast process.

3. Transmission immunoturbidimetry: the principle of the method is that PCT in a sample and PCT monoclonal antibody in a reagent generate antigen-antibody reaction to increase the turbidity of reaction liquid, the turbidity of the reaction liquid and the amount of the added antigen are in a linear relation in a certain range, and a biochemical analyzer or other optical detection instruments are used for measuring the absorbance value of the reaction liquid at the 600nm wavelength. The absorbance value measured is directly proportional to the concentration of PCT detected. Although the method is simple and rapid, the methodology and clinical application of immunoturbidimetry still need further verification.

4. Double antibody sandwich immunochemiluminescence: the method employs a double monoclonal antibody, one of which is a calcitonin antibody and the other of which is an anti-calcin antibody, which bind to the calcitonin and anti-calcin sites of the PCT molecule, respectively, to preclude cross-reactivity. One of the antibodies is light-labeled, the other is unlabeled and fixed on the inner wall of the reaction vessel, the two antibodies are combined with PCT molecules to form a sandwich complex in the reaction process, and the light-emitting part is positioned on the surface of the reaction vessel. The method has the advantages of simple operation, strong specificity and high sensitivity, the measured bottom limit value can reach 0.1ng/ml, and the time is taken for 2 hours.

Based on the outstanding characteristics of PCT in clinical diagnosis, the development of specific binding antibodies against PCT, and increasing the detection range while ensuring sensitivity, is an urgent need in the art.

In 1993, Hamers-Casterman et al found that a class of heavy chain-only dimers (H) was found in camelids (camels, dromedary and llamas) in vivo₂) Antibodies of the type IgG2 and IgG3, which are predominantly of the IgG2 and IgG3, are also referred to as single domain antibodies or single domain antibodies (sdabs) because they lack a light chain and are thus referred to as Heavy chain-only antibodies (HCAbs), whereas their antigen binding site consists of one domain, referred to as a VHH region. Since this type of antibody is a variable region sequence after removal of a constant region, the molecular weight is only 15kD, and the diameter is about 10 nm, and thus it is also called nanobody (Nbs). In addition, such single domain antibodies, called VNARs, are also observed in sharks. This heavy chain-only antibody was originally only madeIs recognized as a pathological form of human B-cell proliferative disease (heavy chain disease). This heavy chain-only antibody may be due to genomic level mutations and deletions that result in the inability of the heavy chain CH1 domain to be expressed, such that the expressed heavy chain lacks CH1 and thus lacks the ability to bind to the light chain, thus forming a heavy chain dimer.

Nanobodies are comparable in affinity to their corresponding scFv, but surpass scfvs in solubility, stability, resistance to aggregation, refolding, expression yield, and ease of DNA manipulation, library construction, and 3-D structure determination, relative to scfvs of conventional four-chain antibodies.

Nanobodies have minimal functional antigen-binding fragments derived from HCabs in adult camelids, have high stability and high avidity for antigen binding, and can interact with protein clefts and enzymatic active sites, making their action similar to inhibitors. Therefore, the nano-antibody can provide a new idea for designing small molecule enzyme inhibitors from peptide-mimetic drugs. Due to the heavy chain only, nanobodies are easier to manufacture than monoclonal antibodies. The unique properties of nanobodies, such as stability in extreme temperature and pH environments, allow for large yields to be produced at low cost. Therefore, the nano antibody has great value and development prospect in the treatment and diagnosis of diseases.

In view of that PCT is more over-expressed in some serious bacterial, fungal and parasitic infections, sepsis, multi-organ failure and other diseases, the development of the nano antibody for resisting PCT fully exerts the super-strong antigen recognition capability of the nano antibody, and particularly recognizes some antigenic determinants hidden in fissures or cavities to form a new requirement in the technical field of antibodies. However, the existence of some structural and functional defects such as low affinity, easy aggregation, short serum half-life, etc. due to the low molecular weight of the nanobody prevents the further application of the nanobody. In the specific application of PCT immunoassay, if the anti-PCT antibody recognizes PCT epitope singly or with sites close to or overlapping, the specific antigen-antibody binding reaction is affected, thereby seriously affecting the detection efficiency. The invention aims to provide an anti-PCT nano antibody which can fully exert the excellent performance of the nano antibody and overcome the inherent defects of the nano antibody, namely, the antibody has a unique epitope recognition site, can recognize and combine antigens with high specificity and can obtain excellent detection efficiency in the immunoassay of the PCT antigens, particularly in a double-antibody sandwich method.

Disclosure of Invention

Based on the above objects, the present invention provides a procalcitonin-resistant nanobody, wherein the variable region of the nanobody has 3 complementarity determining regions CDR1, CDR2 and CDR3, wherein the sequence of CDR1 region consists of the amino acid sequence shown in SEQ ID No.1, the sequence of CDR2 region consists of the amino acid sequence shown in SEQ ID No.2, and the sequence of CDR3 region consists of the amino acid sequence shown in SEQ ID No. 3. The antibodies have unique epitope recognition sites.

In a preferred technical scheme, the variable region sequence of the nanobody consists of the amino acid sequence shown in SEQ ID NO. 4. One preferred example of a nanobody having such a variable region sequence in the present invention is nanobody 1B 10.

The invention further provides a fusion protein containing the nano antibody and human placental alkaline phosphatase, and the fusion protein is formed by connecting the nano antibody and a human placental alkaline phosphatase reporter gene protein in series.

Thirdly, the invention also provides a polynucleotide molecule for coding the nano antibody sequence, and the sequence of the polynucleotide molecule is shown by SEQ ID NO. 5.

Fourthly, the invention provides an expression vector containing the polynucleotide molecule, wherein the vector is pMES 4.

Fifth, the present invention provides a host cell comprising the above expression vector, said cell being E.coli BL21(DE 3).

Sixth, the invention also provides application of the nano antibody in preparation of a procalcitonin detection kit.

Seventhly, the invention provides a procalcitonin immunodetection method based on a non-diagnostic purpose, the method is a double-antibody sandwich enzyme-linked immunoassay, the variable region sequence of the first antibody is shown as the amino acid sequence of SEQ ID NO.6 or SEQ ID NO.9, the second antibody is an enzyme-linked second antibody, and the variable region sequence of the second antibody is shown as the amino acid sequence of SEQ ID NO. 4.

In a preferred embodiment, the enzyme-linked second antibody is a fusion protein of a procalcitonin-resistant nanobody and alkaline phosphatase.

Finally, the invention also provides an immunoassay kit for detecting procalcitonin by using a double-antibody sandwich method, which comprises a first antibody for capturing an antigen and a second antibody for binding with the antigen to trigger an enzyme-linked reaction, wherein the variable region sequence of the first antibody is shown as SEQ ID No.6 or SEQ ID No.9, the second antibody is a fusion protein of a nano antibody for resisting procalcitonin and alkaline phosphatase, and the sequence of the fusion protein is shown as SEQ ID No. 8.

The anti-PCT nano antibody 1B10 provided by the invention has unique antigenic determinant recognition sites, has specific recognition and binding capacity to PCT antigens, has affinity with the antigens up to 7.429E-9, recognizes different antigenic determinants compared with several anti-PCT nano antibodies, can be combined with other nano antibodies to be applied to a double-antibody sandwich enzyme-linked immunosorbent assay to detect procalcitonin, and in a preferred embodiment, the nano antibody 1B10 is respectively combined with two strains of nano antibodies BF5 and 2H4 to be used, so that an excellent detection effect is shown.

Drawings

FIG. 1 shows the electrophoretic identification of total RNA extracted;

FIG. 2 shows the first round of PCR amplification of antibody variable region gene electrophoresis identification map;

FIG. 3 is the second round of PCR amplification of antibody variable region gene electrophoresis identification map;

FIG. 4 is a schematic diagram of the structure of the pMES4 expression vector;

FIG. 5 shows the electrophoretic identification chart of the product of the double digestion reaction with pMES4 vector;

FIG. 6 shows the electrophoretic identification chart of the transformant identified by colony PCR;

FIG. 7 is a SDS-PAGE pattern of nanobody purification;

FIG. 8 is a flow chart of Biacore analysis of nanobody binding sites.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are only illustrative and do not limit the scope of the present invention.

Example 1 preparation of anti-PCT Nanobody

1.1 construction and screening of anti-PCT Nanobody phage display library

1.1.1 immunization of alpaca: selecting one healthy adult alpaca, uniformly mixing the human recombinant PCT antigen and Freund's adjuvant according to the proportion of 1:1, immunizing the alpaca by adopting a back subcutaneous multipoint injection mode according to 6-7 mu g/Kg for four times, wherein the immunization interval is 2 weeks. And collecting alpaca peripheral blood for constructing a phage display library.

1.1.2 isolation of Camel-derived lymphocytes: lymphocytes were analyzed from collected camel-derived anticoagulated whole blood according to routine procedures in the art, every 2.5X 10⁷1mL of RNA isolation reagent was added to each living cell, 1mL of the reagent was extracted with RNA, and the remaining cells were stored at-80 ℃.

1.1.3 Total RNA extraction: total RNA was extracted according to a routine procedure in the art, and the concentration was adjusted to 1. mu.g/. mu.L with RNase-free water (see FIG. 1).

1.1.4 Synthesis of cDNA by reverse transcription: the cDNA was reverse-transcribed using the RNA obtained in step 1.1.3 as a template according to the reverse transcription KIT (Transcriptor first stand cDNA Synthesis KIT from Roche).

1.1.5 antibody variable region Gene amplification: and carrying out PCR reaction by using cDNA obtained by reverse transcription as a template. Amplification was performed in two rounds, and the primer sequences for the first round of PCR were as follows:

CALL001：GTCCTGGCTGCTCTTCTACAAGG

CALL002：GGTACGTGCTGTTGAACTGTTCC

the PCR reaction conditions and procedures were: 5 minutes at 95 ℃; 30 cycles of 95 ℃ for 30 seconds, 57 ℃ for 30 seconds, 72 ℃ for 30 seconds; 7 minutes at 72 ℃. The band of about 700bp was recovered using an agarose gel recovery kit gel, and the nucleic acid concentration was finally adjusted to 5 ng/. mu.l with water (FIG. 2: M is Trans 2K DNA Marker; 1 is first round PCR product). The primer sequences for the second round of PCR were as follows:

VHH-Back：GATGTGCAGCTGCAGGAGTCTGGRGGAGG

VHH-For：CTAGTGCGGCCGCTGGAGACGGTGACCTGGGT

the PCR reaction conditions and procedures were: 5 minutes at 95 ℃; 30 seconds at 95 ℃, 30 seconds at 55 ℃, 30 seconds at 72 ℃ and 15 cycles; 7 minutes at 72 ℃. PCR products were purified using a PCR product recovery kit (FIG. 3: M is Marker; 1 is second round PCR product).

1.1.6 vector construction: pMES4 (purchased from Biovector, whose schematic structure is shown in FIG. 4) was double digested with PstI and BstEII, respectively, to obtain 1.5. mu.g of the digested vector and 450ng of the digested second PCR product, 15. mu. L T4 of DNA ligase was added, buffer and water were supplemented to a total volume of 150. mu.L, ligation was performed overnight at 16 ℃ and the ligation product was recovered. Product recovery was performed using a PCR product recovery kit, eluting with 20. mu.L water. The double restriction of the pMES4 vector was detected on a 1% agarose electrophoresis gel (FIG. 5: M is Trans 2K Plus DNA Marker; 1 is the product of double restriction of the pMES4 vector; and 2 is the plasmid of non-restriction of the pMES4 vector).

1.1.7 electrotransformation and storage capacity determination: mu.L of the purified ligation product was taken, added to a pre-cooled electric cuvette containing 50. mu.L of E.coli TG1 competent cells, and placed in an electric converter (ECM 630 electric converter of BTX, USA) for electric conversion, and the electric cuvette was taken out, and the transformant was recovered and cultured. 18 clones were randomly selected and subjected to colony PCR identification (FIG. 6: M is Marker; 1-22 are randomly selected monoclonal PCR identification products). The pool capacity (pool capacity ═ number of clones × dilution × positive rate of PCR identification × 10) was estimated from the PCR positive rate. The primer sequences are as follows:

MP57：TTATGCTTCCGGCTCGTATG

GIII：CCACAGACAGCCCTCATAG

1.1.8 phage amplification: inoculating recovered bacteria solution into YT-AG culture medium, culturing at 37 deg.C and 200rpm until culture OD₆₀₀0.5. 10ml of the bacterial suspension was taken out and added to 4X 10¹⁰VCSM13, 30min at 37 ℃ for static infection. At 4000rpm, the mixture was centrifuged at room temperature for 10 minutes, and the supernatant was removed. With 2 XYT-AK (ampicillin-containing penicillin)And kanamycin) medium was resuspended in the cells, and cultured overnight at 37 ℃ at 200 rpm. Centrifuging, taking a supernatant in a 40ml tube, adding 10ml of PEG/NaCl (20%/2.5M) solution, mixing thoroughly, centrifuging, discarding the supernatant, washing the precipitate with 1ml of ice PBS, centrifuging, taking 250 μ l of precooled PEG/NaCl from the supernatant, mixing thoroughly, washing and resuspending.

Determining the phage titer: TG1 was cultured to OD₆₀₀When the phage was diluted with LB medium in a gradient manner at 0.4, the phage TG1 culture was mixed and cultured in a double dilution manner, and the plaque formation in the plate was observed the next day, and the number of plaques was counted on a dilution gradient plate of 30 to 300 and the phage titer (pfu) was calculated according to the following equation.

Phage titer (pfu/ml) dilution times plaque number times 100

1.1.9 nanometer antibody screening: positive clones were screened for PCT antigen by ELISA. ELISA plates were coated with PCT antigen, blocked with 5% BSA, and washed with PBST. Mu.l phage supernatant was added to each well and left at 37 ℃ for 1 hour. The supernatant was discarded, and a secondary HRP-labeled mouse anti-M13 antibody was added thereto and the mixture was left at 37 ℃ for 1 hour. The supernatant was discarded, TMB solution was added, incubation was carried out at room temperature for 5 hours, 2M sulfuric acid stop solution was added to each well, and reading was carried out with a microplate reader at 450 nm.

1.1.10 expression and purification of Nanobody in Escherichia coli: selecting a clone with a positive phage ELSIA result, extracting a plasmid, transforming the plasmid into a strain BL21(DE3) competent cell, inducing protein expression of the nano antibody by IPTG, collecting supernatant (periplasmic extract), dialyzing the periplasmic extract into PBS, purifying by using Ni-NTA resin, eluting and collecting by using imidazole with different concentrations, carrying out reduced protein electrophoresis analysis on the collected sample, and finally dialyzing the nano antibody into the PBS.

3 strains of anti-PCT nano antibodies are screened out through alpaca immunity, cell separation, construction of a phage library and screening of the nano antibodies. The sequencing results were analyzed using Vector NTI software, and the entries IMGT (see Table II)http:// www.imgt.org/IMGT_vquest) Antibody light and heavy chain genes were analyzed to determine the Framework Regions (FR) and Complementarity Determining Regions (CDR) of the variable Regions.

The heavy chain nucleotide sequence of the nano antibody 1B10 is shown as SEQ ID NO.5, the variable region amino acid sequence is shown as SEQ ID NO.4, wherein the 1 st-20 th amino acid sequence is FR1, the 21 st-28 th amino acid sequence is CDR1, the 29 th-45 th amino acid sequence is FR2, the 46 th-53 th amino acid sequence is CDR2, the 54 th-91 th amino acid sequence is FR3, the 92 th-99 th amino acid sequence is CDR3, and the 100 th-plus 110 th amino acid sequence is FR 4.

The amino acid sequence of the variable region of the nano antibody 2H4 is shown in SEQ ID NO. 6.

The amino acid sequence of the variable region of the nano antibody BF5 is shown as SEQ ID NO. 9.

Example 2 preparation of anti-PCT Nanobody 1B10

2.1 amplification of original strain TG1 of nano antibody and transformation of Escherichia coli BL by recombinant plasmid of nano antibody₂₁(DE₃)

Performing a reaction on an original strain TG1 glycerol strain containing nano antibody nucleic acid according to the ratio of 1: the culture was inoculated at 1000 ratio to 5mL of fresh LB-A medium and cultured overnight at 37 ℃ and 200 rpm. The following day, Plasmid was extracted using a Plasmid mini kit (OMEGA) as per the instructions. After verification, 1. mu.l of the plasmid was transformed into 100. mu.l of competent cells, gently mixed, placed on ice for 30 minutes, heat-shocked in a water bath at 42 ℃ for 90 seconds, and cooled in an ice bath for 3 minutes. 600. mu.l of LB medium was added to the centrifuge tube, and the tube was cultured with shaking at 37 ℃ for 60 minutes. 100. mu.l of the supernatant was applied to an LB-A plate using a triangle spreader and cultured overnight at 37 ℃ in an inverted state.

2.2 inducible expression of Nanobodies

The above monoclonal colonies were picked up in LB-A medium and cultured overnight with shaking at 37 ℃. The next day, the bacterial liquid was taken according to the ratio of 1: adding 100ml of fresh LB-A culture medium in a proportion of 100, and performing shaking culture at 37 ℃ for 3h until the bacterial liquid OD₆₀₀After adding IPTG to a final concentration of 1mM, the mixture was induced overnight at 30 ℃. On the third day, 8000rpm, centrifugation for 10min collected the thalli, and 1.5mL of precooled TES buffer was added to resuspend the pellet. After 2min in ice bath, gently shake for 30 sec, repeat this cycle 6 times. 3.0ml TES/4 (TES diluted 4 times with water) was added, gently shaken for 30 seconds, and then allowed to stand on an ice bath for 2min, and the shaking and standing steps were repeated a total of 6 times. Centrifugation was carried out at 9000rpm and 4 ℃ for 10min, and about 4.5mL of the supernatant was collected (week)A biomass extract).

2.3 purification and characterization of Nanobodies

After resuspending IMAC Sepharose (GE Co.), 2ml was added to the gravity column, and the column was allowed to stand for 30 minutes to allow Sepharose to naturally settle at the bottom of the gravity column, and the preservation buffer was discharged. Adding 2 column volumes of nickel sulfate solution (0.1M) and flowing out the nickel sulfate solution at a flow rate of about 8 seconds per drop; adding 10 times of column volume of balance buffer solution to balance and wash sepharose, and keeping the flow rate unchanged; diluting the sample by 2 times of a balance buffer solution, adding the diluted sample into a gravity column, adjusting the flow rate to be 6 seconds/drop, and collecting the penetration liquid; adding 10 times of column volume of washing buffer solution to wash sepharose, maintaining the flow rate unchanged, and collecting washing solution; adding elution buffer solution with the volume being 3 times of that of the column, maintaining the flow rate at 6 seconds per drop, and collecting the eluent containing the target protein; finally sepharose was washed by sequentially adding 10 column volumes of equilibration buffer, 10 column volumes of pure water and 10 column volumes of 20% ethanol, and finally 4ml of 20% ethanol was retained to preserve the column. The collected samples are respectively subjected to SDS-PAGE detection (figure 7: M is a rainbow 180 broad-spectrum protein Marker; 1 is a nano antibody 1B10 after escherichia coli induced expression and purification).

Example 3 determination of affinity Activity of anti-PCT Nanobodies with antigens

3.1 chip antigen coupling

PCT antigen is prepared into working solution of 20 mu g/mL by using sodium acetate buffer solutions (pH 5.5, pH 5.0, pH 4.5 and pH 4.0) with different pH values, simultaneously 50mM NaOH regeneration solution is prepared, the electrostatic binding between the antigen and the surface of a chip (GE company) under different pH conditions is analyzed by using a template method in a Biacore T100 protein interaction analysis system instrument, an appropriate pH system with the most neutral pH value is selected according to the standard that the signal increase amount reaches 5 times RL, and the antigen concentration is adjusted according to requirements as the condition during coupling. Coupling the chip according to a template method carried by the instrument: wherein, the 1 channel selects a blank coupling mode, the 2 channel selects a Target coupling mode, and the Target is set as a designed theoretical coupling quantity. The coupling procedure took approximately 60 minutes.

3.2 analyte concentration setting Condition exploration and regeneration Condition optimization

A manual sample injection mode is adopted, a1, 2-channel 2-1 mode is selected for sample injection, and the flow rate is set to be 30 mu L/min. The injection conditions were 120 seconds and 30. mu.L/min. Regeneration conditions were 30 seconds, 30. mu.L/min. The buffer was run continuously empty first until all baselines were stable. The nanobody solution with larger concentration span is prepared to be configured with the running buffer, and 200. mu.g/mL, 150. mu.g/mL, 100. mu.g/mL, 50. mu.g/mL, 20. mu.g/mL, 10. mu.g/mL and 2. mu.g/mL are suggested to be set. Preparing a regeneration solution, selecting the regeneration solution with four pH gradients of a glutamate acid system: 1.5,2.0,2.5,3.0. A200. mu.g/mL sample of analyte was manually injected and the 2-channel was observed, regenerating from the most neutral pH regeneration buffer until the line of response after 2-channel regeneration returned to the same height as the baseline. And manually injecting a sample of 200 mu g/mL of analyte once again, observing the signal change of the 2-1 channel and recording the binding capacity, regenerating by using a regeneration solution which finally returns the response line to the base line in the previous step, then manually injecting a sample of 200 mu g/mL of analyte once again, observing the signal change of the 2-1 channel and recording the binding capacity, comparing with the value of the previous binding capacity, if the deviation is less than 5 percent, determining that the regeneration solution with the pH value is the optimal regeneration solution, and if the binding capacity of re-injection is lower, continuing to perform the experiment by using a regeneration buffer solution with lower pH value. And taking the selected optimal regeneration solution as a chip surface regeneration reagent after each sample introduction. And respectively injecting analyte concentration samples arranged on the sample injection device, and analyzing the binding capacity of each concentration to finally determine the concentration gradient required by the affinity test.

3.3 affinity assay

According to the optimized sample concentration gradient, the solution is regenerated, and the affinity between the nano antibody and the antigen is tested by using a template method carried by the instrument (wherein the sample introduction condition is set to be 60s and 30 mu L/min; the dissociation time is 600s, and the regeneration condition is set to be 30s and 30 mu L/min). The signal condition of the 2-1 channel is observed at any time. The affinity testing process takes approximately 200 min.

3.4 analysis of results

The binding dissociation curves for several concentration gradients were selected using a 1: and fitting all curves by using a 1binding mode to finally obtain important parameters such as affinity values, binding constants, dissociation constants and the like. The affinity value of anti-PCT nanobody 1B10 was 7.429E-9.

Table 1: nanobody affinity data

Sample numbering	Binding constant	Dissociation constant	Affinity of
				VHH-1B10	3.746E+4	2.783E-4	7.429E-9
VHH-BF5	7.384E+4	3.177E-4	4.302E-9
				VHH-2H4	2.736E+4	6.461E-4	2.361E-8

Example 4 ELISA overlay data analysis of anti-PCT Nanobodies

4.1 determination of the saturation concentration of antigen

PCT antigen was coated at a concentration of 2. mu.g/ml, 100. mu.l/well, coated at 4 ℃ for 24h, and washed 5 times. Blocking was performed overnight with 1% BSA as blocking agent and the plate was washed 5 times. Adding different gradient diluted nanometer antibodies into the ELISA plate, performing negative control (negative serum 1:100) and PBS blank control, incubating for 30min at 37 ℃, and washing the plate for 5 times. Adding 1: the goat anti-alpaca IgG labeled with HRP diluted at the ratio of 4000 was incubated at 37 ℃ for 30min, and the plate was washed 5 times. Adding TMB developing solution, incubating at 37 ℃ for 10min, and stopping reaction by 2M sulfuric acid. Reading the light absorption value of 450nm, drawing an antibody saturation curve, and selecting the concentration which does not increase with the increase of the concentration as the saturation concentration according to the result.

4.2 site overlay experiments

The first antibody is added for reaction, the second antibody is added after the plate is washed, the enzyme-labeled secondary antibody is added after the plate is washed, and the color reading of TMB is carried out (the method is the same as 4.1). And calculating the overlapping rate AI of the two antibodies, wherein the AI is more than 50 percent, which indicates that the antigenic sites of the 2 antibodies to be detected are different, the AI is less than 50 percent, which indicates that the antigenic epitopes of the two antibodies to be detected are the same, and the larger the AI value is, the lower the possibility of site overlapping is. The formula is as follows: AI [2 a (1+2) - (a1+ a2) ]/a (1+2) × 100%

A1-first Strain antibody reading

A2-second Strain antibody reading

A (1+2) -overlay of 2 antibody readings

Table 2: antibody epitope superposition experiment

	1st antibody	2nd antibody	1st antibody +2nd antibody	Overlap ratio
					1B10+2H4	0.275	0.417	0.752	107.98％
1B10+BF5	0.275	0.538	0.635	71.97％
					2H4+BF5	0.204	0.634	0.693	79.08％

The experimental results are shown in table 2, and the two strains of nano antibodies, namely 1B10, BF5 and 2H4, respectively aim at different epitopes of the PCT antigen, which indicates that the probability of forming a detection antibody pair by the three strains of nano antibodies is greatly increased in the detection application of the PCT, so that the detection efficiency can be increased.

Example 5 analysis of Nanobody 1B10 binding sites Using Biacore

The principal principle of the Biacore system is that SPR (refractive index) shifts by changes in the concentration of surface molecules, which appear on the monitor as changes in RU. Due to the higher sensitivity of the system, we designed relevant experiments to verify the ELISA-superimposed experimental results. As shown in fig. 8, first repeating 2 needles of the first nanobody a, observing changes in RU values to confirm saturation of the corresponding antigen binding site and recording; then, a second nanobody B was entered, and RU values were observed and recorded: if the RU value is not more than 20% different from that of the single nano antibody B, the two can be considered to recognize different antigenic determinants; if the difference is more than 20% but less than 60%, the two are considered to have steric hindrance; if it isThe difference value is more than 60%, and the two are judged to recognize the same antigen. The specific operation is that firstly, the increased value R of RU is recorded by the antibody B which is injected only_B1And regenerating the chip; antibody A was then repeated twice and RU increase value R was recorded_AAnd after confirming saturation, directly injecting an antibody B, and observing the increase R of RU value_B2(ii) a Then using the formula (R)_B2-R_A)/R_B1The steric hindrance is calculated to determine whether both recognize the same epitope. The results of this example are shown in Table 3. The steric hindrance rates of the 1B10 nano antibody and the BF5 and 2H4 nano antibodies are respectively 9.47% and 6.74%. And sequentially judging that the 1B10 and the other two strains of nano antibodies recognize different antigen sites, wherein the result is consistent with the result presumed by an ELISA superposition experiment. The application prospect of the anti-PCT nano antibody 1B10 in the field of PCT detection is further verified.

Table 3: RU value change table for Biacore detection nano antibody superposition experiment

Example 61B 10-HAP use in detecting PCT content in Standard serum

The amino acid sequence of the binding site sequence of human alkaline phosphatase as the chemical light emitting region is shown as SEQ ID NO. 7. Passing it through a flexible polypeptide (GGGGS)₃The nano antibody 1B10-HAP is fused with the nano antibody 1B10 to form the nano antibody 1B10-HAP with a chemical light-emitting region sequence, and the amino acid sequence of the nano antibody is shown as SEQ ID NO. 8. Two restriction sites HindIII and EcoRI were added to the two ends of the nucleotide coding sequence and ligated to the vector pcDNA3.1 (+). After endotoxin-free large-scale plasmid extraction, 293 cells in logarithmic growth were used for transfection. After the transfected cells are cultured for 36h, the cell culture solution is poured into a 50ml centrifuge tube, 12000g is centrifuged for 5min, the supernatant is collected, filtered by a 0.22um filter membrane, and the culture supernatant is purified by anion exchange chromatography. The affinity test of 1B10-HAP was carried out in the same manner as in example 3, and the affinity value of 1B10-HAP was 3.785E-9. The results of the screening and matching are shown in Table 4. Selecting FC fusion nanoThe antibody 2H4 or BF5 is a capture primary antibody, the sequence of the variable region of the capture primary antibody is shown as the amino acid sequence of SEQ ID NO.6 or SEQ ID NO.9, 1B10-HAP is an enzyme-labeled secondary antibody to detect the PCT antigen in a serum sample by a double-antibody sandwich immunoassay method, and the excellent detection effect is obtained, and the specific process is as follows:

diluting the capture antibody to a final concentration of 10 μ g/ml using sterile CBS; adding 100 mul of the enzyme-linked immunosorbent assay (ELISA) plate into each hole, and standing for 18h at 4 ℃; discarding the supernatant, adding 300 μ L of washing solution into each well, shaking horizontally for 3min, and absorbing and discarding the supernatant; the plate was washed four times. Mu.l of 1% BSA was added to each well and allowed to stand at 37 ℃ for 1 hour. Washing the plate for four times; adding 50 mu L of positive control, negative control or sample to be detected into each hole; adding 50 mu L of freshly diluted enzyme-labeled secondary antibody (namely nano antibody 1B 10-HAP) into each hole, diluting to the working concentration of 2 mu g/ml, and placing on a shaking table to shake for 3-5 s; incubate at 37 ℃ for 1 h. Washing the plate for four times; adding 100 mu L of AP Chemiluminescence color development liquid (BM Chemiluminescence ELISA Substrate) into each hole, and shaking on a shaking table for 3-5 s; incubating for 10min at room temperature in dark; the microplate reader program Luminescence was selected, the Lum value of each well was determined and PCT values of the quality control sera were calculated. Results 1B10 exhibited the best pairing results with the 2H4 nanobody pair, R²＝0.9932。

TABLE 4 Linear index results of PCT content curve in serum by pairing nano antibody 1B10-HAP with BF5 and 2H4

Capture antibody	Detection of antibodies	Linear index (R)2)	Sensitivity (ng/ml)	Number of missed detections
					BF5	1B10-HAP	0.9856	0.1	2
2H4	1B10-HAP	0.9932	0.01	0

Sequence listing

<110> Shenzhen Shang Nanobody technology Limited

<120> nano antibody for resisting PCT antigen and application thereof

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 8

<212> PRT

<213> Lama pacos

<400> 1

Gly Phe Thr Leu Ser Trp Tyr Pro

1 5

<210> 2

<211> 8

<212> PRT

<213> Lama pacos

<400> 2

Ile Ser Ser Ile Gly Gly Arg Thr

1 5

<210> 3

<211> 8

<212> PRT

<213> Lama pacos

<400> 3

Asn Ile Ile Pro Glu Ser Gln Asn

1 5

<210> 4

<211> 110

<212> PRT

<213> Lama pacos

<400> 4

Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser

1 5 10 15

Cys Ala Ala Ser Gly Phe Thr Leu Ser Trp Tyr Pro Met Ile Trp Phe

20 25 30

Arg Gln Ser Pro Gly Asn Glu Arg Glu Phe Val Ala Arg Ile Ser Ser

35 40 45

Ile Gly Gly Arg Thr Met Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr

50 55 60

Ile Ser Arg Asp Asn Gly Lys Asn Thr Val Tyr Leu Gln Met Ser Ser

65 70 75 80

Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn Ile Ile Pro Glu

85 90 95

Ser Gln Asn Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

100 105 110

<210> 5

<211> 330

<212> DNA

<213> Lama pacos

<400> 5

gagtctgggg gaggcttggt gcagcctggg gggtctctga gactctcctg tgcagcctct 60

ggattcaccc tcagttggta tcccatgatt tggttccgcc agtctccagg gaacgagcgc 120

gagttcgtcg cacgtatcag tagtattggt ggtcgcacca tgtatgcaga ctccgtgaag 180

ggtcgattca ccatctccag agacaatggc aagaacacgg tttacctgca aatgagcagc 240

ctgaaacctg aggacacggc cgtgtattat tgtaatataa ttccggagtc tcagaactgg 300

ggccagggga cccaggtcac cgtctcctca 330

<210> 6

<211> 118

<212> PRT

<213> Lama pacos

<400> 6

Glu Ser Gly Gly Gly Leu Leu Gln Pro Gly Gly Ser Leu Arg Leu Ser

1 5 10 15

Cys Ala Ala Ser Gly Ser Gly Phe Ser Thr Tyr Asp Met Ala Trp Tyr

20 25 30

Arg Gln Pro Pro Gly Lys Gln Arg Glu Ser Val Ala Val Ile Thr Thr

35 40 45

Gly Gly Gly Thr Ser Tyr Ala Asn Ser Val Lys Gly Arg Phe Thr Ile

50 55 60

Ser Arg Asp Asn Ala Thr Asn Thr Met Trp Leu Gln Met Asp Ser Leu

65 70 75 80

Arg Pro Glu Asp Thr Ala Val Tyr Trp Cys Ala Gln Thr Lys Ala Gly

85 90 95

Arg Ala Thr Pro Lys Glu Asp Asp Tyr Gly Val Trp Gly Gln Gly Thr

100 105 110

Gln Val Thr Val Ser Ser

115

<210> 7

<211> 484

<212> PRT

<213> Homo sapiens

<400> 7

Ile Ile Pro Val Glu Glu Glu Asn Pro Asp Phe Trp Asn Arg Glu Ala

1 5 10 15

Ala Glu Ala Leu Gly Ala Ala Lys Lys Leu Gln Pro Ala Gln Thr Ala

20 25 30

Ala Lys Asn Leu Ile Ile Phe Leu Gly Asp Gly Met Gly Val Ser Thr

35 40 45

Val Thr Ala Ala Arg Ile Leu Lys Gly Gln Lys Lys Asp Lys Leu Gly

50 55 60

Pro Glu Ile Pro Leu Ala Met Asp Arg Phe Pro Tyr Val Ala Leu Ser

65 70 75 80

Lys Thr Tyr Asn Val Asp Lys His Val Pro Asp Ser Gly Ala Thr Ala

85 90 95

Thr Ala Tyr Leu Cys Gly Val Lys Gly Asn Phe Gln Thr Ile Gly Leu

100 105 110

Ser Ala Ala Ala Arg Phe Asn Gln Cys Asn Thr Thr Arg Gly Asn Glu

115 120 125

Val Ile Ser Val Met Asn Arg Ala Lys Lys Ala Gly Lys Ser Val Gly

130 135 140

Val Val Thr Thr Thr Arg Val Gln His Ala Ser Pro Ala Gly Thr Tyr

145 150 155 160

Ala His Thr Val Asn Arg Asn Trp Tyr Ser Asp Ala Asp Val Pro Ala

165 170 175

Ser Ala Arg Gln Glu Gly Cys Gln Asp Ile Ala Thr Gln Leu Ile Ser

180 185 190

Asn Met Asp Ile Asp Val Ile Leu Gly Gly Gly Arg Lys Tyr Met Phe

195 200 205

Arg Met Gly Thr Pro Asp Pro Glu Tyr Pro Asp Asp Tyr Ser Gln Gly

210 215 220

Gly Thr Arg Leu Asp Gly Lys Asn Leu Val Gln Glu Trp Leu Ala Lys

225 230 235 240

Arg Gln Gly Ala Arg Tyr Val Trp Asn Arg Thr Glu Leu Met Gln Ala

245 250 255

Ser Leu Asp Pro Ser Val Thr His Leu Met Gly Leu Phe Glu Pro Gly

260 265 270

Asp Met Lys Tyr Glu Ile His Arg Asp Ser Thr Leu Asp Pro Ser Leu

275 280 285

Met Glu Met Thr Glu Ala Ala Leu Arg Leu Leu Ser Arg Asn Pro Arg

290 295 300

Gly Phe Phe Leu Phe Val Glu Gly Gly Arg Ile Asp His Gly His His

305 310 315 320

Glu Ser Arg Ala Tyr Arg Ala Leu Thr Glu Thr Ile Met Phe Asp Asp

325 330 335

Ala Ile Glu Arg Ala Gly Gln Leu Thr Ser Glu Glu Asp Thr Leu Ser

340 345 350

Leu Val Thr Ala Asp His Ser His Val Phe Ser Phe Gly Gly Tyr Pro

355 360 365

Leu Arg Gly Ser Ser Ile Phe Gly Leu Ala Pro Gly Lys Ala Arg Asp

370 375 380

Arg Lys Ala Tyr Thr Val Leu Leu Tyr Gly Asn Gly Pro Gly Tyr Val

385 390 395 400

Leu Lys Asp Gly Ala Arg Pro Asp Val Thr Glu Ser Glu Ser Gly Ser

405 410 415

Pro Glu Tyr Arg Gln Gln Ser Ala Val Pro Leu Asp Glu Glu Thr His

420 425 430

Ala Gly Glu Asp Val Ala Val Phe Ala Arg Gly Pro Gln Ala His Leu

435 440 445

Val His Gly Val Gln Glu Gln Thr Phe Ile Ala His Val Met Ala Phe

450 455 460

Ala Ala Cys Leu Glu Pro Tyr Thr Ala Cys Asp Leu Ala Pro Pro Ala

465 470 475 480

Gly Thr Thr Asp

<210> 8

<211> 615

<212> PRT

<213> Lama pacos

<400> 8

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Ser Trp Tyr

20 25 30

Pro Met Ile Trp Phe Arg Gln Ser Pro Gly Asn Glu Arg Glu Phe Val

35 40 45

Ala Arg Ile Ser Ser Ile Gly Gly Arg Thr Met Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Gly Lys Asn Thr Val Tyr

65 70 75 80

Leu Gln Met Ser Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Asn Ile Ile Pro Glu Ser Gln Asn Trp Gly Gln Gly Thr Gln Val Thr

100 105 110

Val Ser Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

115 120 125

Gly Gly Ser Ile Ile Pro Val Glu Glu Glu Asn Pro Asp Phe Trp Asn

130 135 140

Arg Glu Ala Ala Glu Ala Leu Gly Ala Ala Lys Lys Leu Gln Pro Ala

145 150 155 160

Gln Thr Ala Ala Lys Asn Leu Ile Ile Phe Leu Gly Asp Gly Met Gly

165 170 175

Val Ser Thr Val Thr Ala Ala Arg Ile Leu Lys Gly Gln Lys Lys Asp

180 185 190

Lys Leu Gly Pro Glu Ile Pro Leu Ala Met Asp Arg Phe Pro Tyr Val

195 200 205

Ala Leu Ser Lys Thr Tyr Asn Val Asp Lys His Val Pro Asp Ser Gly

210 215 220

Ala Thr Ala Thr Ala Tyr Leu Cys Gly Val Lys Gly Asn Phe Gln Thr

225 230 235 240

Ile Gly Leu Ser Ala Ala Ala Arg Phe Asn Gln Cys Asn Thr Thr Arg

245 250 255

Gly Asn Glu Val Ile Ser Val Met Asn Arg Ala Lys Lys Ala Gly Lys

260 265 270

Ser Val Gly Val Val Thr Thr Thr Arg Val Gln His Ala Ser Pro Ala

275 280 285

Gly Thr Tyr Ala His Thr Val Asn Arg Asn Trp Tyr Ser Asp Ala Asp

290 295 300

Val Pro Ala Ser Ala Arg Gln Glu Gly Cys Gln Asp Ile Ala Thr Gln

305 310 315 320

Leu Ile Ser Asn Met Asp Ile Asp Val Ile Leu Gly Gly Gly Arg Lys

325 330 335

Tyr Met Phe Arg Met Gly Thr Pro Asp Pro Glu Tyr Pro Asp Asp Tyr

340 345 350

Ser Gln Gly Gly Thr Arg Leu Asp Gly Lys Asn Leu Val Gln Glu Trp

355 360 365

Leu Ala Lys Arg Gln Gly Ala Arg Tyr Val Trp Asn Arg Thr Glu Leu

370 375 380

Met Gln Ala Ser Leu Asp Pro Ser Val Thr His Leu Met Gly Leu Phe

385 390 395 400

Glu Pro Gly Asp Met Lys Tyr Glu Ile His Arg Asp Ser Thr Leu Asp

405 410 415

Pro Ser Leu Met Glu Met Thr Glu Ala Ala Leu Arg Leu Leu Ser Arg

420 425 430

Asn Pro Arg Gly Phe Phe Leu Phe Val Glu Gly Gly Arg Ile Asp His

435 440 445

Gly His His Glu Ser Arg Ala Tyr Arg Ala Leu Thr Glu Thr Ile Met

450 455 460

Phe Asp Asp Ala Ile Glu Arg Ala Gly Gln Leu Thr Ser Glu Glu Asp

465 470 475 480

Thr Leu Ser Leu Val Thr Ala Asp His Ser His Val Phe Ser Phe Gly

485 490 495

Gly Tyr Pro Leu Arg Gly Ser Ser Ile Phe Gly Leu Ala Pro Gly Lys

500 505 510

Ala Arg Asp Arg Lys Ala Tyr Thr Val Leu Leu Tyr Gly Asn Gly Pro

515 520 525

Gly Tyr Val Leu Lys Asp Gly Ala Arg Pro Asp Val Thr Glu Ser Glu

530 535 540

Ser Gly Ser Pro Glu Tyr Arg Gln Gln Ser Ala Val Pro Leu Asp Glu

545 550 555 560

Glu Thr His Ala Gly Glu Asp Val Ala Val Phe Ala Arg Gly Pro Gln

565 570 575

Ala His Leu Val His Gly Val Gln Glu Gln Thr Phe Ile Ala His Val

580 585 590

Met Ala Phe Ala Ala Cys Leu Glu Pro Tyr Thr Ala Cys Asp Leu Ala

595 600 605

Pro Pro Ala Gly Thr Thr Asp

610 615

<210> 9

<211> 109

<212> PRT

<213> Lama pacos

<400> 9

Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser

1 5 10 15

Cys Val Ala Ser Gly Thr Ile Ala Ser Val Tyr Ile Met Gly Trp Tyr

20 25 30

Arg Gln Ala Pro Gly Lys Gln Arg Glu Val Val Ala Val Val Thr Ser

35 40 45

Gly Gly Gly Thr Ser Tyr Ala Glu Ser Val Lys Gly Arg Phe Thr Ile

50 55 60

Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu Gln Met Asn Ser Leu

65 70 75 80

Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn Phe Leu Pro Asn Arg

85 90 95

His Gly Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

100 105

Claims (10)

1. A nano-antibody against procalcitonin, characterized in that the variable region of the nano-antibody has 3 complementarity determining regions CDR1, CDR2 and CDR3, wherein the sequence of the CDR1 region consists of the amino acid sequence shown in SEQ ID No.1, the sequence of the CDR2 region consists of the amino acid sequence shown in SEQ ID No.2, and the sequence of the CDR3 region consists of the amino acid sequence shown in SEQ ID No. 3.

2. The nanobody of claim 1, wherein the variable region sequence of the nanobody consists of the amino acid sequence set forth in SEQ ID No. 4.

3. A fusion protein comprising the nanobody of claim 2 and human placental alkaline phosphatase, wherein the fusion protein is formed by tandem connection of the nanobody and the human placental alkaline phosphatase.

4. A polynucleotide molecule encoding the nanobody sequence of claim 2, wherein the sequence of said polynucleotide molecule is represented by SEQ ID No. 5.

5. An expression vector comprising the polynucleotide molecule of claim 4, wherein said vector is pMES 4.

6. A host cell comprising the expression vector of claim 5, wherein said cell is E.coli BL21(DE 3).

7. Use of the nanobody of claim 1 or 2 for the preparation of a procalcitonin detection kit.

8. The procalcitonin immunodetection method based on the non-diagnosis purpose is characterized in that the method is a double-antibody sandwich enzyme-linked immunoassay, the variable region sequence of the first antibody is shown as the amino acid sequence of SEQ ID NO.6 or SEQ ID NO.9, the second antibody is an enzyme-linked second antibody, and the variable region sequence of the second antibody is shown as the amino acid sequence of SEQ ID NO. 4.

9. The method of claim 8, wherein the enzyme-linked secondary antibody is a fusion protein of a nanobody against procalcitonin and alkaline phosphatase.

10. An immunoassay kit for detecting procalcitonin by using a double-antibody sandwich method, the kit comprises a first antibody for capturing an antigen and a second antibody for binding with the antigen to trigger an enzyme-linked reaction, and is characterized in that the variable region sequence of the first antibody is shown as SEQ ID No.6 or SEQ ID No.9, the second antibody is a fusion protein of a nano antibody for resisting procalcitonin and alkaline phosphatase, and the sequence of the fusion protein is shown as SEQ ID No. 8.

Images