CN110885830A - FN1 gene mutation and application thereof - Google Patents

FN1 gene mutation and application thereof Download PDF

Info

Publication number
CN110885830A
CN110885830A CN201811045298.2A CN201811045298A CN110885830A CN 110885830 A CN110885830 A CN 110885830A CN 201811045298 A CN201811045298 A CN 201811045298A CN 110885830 A CN110885830 A CN 110885830A
Authority
CN
China
Prior art keywords
nucleic acid
sample
mutation
fibronectin
glomerulopathy
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811045298.2A
Other languages
Chinese (zh)
Inventor
杨昀
毛良伟
张宁芝
宛杨
李�浩
孙岩
袁雯
杜丽缺
王海荣
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fuyang People's Hospital Of Anhui Province
Wuhan Bgi Medical Laboratory Co Ltd
Anhui Huada Medical Laboratory Co Ltd
Original Assignee
Fuyang People's Hospital Of Anhui Province
Wuhan Bgi Medical Laboratory Co Ltd
Anhui Huada Medical Laboratory Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fuyang People's Hospital Of Anhui Province, Wuhan Bgi Medical Laboratory Co Ltd, Anhui Huada Medical Laboratory Co Ltd filed Critical Fuyang People's Hospital Of Anhui Province
Priority to CN201811045298.2A priority Critical patent/CN110885830A/en
Publication of CN110885830A publication Critical patent/CN110885830A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/78—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin, cold insoluble globulin [CIG]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/78—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin, cold insoluble globulin [CIG]
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/34—Genitourinary disorders
    • G01N2800/347—Renal failures; Glomerular diseases; Tubulointerstitial diseases, e.g. nephritic syndrome, glomerulonephritis; Renovascular diseases, e.g. renal artery occlusion, nephropathy

Abstract

The present invention relates to isolated nucleic acids, genetic mutations, isolated proteins and their use in the preparation of kits, the use of biological models in screening drugs, drugs for the treatment of fibronectin deposit glomerulopathy type 2, systems and kits for screening biological samples susceptible to fibronectin deposit glomerulopathy type 2, constructs and recombinant cells. Wherein, compared to SEQ ID NO:1, the isolated nucleic acid has a mutation selected from the group consisting of: c.6994G > C. By detecting the presence of the isolated nucleic acid in a biological sample, it is possible to effectively detect whether the biological sample is susceptible to fibronectin deposit glomerulopathy type 2.

Description

FN1 gene mutation and application thereof
Technical Field
The invention relates to the technical field. In particular, the invention relates to FN1 gene mutation and application thereof.
Background
Fibronectin deposit Glomerulopathy type 2 (glomerilopathic with fibronectin depots 2) is an autosomal dominant genetic disease with genetic heterogeneity and a certain correlation between penetrance and age. It is characterized by proteinuria, microscopic hematuria, hypertension and massive fibronectin glomerular deposition, leading to end-stage renal failure. Although several causative genes of fibronectin deposit glomerulopathy type 2 have been discovered so far, there is a considerable portion of unknown causative gene sites.
Thus, the research on fibronectin deposit glomerulopathy type 2 is still under investigation.
Disclosure of Invention
The present invention aims to solve at least to some extent at least one of the technical problems of the prior art.
It should be noted that the present invention has been completed based on the following findings of the inventors:
the inventor determines a new pathogenic gene mutation site of fibronectin deposition glomerulopathy type 2 (c.6994G > C mutation of FN1 gene) by a high-throughput exome sequencing and candidate gene mutation verification method.
To this end, in a first aspect of the invention, the invention provides an isolated nucleic acid. According to embodiments of the invention, the sequence of SEQ ID NO:1, the isolated nucleic acid has a mutation selected from the group consisting of: c.6994G > C. The inventor finds that the FN1 gene coding region has a missense mutation c.6994G > C, namely, G base at position 6994 is mutated into C base, the mutation is closely related to the pathogenesis of fibronectin deposit glomerulopathy type 2, so that whether a biological sample is susceptible to fibronectin deposit glomerulopathy type 2 can be effectively detected by detecting whether the nucleic acid exists in the biological sample.
According to an embodiment of the invention, the isolated nucleic acid is DNA.
In a second aspect of the invention, the invention features a genetic mutation. According to an embodiment of the present invention, the sequence shown in seq id NO:1, having a mutation selected from the group consisting of: c.6994G > C. The inventors have found that the FN1 gene coding region has a missense mutation c.6994g > C which is closely related to the onset of fibronectin deposit glomerulopathy type 2, so that by detecting the presence of the nucleic acid in a biological sample, it is possible to effectively detect whether the biological sample is susceptible to fibronectin deposit glomerulopathy type 2.
In a third aspect of the invention, the invention features an isolated protein. According to embodiments of the invention, the sequence of SEQ ID NO:1, the amino acid sequence of said isolated protein has a mutation selected from the group consisting of: p.G2332R. The inventors found that the FN1 gene encodes the expressed protein, and the amino acid has a missense mutation p.G2332R, that is, glycine at the 2332 th amino acid sequence is mutated into arginine, and the mutation is closely related to the onset of the type 2 glomerulopathy deposited by fibronectin, so that whether a biological sample is susceptible to the type 2 glomerulopathy deposited by fibronectin can be effectively detected by detecting the presence or absence of the nucleic acid in the biological sample.
In a fourth aspect, the invention provides the use of a reagent for detecting an isolated nucleic acid as hereinbefore described or a genetic mutation as hereinbefore described or an isolated protein as hereinbefore described in the manufacture of a kit. According to an embodiment of the invention, the kit is for diagnosing a predisposition to fibronectin deposit glomerulopathy type 2. Thus, by detecting the presence or absence of the nucleic acid or protein in a biological sample, it is possible to effectively diagnose whether or not the sample is susceptible to fibronectin deposit glomerulopathy type 2.
According to an embodiment of the present invention, the reagent includes at least one of an antibody, a probe, and a primer.
According to an embodiment of the invention, the probe or primer has the sequence as shown in SEQ ID NO: 2 or 3.
In a fifth aspect of the invention, the invention provides the use of a biological model for screening a drug. According to an embodiment of the invention, the biological model carries the isolated nucleic acid and/or the genetic mutation and/or the expression of the isolated protein. Therefore, the biological model of the invention can accurately screen out the medicine for treating the fibronectin deposit glomerular disease type 2.
According to an embodiment of the invention, the biological model is a cellular model or an animal model.
In a sixth aspect of the invention, the invention provides a medicament for the treatment of fibronectin deposit glomerulopathy type 2. According to an embodiment of the invention, the medicament comprises: an agent which specifically alters the isolated nucleic acid or the genetic mutation or the isolated protein described above. Thus, the drug of the present invention can effectively treat fibronectin deposit glomerulopathy type 2.
In a seventh aspect of the invention, a system for screening a biological sample predisposed to fibronectin deposit glomerulopathy type 2 is provided. According to an embodiment of the invention, the system comprises: a nucleic acid extraction device for extracting a nucleic acid sample from the biological sample; a nucleic acid sequence determining device connected with the nucleic acid extracting device and used for analyzing the nucleic acid sample so as to determine the nucleic acid sequence of the nucleic acid sample; a judging means connected to the nucleic acid sequence determining means so as to compare the nucleic acid sequence of the nucleic acid sample or a complementary sequence thereof with the nucleic acid sequence of SEQ ID NO:1, has a mutation selected from the group consisting of: c.6994G > C mutation, and determining whether the biological sample is susceptible to fibronectin deposit glomerulopathy type 2. The system for screening the biological sample of the fibronectin deposited glomerulopathy-2 can effectively screen the biological sample susceptible to the fibronectin deposited glomerulopathy-2.
According to an embodiment of the present invention, the nucleic acid extraction apparatus further comprises: an RNA extraction unit for extracting an RNA sample from the biological sample; and a reverse transcription unit connected to the RNA extraction unit for performing a reverse transcription reaction on the RNA sample to obtain a cDNA sample, the cDNA sample constituting the nucleic acid sample.
According to an embodiment of the invention, the mutation is a heterozygous mutation.
According to an embodiment of the present invention, the nucleic acid sequence determination apparatus further comprises: a library construction unit for constructing a nucleic acid sequencing library for the nucleic acid sample; and the sequencing unit is connected with the library construction unit and used for sequencing the nucleic acid sequencing library so as to obtain a sequencing result consisting of a plurality of sequencing data.
According to an embodiment of the invention, the library construction unit further comprises: a PCR amplification module, wherein FN1 gene exon specific primers are arranged in the PCR amplification module, so that the specific primers are used for carrying out PCR amplification on the nucleic acid sample.
According to an embodiment of the invention, the specific primer has the sequence as shown in SEQ ID NO: 2 or 3.
According to an embodiment of the invention, the sequencing unit comprises at least one selected from the group consisting of hipseq 2000, SOLiD, 454 and a single molecule sequencing device.
In an eighth aspect of the invention, a kit for screening a biological sample susceptible to fibronectin deposit glomerulopathy type 2 is provided. According to an embodiment of the invention, the kit comprises: a reagent suitable for detecting the isolated nucleic acid or the genetic mutation or at least one of the proteins as described above, wherein the sequence of SEQ ID NO:1, the isolated nucleic acid or the mutation in the gene has a mutation selected from the group consisting of: c.6994G > C. By the kit for screening the biological sample of the fibronectin deposit glomerulopathy 2, the biological sample susceptible to the fibronectin deposit glomerulopathy 2 can be effectively screened.
According to an embodiment of the present invention, the reagent includes at least one of an antibody, a probe, and a primer.
According to an embodiment of the invention, the probe or primer has the sequence as shown in SEQ ID NO: 2 or 3.
In a ninth aspect of the invention, the invention provides a construct. According to an embodiment of the invention, the construct comprises the isolated nucleic acid or the genetic mutation as described above. The construct of the invention contains the gene mutation of c.6994G > C, and the gene mutation can be transferred into a receptor cell, thereby realizing the screening, research and treatment of biological samples which are easy to suffer from fibronectin deposit glomerulopathy type 2.
In a tenth aspect of the invention, a recombinant cell is provided. According to an embodiment of the invention, the recombinant cell is obtained by transforming a recipient cell with the construct or expressing the isolated protein as described above. The recombinant cells according to the embodiment of the invention can be used for screening, researching and treating biological samples susceptible to the fibronectin deposit glomerulopathy type 2.
Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.
Drawings
The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:
FIG. 1 shows a schematic structural diagram of a system for screening a biological sample susceptible to fibronectin deposit glomerulopathy type 2 according to an embodiment of the present invention, wherein,
a is a schematic diagram of a system for screening a biological sample susceptible to fibronectin deposit glomerulopathy type 2, B is a schematic diagram of a nucleic acid extraction device, and C is a schematic diagram of a nucleic acid sequence determination device;
FIG. 2 shows a pedigree map predisposed to fibronectin deposit glomerulopathy type 2 according to one embodiment of the invention;
FIG. 3 shows a schematic flow diagram for whole exome sequencing according to one embodiment of the present invention;
FIG. 4 shows a schematic structural diagram of a polypeptide encoded by the FN1 gene according to one embodiment of the present invention; and
FIG. 5 shows an alignment of amino acids encoded by the FN1 gene according to one embodiment of the invention.
Detailed Description
The following describes embodiments of the present invention in detail. The following examples are illustrative only and are not to be construed as limiting the invention.
Isolated nucleic acids
According to a first aspect of the invention, an isolated nucleic acid is provided. According to an embodiment of the present invention, the sequence shown in seq id NO:1, the isolated nucleic acid has a mutation selected from the group consisting of: c.6994G > C. That is, the FN1 gene of the present invention has a missense mutation c.6994g > C relative to the wild-type FN1 gene.
It should be noted that the isolated nucleic acid of the present invention encoding the FN1 gene mutant may also be referred to as "a nucleic acid encoding the FN1 gene mutant", i.e., the nucleic acid may be understood as a nucleic acid substance corresponding to the gene encoding the FN1 gene mutant, i.e., the type of the nucleic acid is not particularly limited, and may be any polymer including deoxyribonucleotides and/or ribonucleotides corresponding to the gene encoding FN1, including but not limited to DNA, RNA, or cDNA. According to a particular example of the invention, the previously isolated nucleic acid is DNA. In addition, it will be understood by those skilled in the art that the term "nucleic acid" encompasses virtually either or both of the complementary double strands. For convenience, in the present specification and claims, although only one strand is given in most cases, the other strand complementary thereto is actually disclosed. For example, reference to SEQ ID NOs 1-6 actually includes the complementary sequences thereof. One skilled in the art will also appreciate that one strand may be used to detect the other strand and vice versa.
The inventors have identified a novel mutant of the FN1 gene, which is closely related to the onset of fibronectin deposit glomerulopathy type 2, and thus, by detecting the presence of the novel mutant in a biological sample, it was possible to effectively detect whether the biological sample is susceptible to fibronectin deposit glomerulopathy type 2. The nucleic acid encoding the FN1 mutant is a novel mutation in a pathogenic gene of fibronectin deposition glomerulopathy type 2, which is determined by the inventor of the application through high-throughput exome sequencing combined with candidate gene mutation verification, and the mutation site is not mentioned in the prior art.
Wherein the cDNA of the wild-type FN1 gene has a nucleotide sequence (SEQ ID NO: 1) as shown below:
atgcttaggggtccggggcccgggctgctgctgctggccgtccagtgcctggggacagcggtgccctccacgggagcctcgaagagcaagaggcaggctcagcaaatggttcagccccagtccccggtggctgtcagtcaaagcaagcccggttgttatgacaatggaaaacactatcagataaatcaacagtgggagcggacctacctaggcaatgcgttggtttgtacttgttatggaggaagccgaggttttaactgcgagagtaaacctgaagctgaagagacttgctttgacaagtacactgggaacacttaccgagtgggtgacacttatgagcgtcctaaagactccatgatctgggactgtacctgcatcggggctgggcgagggagaataagctgtaccatcgcaaaccgctgccatgaagggggtcagtcctacaagattggtgacacctggaggagaccacatgagactggtggttacatgttagagtgtgtgtgtcttggtaatggaaaaggagaatggacctgcaagcccatagctgagaagtgttttgatcatgctgctgggacttcctatgtggtcggagaaacgtgggagaagccctaccaaggctggatgatggtagattgtacttgcctgggagaaggcagcggacgcatcacttgcacttctagaaatagatgcaacgatcaggacacaaggacatcctatagaattggagacacctggagcaagaaggataatcgaggaaacctgctccagtgcatctgcacaggcaacggccgaggagagtggaagtgtgagaggcacacctctgtgcagaccacatcgagcggatctggccccttcaccgatgttcgtgcagctgtttaccaaccgcagcctcacccccagcctcctccctatggccactgtgtcacagacagtggtgtggtctactctgtggggatgcagtggctgaagacacaaggaaataagcaaatgctttgcacgtgcctgggcaacggagtcagctgccaagagacagctgtaacccagacttacggtggcaactcaaatggagagccatgtgtcttaccattcacctacaatggcaggacgttctactcctgcaccacagaagggcgacaggacggacatctttggtgcagcacaacttcgaattatgagcaggaccagaaatactctttctgcacagaccacactgttttggttcagactcgaggaggaaattccaatggtgccttgtgccacttccccttcctatacaacaaccacaattacactgattgcacttctgagggcagaagagacaacatgaagtggtgtgggaccacacagaactatgatgccgaccagaagtttgggttctgccccatggctgcccacgaggaaatctgcacaaccaatgaaggggtcatgtaccgcattggagatcagtgggataagcagcatgacatgggtcacatgatgaggtgcacgtgtgttgggaatggtcgtggggaatggacatgcattgcctactcgcagcttcgagatcagtgcattgttgatgacatcacttacaatgtgaacgacacattccacaagcgtcatgaagaggggcacatgctgaactgtacatgcttcggtcagggtcggggcaggtggaagtgtgatcccgtcgaccaatgccaggattcagagactgggacgttttatcaaattggagattcatgggagaagtatgtgcatggtgtcagataccagtgctactgctatggccgtggcattggggagtggcattgccaacctttacagacctatccaagctcaagtggtcctgtcgaagtatttatcactgagactccgagtcagcccaactcccaccccatccagtggaatgcaccacagccatctcacatttccaagtacattctcaggtggagacctaaaaattctgtaggccgttggaaggaagctaccataccaggccacttaaactcctacaccatcaaaggcctgaagcctggtgtggtatacgagggccagctcatcagcatccagcagtacggccaccaagaagtgactcgctttgacttcaccaccaccagcaccagcacacctgtgaccagcaacaccgtgacaggagagacgactcccttttctcctcttgtggccacttctgaatctgtgaccgaaatcacagccagtagctttgtggtctcctgggtctcagcttccgacaccgtgtcgggattccgggtggaatatgagctgagtgaggagggagatgagccacagtacctggatcttccaagcacagccacttctgtgaacatccctgacctgcttcctggccgaaaatacattgtaaatgtctatcagatatctgaggatggggagcagagtttgatcctgtctacttcacaaacaacagcgcctgatgcccctcctgacccgactgtggaccaagttgatgacacctcaattgttgttcgctggagcagaccccaggctcccatcacagggtacagaatagtctattcgccatcagtagaaggtagcagcacagaactcaaccttcctgaaactgcaaactccgtcaccctcagtgacttgcaacctggtgttcagtataacatcactatctatgctgtggaagaaaatcaagaaagtacacctgttgtcattcaacaagaaaccactggcaccccacgctcagatacagtgccctctcccagggacctgcagtttgtggaagtgacagacgtgaaggtcaccatcatgtggacaccgcctgagagtgcagtgaccggctaccgtgtggatgtgatccccgtcaacctgcctggcgagcacgggcagaggctgcccatcagcaggaacacctttgcagaagtcaccgggctgtcccctggggtcacctattacttcaaagtctttgcagtgagccatgggagggagagcaagcctctgactgctcaacagacaaccaaactggatgctcccactaacctccagtttgtcaatgaaactgattctactgtcctggtgagatggactccacctcgggcccagataacaggataccgactgaccgtgggccttacccgaagaggacagcccaggcagtacaatgtgggtccctctgtctccaagtacccactgaggaatctgcagcctgcatctgagtacaccgtatccctcgtggccataaagggcaaccaagagagccccaaagccactggagtctttaccacactgcagcctgggagctctattccaccttacaacaccgaggtgactgagaccaccattgtgatcacatggacgcctgctccaagaattggttttaagctgggtgtacgaccaagccagggaggagaggcaccacgagaagtgacttcagactcaggaagcatcgttgtgtccggcttgactccaggagtagaatacgtctacaccatccaagtcctgagagatggacaggaaagagatgcgccaattgtaaacaaagtggtgacaccattgtctccaccaacaaacttgcatctggaggcaaaccctgacactggagtgctcacagtctcctgggagaggagcaccaccccagacattactggttatagaattaccacaacccctacaaacggccagcagggaaattctttggaagaagtggtccatgctgatcagagctcctgcacttttgataacctgagtcccggcctggagtacaatgtcagtgtttacactgtcaaggatgacaaggaaagtgtccctatctctgataccatcatcccagaggtgccccaactcactgacctaagctttgttgatataaccgattcaagcatcggcctgaggtggaccccgctaaactcttccaccattattgggtaccgcatcacagtagttgcggcaggagaaggtatccctatttttgaagattttgtggactcctcagtaggatactacacagtcacagggctggagccgggcattgactatgatatcagcgttatcactctcattaatggcggcgagagtgcccctactacactgacacaacaaacggctgttcctcctcccactgacctgcgattcaccaacattggtccagacaccatgcgtgtcacctgggctccacccccatccattgatttaaccaacttcctggtgcgttactcacctgtgaaaaatgaggaagatgttgcagagttgtcaatttctccttcagacaatgcagtggtcttaacaaatctcctgcctggtacagaatatgtagtgagtgtctccagtgtctacgaacaacatgagagcacacctcttagaggaagacagaaaacaggtcttgattccccaactggcattgacttttctgatattactgccaactcttttactgtgcactggattgctcctcgagccaccatcactggctacaggatccgccatcatcccgagcacttcagtgggagacctcgagaagatcgggtgccccactctcggaattccatcaccctcaccaacctcactccaggcacagagtatgtggtcagcatcgttgctcttaatggcagagaggaaagtcccttattgattggccaacaatcaacagtttctgatgttccgagggacctggaagttgttgctgcgacccccaccagcctactgatcagctgggatgctcctgctgtcacagtgagatattacaggatcacttacggagagacaggaggaaatagccctgtccaggagttcactgtgcctgggagcaagtctacagctaccatcagcggccttaaacctggagttgattataccatcactgtgtatgctgtcactggccgtggagacagccccgcaagcagcaagccaatttccattaattaccgaacagaaattgacaaaccatcccagatgcaagtgaccgatgttcaggacaacagcattagtgtcaagtggctgccttcaagttcccctgttactggttacagagtaaccaccactcccaaaaatggaccaggaccaacaaaaactaaaactgcaggtccagatcaaacagaaatgactattgaaggcttgcagcccacagtggagtatgtggttagtgtctatgctcagaatccaagcggagagagtcagcctctggttcagactgcagtaaccaacattgatcgccctaaaggactggcattcactgatgtggatgtcgattccatcaaaattgcttgggaaagcccacaggggcaagtttccaggtacagggtgacctactcgagccctgaggatggaatccatgagctattccctgcacctgatggtgaagaagacactgcagagctgcaaggcctcagaccgggttctgagtacacagtcagtgtggttgccttgcacgatgatatggagagccagcccctgattggaacccagtccacagctattcctgcaccaactgacctgaagttcactcaggtcacacccacaagcctgagcgcccagtggacaccacccaatgttcagctcactggatatcgagtgcgggtgacccccaaggagaagaccggaccaatgaaagaaatcaaccttgctcctgacagctcatccgtggttgtatcaggacttatggtggccaccaaatatgaagtgagtgtctatgctcttaaggacactttgacaagcagaccagctcagggagttgtcaccactctggagaatgtcagcccaccaagaagggctcgtgtgacagatgctactgagaccaccatcaccattagctggagaaccaagactgagacgatcactggcttccaagttgatgccgttccagccaatggccagactccaatccagagaaccatcaagccagatgtcagaagctacaccatcacaggtttacaaccaggcactgactacaagatctacctgtacaccttgaatgacaatgctcggagctcccctgtggtcatcgacgcctccactgccattgatgcaccatccaacctgcgtttcctggccaccacacccaattccttgctggtatcatggcagccgccacgtgccaggattaccggctacatcatcaagtatgagaagcctgggtctcctcccagagaagtggtccctcggccccgccctggtgtcacagaggctactattactggcctggaaccgggaaccgaatatacaatttatgtcattgccctgaagaataatcagaagagcgagcccctgattggaaggaaaaagacagacgagcttccccaactggtaacccttccacaccccaatcttcatggaccagagatcttggatgttccttccacagttcaaaagacccctttcgtcacccaccctgggtatgacactggaaatggtattcagcttcctggcacttctggtcagcaacccagtgttgggcaacaaatgatctttgaggaacatggttttaggcggaccacaccgcccacaacggccacccccataaggcataggccaagaccatacccgccgaatgtaggtgaggaaatccaaattggtcacatccccagggaagatgtagactatcacctgtacccacacggtccgggactcaatccaaatgcctctacaggacaagaagctctctctcagacaaccatctcatgggccccattccaggacacttctgagtacatcatttcatgtcatcctgttggcactgatgaagaacccttacagttcagggttcctggaacttctaccagtgccactctgacaggcctcaccagaggtgccacctacaacatcatagtggaggcactgaaagaccagcagaggcataaggttcgggaagaggttgttaccgtgggcaactctgtcaacgaaggcttgaaccaacctacggatgactcgtgctttgacccctacacagtttcccattatgccgttggagatgagtgggaacgaatgtctgaatcaggctttaaactgttgtgccagtgcttaggctttggaagtggtcatttcagatgtgattcatctagatggtgccatgacaatggtgtgaactacaagattggagagaagtgggaccgtcagggagaaaatggccagatgatgagctgcacatgtcttgggaacggaaaaggagaattcaagtgtgaccctcatgaggcaacgtgttatgatgatgggaagacataccacgtaggagaacagtggcagaaggaatatctcggtgccatttgctcctgcacatgctttggaggccagcggggctggcgctgtgacaactgccgcagacctgggggtgaacccagtcccgaaggcactactggccagtcctacaaccagtattctcagagataccatcagagaacaaacactaatgttaattgcccaattgagtgcttcatgcctttagatgtacaggctgacagagaagattcccgagagtaa
the mutant c.6994G > C cDNA has the nucleotide sequence shown below (SEQ ID NO: 4): atgcttaggggtccggggcccgggctgctgctgctggccgtccagtgcctggggacagcggtgccctccacgggagcctcgaagagcaagaggcaggctcagcaaatggttcagccccagtccccggtggctgtcagtcaaagcaagcccggttgttatgacaatggaaaacactatcagataaatcaacagtgggagcggacctacctaggcaatgcgttggtttgtacttgttatggaggaagccgaggttttaactgcgagagtaaacctgaagctgaagagacttgctttgacaagtacactgggaacacttaccgagtgggtgacacttatgagcgtcctaaagactccatgatctgggactgtacctgcatcggggctgggcgagggagaataagctgtaccatcgcaaaccgctgccatgaagggggtcagtcctacaagattggtgacacctggaggagaccacatgagactggtggttacatgttagagtgtgtgtgtcttggtaatggaaaaggagaatggacctgcaagcccatagctgagaagtgttttgatcatgctgctgggacttcctatgtggtcggagaaacgtgggagaagccctaccaaggctggatgatggtagattgtacttgcctgggagaaggcagcggacgcatcacttgcacttctagaaatagatgcaacgatcaggacacaaggacatcctatagaattggagacacctggagcaagaaggataatcgaggaaacctgctccagtgcatctgcacaggcaacggccgaggagagtggaagtgtgagaggcacacctctgtgcagaccacatcgagcggatctggccccttcaccgatgttcgtgcagctgtttaccaaccgcagcctcacccccagcctcctccctatggccactgtgtcacagacagtggtgtggtctactctgtggggatgcagtggctgaagacacaaggaaataagcaaatgctttgcacgtgcctgggcaacggagtcagctgccaagagacagctgtaacccagacttacggtggcaactcaaatggagagccatgtgtcttaccattcacctacaatggcaggacgttctactcctgcaccacagaagggcgacaggacggacatctttggtgcagcacaacttcgaattatgagcaggaccagaaatactctttctgcacagaccacactgttttggttcagactcgaggaggaaattccaatggtgccttgtgccacttccccttcctatacaacaaccacaattacactgattgcacttctgagggcagaagagacaacatgaagtggtgtgggaccacacagaactatgatgccgaccagaagtttgggttctgccccatggctgcccacgaggaaatctgcacaaccaatgaaggggtcatgtaccgcattggagatcagtgggataagcagcatgacatgggtcacatgatgaggtgcacgtgtgttgggaatggtcgtggggaatggacatgcattgcctactcgcagcttcgagatcagtgcattgttgatgacatcacttacaatgtgaacgacacattccacaagcgtcatgaagaggggcacatgctgaactgtacatgcttcggtcagggtcggggcaggtggaagtgtgatcccgtcgaccaatgccaggattcagagactgggacgttttatcaaattggagattcatgggagaagtatgtgcatggtgtcagataccagtgctactgctatggccgtggcattggggagtggcattgccaacctttacagacctatccaagctcaagtggtcctgtcgaagtatttatcactgagactccgagtcagcccaactcccaccccatccagtggaatgcaccacagccatctcacatttccaagtacattctcaggtggagacctaaaaattctgtaggccgttggaaggaagctaccataccaggccacttaaactcctacaccatcaaaggcctgaagcctggtgtggtatacgagggccagctcatcagcatccagcagtacggccaccaagaagtgactcgctttgacttcaccaccaccagcaccagcacacctgtgaccagcaacaccgtgacaggagagacgactcccttttctcctcttgtggccacttctgaatctgtgaccgaaatcacagccagtagctttgtggtctcctgggtctcagcttccgacaccgtgtcgggattccgggtggaatatgagctgagtgaggagggagatgagccacagtacctggatcttccaagcacagccacttctgtgaacatccctgacctgcttcctggccgaaaatacattgtaaatgtctatcagatatctgaggatggggagcagagtttgatcctgtctacttcacaaacaacagcgcctgatgcccctcctgacccgactgtggaccaagttgatgacacctcaattgttgttcgctggagcagaccccaggctcccatcacagggtacagaatagtctattcgccatcagtagaaggtagcagcacagaactcaaccttcctgaaactgcaaactccgtcaccctcagtgacttgcaacctggtgttcagtataacatcactatctatgctgtggaagaaaatcaagaaagtacacctgttgtcattcaacaagaaaccactggcaccccacgctcagatacagtgccctctcccagggacctgcagtttgtggaagtgacagacgtgaaggtcaccatcatgtggacaccgcctgagagtgcagtgaccggctaccgtgtggatgtgatccccgtcaacctgcctggcgagcacgggcagaggctgcccatcagcaggaacacctttgcagaagtcaccgggctgtcccctggggtcacctattacttcaaagtctttgcagtgagccatgggagggagagcaagcctctgactgctcaacagacaaccaaactggatgctcccactaacctccagtttgtcaatgaaactgattctactgtcctggtgagatggactccacctcgggcccagataacaggataccgactgaccgtgggccttacccgaagaggacagcccaggcagtacaatgtgggtccctctgtctccaagtacccactgaggaatctgcagcctgcatctgagtacaccgtatccctcgtggccataaagggcaaccaagagagccccaaagccactggagtctttaccacactgcagcctgggagctctattccaccttacaacaccgaggtgactgagaccaccattgtgatcacatggacgcctgctccaagaattggttttaagctgggtgtacgaccaagccagggaggagaggcaccacgagaagtgacttcagactcaggaagcatcgttgtgtccggcttgactccaggagtagaatacgtctacaccatccaagtcctgagagatggacaggaaagagatgcgccaattgtaaacaaagtggtgacaccattgtctccaccaacaaacttgcatctggaggcaaaccctgacactggagtgctcacagtctcctgggagaggagcaccaccccagacattactggttatagaattaccacaacccctacaaacggccagcagggaaattctttggaagaagtggtccatgctgatcagagctcctgcacttttgataacctgagtcccggcctggagtacaatgtcagtgtttacactgtcaaggatgacaaggaaagtgtccctatctctgataccatcatcccagaggtgccccaactcactgacctaagctttgttgatataaccgattcaagcatcggcctgaggtggaccccgctaaactcttccaccattattgggtaccgcatcacagtagttgcggcaggagaaggtatccctatttttgaagattttgtggactcctcagtaggatactacacagtcacagggctggagccgggcattgactatgatatcagcgttatcactctcattaatggcggcgagagtgcccctactacactgacacaacaaacggctgttcctcctcccactgacctgcgattcaccaacattggtccagacaccatgcgtgtcacctgggctccacccccatccattgatttaaccaacttcctggtgcgttactcacctgtgaaaaatgaggaagatgttgcagagttgtcaatttctccttcagacaatgcagtggtcttaacaaatctcctgcctggtacagaatatgtagtgagtgtctccagtgtctacgaacaacatgagagcacacctcttagaggaagacagaaaacaggtcttgattccccaactggcattgacttttctgatattactgccaactcttttactgtgcactggattgctcctcgagccaccatcactggctacaggatccgccatcatcccgagcacttcagtgggagacctcgagaagatcgggtgccccactctcggaattccatcaccctcaccaacctcactccaggcacagagtatgtggtcagcatcgttgctcttaatggcagagaggaaagtcccttattgattggccaacaatcaacagtttctgatgttccgagggacctggaagttgttgctgcgacccccaccagcctactgatcagctgggatgctcctgctgtcacagtgagatattacaggatcacttacggagagacaggaggaaatagccctgtccaggagttcactgtgcctgggagcaagtctacagctaccatcagcggccttaaacctggagttgattataccatcactgtgtatgctgtcactggccgtggagacagccccgcaagcagcaagccaatttccattaattaccgaacagaaattgacaaaccatcccagatgcaagtgaccgatgttcaggacaacagcattagtgtcaagtggctgccttcaagttcccctgttactggttacagagtaaccaccactcccaaaaatggaccaggaccaacaaaaactaaaactgcaggtccagatcaaacagaaatgactattgaaggcttgcagcccacagtggagtatgtggttagtgtctatgctcagaatccaagcggagagagtcagcctctggttcagactgcagtaaccaacattgatcgccctaaaggactggcattcactgatgtggatgtcgattccatcaaaattgcttgggaaagcccacaggggcaagtttccaggtacagggtgacctactcgagccctgaggatggaatccatgagctattccctgcacctgatggtgaagaagacactgcagagctgcaaggcctcagaccgggttctgagtacacagtcagtgtggttgccttgcacgatgatatggagagccagcccctgattggaacccagtccacagctattcctgcaccaactgacctgaagttcactcaggtcacacccacaagcctgagcgcccagtggacaccacccaatgttcagctcactggatatcgagtgcgggtgacccccaaggagaagaccggaccaatgaaagaaatcaaccttgctcctgacagctcatccgtggttgtatcaggacttatggtggccaccaaatatgaagtgagtgtctatgctcttaaggacactttgacaagcagaccagctcagggagttgtcaccactctggagaatgtcagcccaccaagaagggctcgtgtgacagatgctactgagaccaccatcaccattagctggagaaccaagactgagacgatcactggcttccaagttgatgccgttccagccaatggccagactccaatccagagaaccatcaagccagatgtcagaagctacaccatcacaggtttacaaccaggcactgactacaagatctacctgtacaccttgaatgacaatgctcggagctcccctgtggtcatcgacgcctccactgccattgatgcaccatccaacctgcgtttcctggccaccacacccaattccttgctggtatcatggcagccgccacgtgccaggattaccggctacatcatcaagtatgagaagcctgggtctcctcccagagaagtggtccctcggccccgccctggtgtcacagaggctactattactggcctggaaccgggaaccgaatatacaatttatgtcattgccctgaagaataatcagaagagcgagcccctgattggaaggaaaaagacagacgagcttccccaactggtaacccttccacaccccaatcttcatggaccagagatcttggatgttccttccacagttcaaaagacccctttcgtcacccaccctgggtatgacactggaaatggtattcagcttcctggcacttctggtcagcaacccagtgttgggcaacaaatgatctttgaggaacatggttttaggcggaccacaccgcccacaacggccacccccataaggcataggccaagaccatacccgccgaatgtaggtgaggaaatccaaattggtcacatccccagggaagatgtagactatcacctgtacccacacggtccgggactcaatccaaatgcctctacaggacaagaagctctctctcagacaaccatctcatgggccccattccaggacacttctgagtacatcatttcatgtcatcctgttggcactgatgaagaacccttacagttcagggttcctggaacttctaccagtgccactctgacaggcctcaccagaggtgccacctacaacatcatagtggaggcactgaaagaccagcagaggcataaggttcgggaagaggttgttaccgtgggcaactctgtcaacgaaggcttgaaccaacctacggatgactcgtgctttgacccctacacagtttcccattatgccgttggagatgagtgggaacgaatgtctgaatcaggctttaaactgttgtgccagtgcttaggctttggaagtcgtcatttcagatgtgattcatctagatggtgccatgacaatggtgtgaactacaagattggagagaagtgggaccgtcagggagaaaatggccagatgatgagctgcacatgtcttgggaacggaaaaggagaattcaagtgtgaccctcatgaggcaacgtgttatgatgatgggaagacataccacgtaggagaacagtggcagaaggaatatctcggtgccatttgctcctgcacatgctttggaggccagcggggctggcgctgtgacaactgccgcagacctgggggtgaacccagtcccgaaggcactactggccagtcctacaaccagtattctcagagataccatcagagaacaaacactaatgttaattgcccaattgagtgcttcatgcctttagatgtacaggctgacagagaagattcccgagagtaa
Gene mutation
In a second aspect of the invention, the invention features a genetic mutation. According to an embodiment of the present invention, the sequence shown in seq id NO:1, having a mutation selected from the group consisting of: c.6994G > C. The inventors found that the mutation of G base at position 6994 of wild-type FN1 gene to C base is closely related to the onset of fibronectin deposit glomerulopathy type 2, so that the presence or absence of the mutation in FN1 gene can be detected effectively to determine whether or not a biological sample is susceptible to fibronectin deposit glomerulopathy type 2.
Isolated proteins
In a third aspect of the invention, the invention features an isolated protein. According to an embodiment of the present invention, the sequence shown in seq id NO:1, the amino acid sequence of the isolated protein has a mutation selected from the group consisting of: p.G2332R. By detecting whether the protein is expressed in the biological sample, whether the biological sample is susceptible to fibronectin deposit glomerulopathy type 2 can be effectively detected.
The protein encoded by the wild-type FN1 gene has an amino acid sequence (SEQ ID NO: 5) as shown below:
MLRGPGPGLLLLAVQCLGTAVPSTGASKSKRQAQQMVQPQSPVAVSQSKPGCYDNGKHYQINQQWERTYLGNALVCTCYGGSRGFNCESKPEAEETCFDKYTGNTYRVGDTYERPKDSMIWDCTCIGAGRGRISCTIANRCHEGGQSYKIGDTWRRPHETGGYMLECVCLGNGKGEWTCKPIAEKCFDHAAGTSYVVGETWEKPYQGWMMVDCTCLGEGSGRITCTSRNRCNDQDTRTSYRIGDTWSKKDNRGNLLQCICTGNGRGEWKCERHTSVQTTSSGSGPFTDVRAAVYQPQPHPQPPPYGHCVTDSGVVYSVGMQWLKTQGNKQMLCTCLGNGVSCQETAVTQTYGGNSNGEPCVLPFTYNGRTFYSCTTEGRQDGHLWCSTTSNYEQDQKYSFCTDHTVLVQTRGGNSNGALCHFPFLYNNHNYTDCTSEGRRDNMKWCGTTQNYDADQKFGFCPMAAHEEICTTNEGVMYRIGDQWDKQHDMGHMMRCTCVGNGRGEWTCIAYSQLRDQCIVDDITYNVNDTFHKRHEEGHMLNCTCFGQGRGRWKCDPVDQCQDSETGTFYQIGDSWEKYVHGVRYQCYCYGRGIGEWHCQPLQTYPSSSGPVEVFITETPSQPNSHPIQWNAPQPSHISKYILRWRPKNSVGRWKEATIPGHLNSYTIKGLKPGVVYEGQLISIQQYGHQEVTRFDFTTTSTSTPVTSNTVTGETTPFSPLVATSESVTEITASSFVVSWVSASDTVSGFRVEYELSEEGDEPQYLDLPSTATSVNIPDLLPGRKYIVNVYQISEDGEQSLILSTSQTTAPDAPPDTTVDQVDDTSIVVRWSRPQAPITGYRIVYSPSVEGSSTELNLPETANSVTLSDLQPGVQYNITIYAVEENQESTPVVIQQETTGTPRSDTVPSPRDLQFVEVTDVKVTIMWTPPESAVTGYRVDVIPVNLPGEHGQRLPISRNTFAEVTGLSPGVTYYFKVFAVSHGRESKPLTAQQTTKLDAPTNLQFVNETDSTVLVRWTPPRAQITGYRLTVGLTRRGQPRQYNVGPSVSKYPLRNLQPASEYTVSLVAIKGNQESPKATGVFTTLQPGSSIPPYNTEVTETTIVITWTPAPRIGFKLGVRPSQGGEAPREVTSDSGSIVVSGLTPGVEYVYTIQVLRDGQERDAPIVNKVVTPLSPPTNLHLEANPDTGVLTVSWERSTTPDITGYRITTTPTNGQQGNSLEEVVHADQSSCTFDNLSPGLEYNVSVYTVKDDKESVPISDTIIPEVPQLTDLSFVDITDSSIGLRWTPLNSSTIIGYRITVVAAGEGIPIFEDFVDSSVGYYTVTGLEPGIDYDISVITLINGGESAPTTLTQQTAVPPPTDLRFTNIGPDTMRVTWAPPPSIDLTNFLVRYSPVKNEEDVAELSISPSDNAVVLTNLLPGTEYVVSVSSVYEQHESTPLRGRQKTGLDSPTGIDFSDITANSFTVHWIAPRATITGYRIRHHPEHFSGRPREDRVPHSRNSITLTNLTPGTEYVVSIVALNGREESPLLIGQQSTVSDVPRDLEVVAATPTSLLISWDAPAVTVRYYRITYGETGGNSPVQEFTVPGSKSTATISGLKPGVDYTITVYAVTGRGDSPASSKPISINYRTEIDKPSQMQVTDVQDNSISVKWLPSSSPVTGYRVTTTPKNGPGPTKTKTAGPDQTEMTIEGLQPTVEYVVSVYAQNPSGESQPLVQTAVTNIDRPKGLAFTDVDVDSIKIAWESPQGQVSRYRVTYSSPEDGIHELFPAPDGEEDTAELQGLRPGSEYTVSVVALHDDMESQPLIGTQSTAIPAPTDLKFTQVTPTSLSAQWTPPNVQLTGYRVRVTPKEKTGPMKEINLAPDSSSVVVSGLMVATKYEVSVYALKDTLTSRPAQGVVTTLENVSPPRRARVTDATETTITISWRTKTETITGFQVDAVPANGQTPIQRTIKPDVRSYTITGLQPGTDYKIYLYTLNDNARSSPVVIDASTAIDAPSNLRFLATTPNSLLVSWQPPRARITGYIIKYEKPGSPPREVVPRPRPGVTEATITGLEPGTEYTIYVIALKNNQKSEPLIGRKKTDELPQLVTLPHPNLHGPEILDVPSTVQKTPFVTHPGYDTGNGIQLPGTSGQQPSVGQQMIFEEHGFRRTTPPTTATPIRHRPRPYPPNVGEEIQIGHIPREDVDYHLYPHGPGLNPNASTGQEALSQTTISWAPFQDTSEYIISCHPVGTDEEPLQFRVPGTSTSATLTGLTRGATYNVIVEALKDQQRHKVREEVVTVGNSVNEGLNQPTDDSCFDPYTVSHYAVGDEWERMSESGFKLLCQCLGFGSGHFRCDSSRWCHDNGVNYKIGEKWDRQGENGQMMSCTCLGNGKGEFKCDPHEATCYDDGKTYHVGEQWQKEYLGAICSCTCFGGQRGWRCDNCRRPGGEPSPEGTTGQSYNQYSQRYHQRTNTNVNCPIECFMPLDVQADREDSRE
the protein encoded by the mutant c.6994G > C gene has an amino acid sequence (SEQ ID NO: 6) as shown below: MLRGPGPGLLLLAVQCLGTAVPSTGASKSKRQAQQMVQPQSPVAVSQSKPGCYDNGKHYQINQQWERTYLGNALVCTCYGGSRGFNCESKPEAEETCFDKYTGNTYRVGDTYERPKDSMIWDCTCIGAGRGRISCTIANRCHEGGQSYKIGDTWRRPHETGGYMLECVCLGNGKGEWTCKPIAEKCFDHAAGTSYVVGETWEKPYQGWMMVDCTCLGEGSGRITCTSRNRCNDQDTRTSYRIGDTWSKKDNRGNLLQCICTGNGRGEWKCERHTSVQTTSSGSGPFTDVRAAVYQPQPHPQPPPYGHCVTDSGVVYSVGMQWLKTQGNKQMLCTCLGNGVSCQETAVTQTYGGNSNGEPCVLPFTYNGRTFYSCTTEGRQDGHLWCSTTSNYEQDQKYSFCTDHTVLVQTRGGNSNGALCHFPFLYNNHNYTDCTSEGRRDNMKWCGTTQNYDADQKFGFCPMAAHEEICTTNEGVMYRIGDQWDKQHDMGHMMRCTCVGNGRGEWTCIAYSQLRDQCIVDDITYNVNDTFHKRHEEGHMLNCTCFGQGRGRWKCDPVDQCQDSETGTFYQIGDSWEKYVHGVRYQCYCYGRGIGEWHCQPLQTYPSSSGPVEVFITETPSQPNSHPIQWNAPQPSHISKYILRWRPKNSVGRWKEATIPGHLNSYTIKGLKPGVVYEGQLISIQQYGHQEVTRFDFTTTSTSTPVTSNTVTGETTPFSPLVATSESVTEITASSFVVSWVSASDTVSGFRVEYELSEEGDEPQYLDLPSTATSVNIPDLLPGRKYIVNVYQISEDGEQSLILSTSQTTAPDAPPDTTVDQVDDTSIVVRWSRPQAPITGYRIVYSPSVEGSSTELNLPETANSVTLSDLQPGVQYNITIYAVEENQESTPVVIQQETTGTPRSDTVPSPRDLQFVEVTDVKVTIMWTPPESAVTGYRVDVIPVNLPGEHGQRLPISRNTFAEVTGLSPGVTYYFKVFAVSHGRESKPLTAQQTTKLDAPTNLQFVNETDSTVLVRWTPPRAQITGYRLTVGLTRRGQPRQYNVGPSVSKYPLRNLQPASEYTVSLVAIKGNQESPKATGVFTTLQPGSSIPPYNTEVTETTIVITWTPAPRIGFKLGVRPSQGGEAPREVTSDSGSIVVSGLTPGVEYVYTIQVLRDGQERDAPIVNKVVTPLSPPTNLHLEANPDTGVLTVSWERSTTPDITGYRITTTPTNGQQGNSLEEVVHADQSSCTFDNLSPGLEYNVSVYTVKDDKESVPISDTIIPEVPQLTDLSFVDITDSSIGLRWTPLNSSTIIGYRITVVAAGEGIPIFEDFVDSSVGYYTVTGLEPGIDYDISVITLINGGESAPTTLTQQTAVPPPTDLRFTNIGPDTMRVTWAPPPSIDLTNFLVRYSPVKNEEDVAELSISPSDNAVVLTNLLPGTEYVVSVSSVYEQHESTPLRGRQKTGLDSPTGIDFSDITANSFTVHWIAPRATITGYRIRHHPEHFSGRPREDRVPHSRNSITLTNLTPGTEYVVSIVALNGREESPLLIGQQSTVSDVPRDLEVVAATPTSLLISWDAPAVTVRYYRITYGETGGNSPVQEFTVPGSKSTATISGLKPGVDYTITVYAVTGRGDSPASSKPISINYRTEIDKPSQMQVTDVQDNSISVKWLPSSSPVTGYRVTTTPKNGPGPTKTKTAGPDQTEMTIEGLQPTVEYVVSVYAQNPSGESQPLVQTAVTNIDRPKGLAFTDVDVDSIKIAWESPQGQVSRYRVTYSSPEDGIHELFPAPDGEEDTAELQGLRPGSEYTVSVVALHDDMESQPLIGTQSTAIPAPTDLKFTQVTPTSLSAQWTPPNVQLTGYRVRVTPKEKTGPMKEINLAPDSSSVVVSGLMVATKYEVSVYALKDTLTSRPAQGVVTTLENVSPPRRARVTDATETTITISWRTKTETITGFQVDAVPANGQTPIQRTIKPDVRSYTITGLQPGTDYKIYLYTLNDNARSSPVVIDASTAIDAPSNLRFLATTPNSLLVSWQPPRARITGYIIKYEKPGSPPREVVPRPRPGVTEATITGLEPGTEYTIYVIALKNNQKSEPLIGRKKTDELPQLVTLPHPNLHGPEILDVPSTVQKTPFVTHPGYDTGNGIQLPGTSGQQPSVGQQMIFEEHGFRRTTPPTTATPIRHRPRPYPPNVGEEIQIGHIPREDVDYHLYPHGPGLNPNASTGQEALSQTTISWAPFQDTSEYIISCHPVGTDEEPLQFRVPGTSTSATLTGLTRGATYNVIVEALKDQQRHKVREEVVTVGNSVNEGLNQPTDDSCFDPYTVSHYAVGDEWERMSESGFKLLCQCLGFGSRHFRCDSSRWCHDNGVNYKIGEKWDRQGENGQMMSCTCLGNGKGEFKCDPHEATCYDDGKTYHVGEQWQKEYLGAICSCTCFGGQRGWRCDNCRRPGGEPSPEGTTGQSYNQYSQRYHQRTNTNVNCPIECFMPLDVQADREDSRE
Application in preparation of kit
In a fourth aspect of the invention, the invention provides the use of an isolated nucleic acid or a gene mutation or an isolated protein reagent as described above in the preparation of a kit. According to an embodiment of the invention, the kit is for diagnosing a predisposition to fibronectin deposit glomerulopathy type 2. The inventors found that the FN1 gene coding region has a missense mutation c.6994g > C, and the amino acid sequence of the expressed protein has a corresponding mutation p.g2332r, which is closely related to the onset of fibronectin deposit glomerulopathy type 2, so that the presence or absence of the nucleic acid in a biological sample can be effectively diagnosed as being susceptible to fibronectin deposit glomerulopathy type 2.
According to an embodiment of the present invention, the reagent includes at least one of an antibody, a probe, and a primer. The antibody, the probe and the primer can effectively detect whether the mutation exists in a biological sample by specifically recognizing, combining and amplifying the c.6994G > C mutation of the FN1 gene, thereby effectively diagnosing whether the biological sample is susceptible to the fibronectin deposit glomerulopathy type 2.
According to an embodiment of the invention, the probe or primer has the sequence as shown in SEQ ID NO: 2 or 3. The inventors surprisingly found that by using these primers, amplification of an exon, in particular, an exon sequence in which the c.6994g > C mutation of FN1 gene is located, can be significantly efficiently accomplished in a PCR reaction system. It is noted that, SEQ ID NO: 2 or 3 is unexpectedly obtained by the inventors of the present invention after a hard work.
Figure BDA0001793143500000131
Use of biological model in screening drugs
In a fifth aspect of the invention, the invention proposes the use of a biological model for screening a drug. According to an embodiment of the invention, the biological model carries the isolated nucleic acid and/or the genetic mutation and/or the expression of the isolated protein. The inventor finds that FN1 gene coding region has a missense mutation c.6994G > C, the amino acid sequence of the expressed protein has a corresponding mutation p.G2332R, the mutation is closely related to the pathogenesis of the type 2 fibronectin deposit glomerulopathy, and by making a biological model carry the mutant nucleic acid, gene mutation or mutant protein, if the candidate drug can specifically change the mutations (for example, carry a back mutation), the candidate drug can be concluded to be the drug for treating the type 2 fibronectin deposit glomerulopathy. Therefore, the biological model of the invention can accurately screen out the medicine for treating the fibronectin deposit glomerular disease type 2.
According to an embodiment of the invention, the biological model is a cellular model or an animal model.
Medicine for treating fibronectin deposit glomerulopathy type 2
In a sixth aspect of the invention, the invention provides a medicament for the treatment of fibronectin deposit glomerulopathy type 2. According to an embodiment of the invention, the medicament comprises: an agent that specifically alters an isolated nucleic acid or a gene mutation or an isolated protein as described above. The inventors have found that the FN1 gene coding region has a missense mutation c.6994g > C, and the amino acid sequence of the expressed protein has a corresponding mutation p.g2332r, which is closely related to the onset of fibronectin deposit glomerulopathy type 2, and that the therapeutic purpose can be effectively achieved by applying to a patient a reagent capable of specifically altering nucleic acid or protein mutation (e.g., by back-mutation).
It is noted that the term "treatment" as used herein is intended to mean obtaining a desired pharmacological and/or physiological effect. The effect may be prophylactic in terms of complete or partial prevention of the disease or symptoms thereof, and/or may be therapeutic in terms of a partial or complete cure for the disease and/or adverse effects resulting from the disease. As used herein, "treatment" encompasses diseases in mammals, particularly humans, including: (a) preventing disease (e.g., preventing fibronectin deposit glomerulopathy type 2) or the development of a disorder in an individual who is susceptible to the disease but has not yet been diagnosed with the disease; (b) inhibiting a disease, e.g., arresting disease progression; or (c) alleviating the disease, e.g., alleviating symptoms associated with the disease. As used herein, "treatment" encompasses any administration of a drug or compound to an individual to treat, cure, alleviate, ameliorate, reduce, or inhibit a disease in the individual, including, but not limited to, administering a drug containing a compound described herein to an individual in need thereof.
System for screening biological samples susceptible to fibronectin deposit glomerulopathy type 2
In a seventh aspect of the invention, a system for screening a biological sample predisposed to fibronectin deposit glomerulopathy type 2 is provided.
Referring to fig. 1, the system 1000 for screening a biological sample susceptible to fibronectin deposit glomerulopathy type 2 according to an embodiment of the present invention includes a nucleic acid extracting means 100, a nucleic acid sequence determining means 200, and a judging means 300.
According to an embodiment of the present invention, the nucleic acid extraction apparatus 100 is used to extract a nucleic acid sample from a biological sample. As described above, according to the embodiment of the present invention, the type of the nucleic acid sample is not particularly limited, and for using RNA as the nucleic acid sample, the nucleic acid extraction apparatus further includes an RNA extraction unit 101 and a reverse transcription unit 102, wherein the extraction unit 101 is used for extracting the RNA sample from the biological sample, and the reverse transcription unit 102 is connected to the RNA extraction unit 101 for performing a reverse transcription reaction on the RNA sample to obtain a cDNA sample, and the obtained cDNA sample constitutes the nucleic acid sample.
According to an embodiment of the present invention, the nucleic acid sequence determining apparatus 200 is connected to the nucleic acid extracting apparatus 100, and is configured to analyze the nucleic acid sample to determine the nucleic acid sequence of the nucleic acid sample. As indicated above, sequencing methods can be used to determine the nucleic acid sequence of a nucleic acid sample. Thus, according to one embodiment of the present invention, the nucleic acid sequence determination apparatus 200 may further include: a library construction unit 201 and a sequencing unit 202. The library construction unit 201 is used for constructing a nucleic acid sequencing library aiming at a nucleic acid sample; the sequencing unit 202 is connected to the library construction unit 201 and is configured to sequence the nucleic acid sequencing library to obtain a sequencing result consisting of a plurality of sequencing data. As previously described, FN1 exon can be enriched by PCR amplification to further improve the efficiency of screening biological samples susceptible to fibronectin deposit glomerulopathy type 2. Thus, the library constructing unit 201 may further comprise a PCR amplification module (not shown) in which FN1 gene exon-specific primers are disposed to perform PCR amplification on the nucleic acid sample using FN1 exon-specific primers having the amino acid sequence as shown in SEQ ID NO: 2 or 3. According to an embodiment of the invention, the sequencing unit 202 may comprise at least one selected from the group consisting of hipseq 2000, SOLiD, 454 and a single molecule sequencing device. Therefore, by combining the latest sequencing technology, the higher sequencing depth can be achieved for a single site, and the detection sensitivity and accuracy are greatly improved, so that the characteristics of high throughput and deep sequencing of the sequencing devices can be utilized to further improve the efficiency of detecting and analyzing the nucleic acid sample. Therefore, the accuracy and the precision of the subsequent analysis of the sequencing data are improved.
According to an embodiment of the present invention, the judging means 300 is connected to the nucleic acid sequence determining means 200, and is adapted to compare the nucleic acid sequence of the nucleic acid sample with the nucleic acid sequence of SEQ ID NO:1 whether the biological sample is susceptible to fibronectin deposit glomerulopathy type 2. Specifically, the nucleic acid sequence based on the nucleic acid sample is identical to the nucleic acid sequence of SEQ ID NO:1, and judging whether the biological sample is susceptible to the fibronectin deposit glomerulopathy type 2 or not by judging whether the biological sample has the c.6994G > C mutation or not. According to one embodiment of the invention, the nucleic acid sequence of the nucleic acid sample or the complement thereof is identical to SEQ ID NO:1, having a c.6994g > C mutation, is indicative of a biological sample being susceptible to fibronectin deposit glomerulopathy type 2. According to one embodiment of the invention, the mutation is a heterozygous mutation. According to an embodiment of the invention, the nucleic acid sequence or the complement thereof is identical to SEQ ID NO:1, the device for performing the comparison is not particularly limited, and may be operated by any conventional software, and according to the specific example of the present invention, the comparison may be performed by SOAP software.
Thus, using this system, a biological sample susceptible to fibronectin deposit glomerulopathy type 2 can be effectively screened.
Kit for screening biological samples susceptible to fibronectin deposit glomerulopathy type 2
In an eighth aspect of the invention, a kit for screening a biological sample susceptible to fibronectin deposit glomerulopathy type 2 is provided. According to an embodiment of the invention, the kit comprises: a reagent suitable for detecting at least one of the isolated nucleic acids or genetic mutations or isolated proteins as described above, wherein the nucleic acid sequence of seq id no:1, the isolated nucleic acid or the mutation in the gene has a mutation selected from the group consisting of: c.6994G > C. Therefore, the kit provided by the embodiment of the invention can be used for efficiently screening the biological samples susceptible to the fibronectin deposit glomerulopathy type 2.
According to an embodiment of the present invention, the reagent includes at least one of an antibody, a probe, and a primer. The antibody, the probe and the primer can effectively detect whether the mutation exists in a biological sample by specifically recognizing, combining and amplifying the c.6994G > C mutation of the FN1 gene, thereby screening whether the biological sample is susceptible to the fibronectin deposit glomerulopathy type 2.
Construct
In a ninth aspect of the invention, the invention provides a construct. According to an embodiment of the invention, the construct comprises the isolated nucleic acid or the genetic mutation as described above. The construct of the invention contains the gene mutation of c.6994G > C, and the gene mutation can be transferred into a receptor cell, thereby realizing the screening, research and treatment of biological samples which are easy to suffer from fibronectin deposit glomerulopathy type 2.
Recombinant cell
In a tenth aspect of the invention, a recombinant cell is provided. According to an embodiment of the invention, the recombinant cell is obtained by transforming a recipient cell with the construct or expressing the isolated protein as described above. The recombinant cells according to the embodiment of the invention can be used for screening, researching and treating biological samples susceptible to the fibronectin deposit glomerulopathy type 2.
The scheme of the invention will be explained with reference to the examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples, where specific techniques or conditions are not indicated, are to be construed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
Example 1 determination of the causative Gene of fibronectin deposit glomerulopathy type 2
1. Collecting samples:
the inventors collected a fibronectin deposited glomerulopathy type 2 patient whose pedigree is shown in fig. 2, in which ⊙ indicates female carriers and ■ indicates male patients.
2. Whole exome sequencing
The inventors sequenced Exome sequences from patients in the fibronectin deposited glomerulopathy type 2 patient family shown in FIG. 2 using a custom-made NimbleGen SeqCap EZ exosome (10M) in combination with BGISEQ-500 high throughput sequencing technique. The experimental procedure is shown in fig. 3, and specifically as follows:
2.1DNA extraction
Collecting peripheral Blood of patient with fibronectin deposit glomerulopathy 2 shown in FIG. 3, extracting genomic DNA of each patient from the peripheral Blood sample with OMEGA Blood DNAmidi Kit whole Blood DNA extraction Kit, and measuring the concentration and purity of DNA with spectrophotometer, wherein the OD260/OD280 of each genomic DNA should be 1.7-2.0, the concentration is not less than 200 ng/microliter, and the total amount is not less than 30 micrograms.
2.2 genomic DNA fragmentation
A genome DNA sample is randomly broken into fragments of about 200-300bp by an ultrasonoscope Covaris LE220(Covaris 2, Massachusetts, USA), a 2% agarose gel is prepared to detect the broken DNA fragment range, the main band is 200-300bp, and if the fragments are larger, the fragments need to be broken according to actual conditions.
Table 1 interruption parameters
Parameter(s) Set value
Duty cycle(％) 21
PIP/Intensity 500
CPB 500
Treatment Time(s) 20s*14
2.3DNA fragment selection
Taking Ampure Beads stored at 4 ℃, standing at room temperature for 30min for balancing, sucking the cut sample (with the default volume of 75 mu L) from a 96-well plate to a shallow-well plate, adding 75 mu L of XP Beads, repeatedly blowing and beating for 20 times, uniformly mixing the sample and the magnetic Beads, standing at room temperature for 20min, and putting on a magnetic rack until the sample is clear. The supernatant was recovered to a shallow well plate, purified by addition of 37.5. mu.L XPBeads, and finally dissolved in 45. mu.L of TE. 2% agarose gel is prepared to detect the range of the broken DNA fragment, and the main band is required to be concentrated in 200-300 bp.
2.4 homogenization
The fragment selection was quantified using a Qubit (Qubit fluorimetric quantification, Thermo Scientific), the initial pool building up to 50ng was normalized to the determined concentration, and the total volume was made up to 40. mu.L by adding TE.
2.5 end repair and addition of "A"
First, 5:1dATP was prepared in the ratio of table 2: dNTP mixed solution, fully mixing and using.
TABLE 25 1dATP dNTP mix solution
Figure BDA0001793143500000171
Figure BDA0001793143500000181
The enzyme reaction system was then formulated as per table 3:
TABLE 3 end repair and A enzyme addition reaction System
Number of reactions 1 reaction (. mu.L)
10X PNK Buffer 5
5:1dATP:dNTP 0.6
T4PNK(10U/μL) 0.6
Klenow fragment(5U/μL) 0.1
rTaq(5U/μL) 0.2
T4DNA polymerase(3U/μL) 2
Nuclease-Free water 1.5
Total volume 10
Putting the sample into a PCR instrument for reaction, wherein the reaction conditions are as follows: 30min at 37 ℃; 15min at 65 ℃; hold at 4 ℃.
2.6 end repair and addition of "A"
mu.L of 10. mu.M Ad153-2B Adapter Barcode was added to a 50. mu.L system after completion of the one-step reaction.
The reaction system was prepared as in table 4:
TABLE 4 linker ligation reaction System
Number of reactions 1 reaction (. mu.L)
Nuclease-Free water 3.6
ATP(100mM) 0.8
10X PNK Buffer 3
50％PEG8000 16
T4DNA Ligase(600U/μL) 1.6
Total volume 25
Adding 25 mu L of the reaction system into a sample containing Barcode, mixing uniformly, sealing a membrane and centrifuging. Putting the sample into a PCR instrument for reaction, wherein the reaction conditions are as follows: 60min at 23 ℃; hold at 4 ℃. After the reaction, 20. mu.L of TE buffer was added to the sample to make the total volume of the sample 100. mu.L, and 50. mu.L of XPBeads was added for purification and finally dissolved in 48. mu.L of TE. After purification, the purified ligation product was quantified using the Qubit HS.
2.7PCR
PCR reaction systems were prepared as per table 5:
TABLE 5 PCR reaction System
Number of reactions 1 reaction (. mu.L)
2X KAPA HiFi HotStart ReadyMix 100μL
Nuclease-Free water 44μL
AD153-F(SEQ ID NO：2)(20μM) 6μL
AD153-R(SEQ ID NO：3)((20μM) 6μL
Total volume 156μL
The 156. mu.L reaction was added to 44. mu.L of the ligation product and mixed well, and PCR was carried out in 2 tubes (100. mu.L per tube).
The samples were placed in a PCR instrument for PCR reaction according to the reaction conditions of Table 6:
TABLE 6 PCR reaction conditions
Figure BDA0001793143500000191
After completion of the reaction, 200. mu.L of XP Beads were added for purification and finally dissolved in 45. mu.L of TE. After purification, the purified PCR product was quantified using QubitHS. 2% agarose gel was prepared to detect the range of DNA fragments after PCR, requiring the main bands to be concentrated: 250-350 bp.
2.8 hybridization
The sample loading volume was calculated as 1. mu.g per chip, based on the total amount of the posing tubes (one tube ready for use), i.e., 2. mu.g, and the posing was mixed well.
Preparation of linker Block 8. mu.L of Block 3 and 8. mu.L of Block 4 were added.
The Cot-1 DNA was dispensed at 10. mu.g per tube. Marking the corresponding sample number on the Cot-1 DNA tube, and adding the poolling sample and the prepared linker block into the Cot-1 DNA tube.
The hybridization mixture now contains the following components:
TABLE 7 ingredient tables
Pooling sample 1μg
Block 3(100μM) 8μL
Block 4(100μM) 8μL
cot-1DNA 1 tube (10 mug)
The tube caps were closed, a well was punched into the sub-loaded EP tube caps with a clean syringe needle, and the mixture of the sample library and the block was placed in a vacuum concentrator and evaporated to dryness in a mode set to V-AQ and a temperature set at 60 ℃.
The dry heater was adjusted to 95 ℃ and 4.5. mu.L of the Exome Library dispensed was removed from the freezer at-20 ℃ and thawed on ice.
The sample was removed and the following two reagents were added: 7.5 μ L of 2 XSC hybridization Buffer and 3 μ L of LSCHybridization Component A.
The sample is shaken and mixed evenly and then placed on a centrifuge for full speed centrifugation for 10 s. The centrifuged sample was transferred to a 95 ℃ dry heater for 10min, and was taken out every 5min, shaken and centrifuged.
The sample was removed, shaken, mixed and centrifuged at full speed for 10 seconds at room temperature.
The hybridization mixture was transferred to 4.5. mu.L of Exome Library (0.2mL PCR tube or 96-well PCR plate, shaken, mixed and centrifuged in a centrifuge for 10 seconds at full speed.
The mixture is placed on a PCR instrument for hybridization for 64h-72h at 47 ℃, and a thermal cover of the PCR instrument is arranged and kept at 57 ℃.
2.9 elution
The required Buffer reagent is unfrozen in advance, and five Buffer reagents (10XSC Wash Buffer I, 10 XSCcoast Buffer II, 10XSC Wash Buffer III, 10XStringent Wash Buffer and 2.5XBindingbuffer) are diluted according to the proportion to prepare a 1X solution. Wherein Buffer I was divided into two tubes, one tube preheated at 47 deg.C (110. mu.L) and one tube at room temperature (220. mu.L).
TABLE 8 elution System
Name of reagent Single tube dosage stock solution (mu L) Single tube adding H2O(μL)
Binding Buffer 220 330
BufferⅠ 33 297
BufferⅡ 22 198
BufferⅢ 22 198
Buffer S 44 396
Preheat the following solutions at 47 ℃:
1X Stringent Wash Buffer and 1X SC Wash Buffer I
And taking out the streptomycin magnetic beads from a refrigerator at 4 ℃, uniformly mixing, and balancing for 30min for later use.
After 100ul of magnetic beads were added to a 1.5mL EP tube, the EP tube was placed on a magnetic stand until the liquid was clarified, and the supernatant was removed.
Add 200. mu.L of Streptavidin Dynabead Binding and Wash Buffer, Vortex 10s mix well, place the EP tube on the magnetic rack until the liquid is clear, remove the supernatant, repeat the sequence, total two washes.
The magnetic beads were suspended in a 200. mu.L EP tube pipetted 100. mu.L of Streptavidin Dynabead Binding and Wash Buffer.
The magnetic beads are attached to the magnetic stand (the vial is placed against the magnetic stand) until the liquid is clarified and the supernatant is removed, and the beads are used to bind the captured DNA.
The hybridization mixture was transferred to prepared magnetic beads and vortexed 10 times.
The vials were incubated at 47 ℃ for 45min on a PCR machine (the PCR machine thermal lid should be set to 57 ℃ and removed every 15min at vortex 3s to prevent the beads from settling)
After 45min incubation, the product was transferred to a 1.5mL EP tube, which was then placed on a magnetic rack until the liquid was clear and the supernatant was removed.
Add 100. mu.l of 1 XWash Buffer 1, vortex 10s at 47 ℃ and mix well, place the EP tube on the magnetic stand until the liquid is clear, remove the supernatant.
Removing the EP tube from the magnetic frame, adding 200 μ L of 47 deg.C 1X Stringent Wash Buffer, pipetting, mixing well for 10 times, incubating at 47 deg.C for 5min, placing the EP tube on the magnetic frame until the liquid is clear, and removing the supernatant. This procedure was repeated once more, i.e. twice with a 1XStringent Wash Buffer Wash.
Add 200. mu.l of 1 XWash Buffer I at room temperature, mix well on vortex for 2min, place the EP tube on the magnetic stand until the liquid is clear, remove the supernatant.
Add 200. mu.l of 1 XWash Buffer II at room temperature, mix well on vortex for 1min, place the EP tube on the magnetic stand until the liquid is clear, remove the supernatant.
Add 200. mu.l of 1 XWash Buffer III at room temperature, mix well on vortex for 30s, place the EP tube on the magnetic stand until the liquid is clear, remove the supernatant.
Add 44. mu.l TE (PCR can be performed directly without eluting DNA from the beads).
2.10Post-PCR
The reaction system was prepared as in table 9:
TABLE 9 Post-PCR reaction System
Figure BDA0001793143500000211
Figure BDA0001793143500000221
The 156. mu.L reaction was added to the 44. mu.L product of the above step, mixed well, divided into 2 tubes (100. mu.L per tube), and subjected to PCR reaction according to the procedure of Table 10:
TABLE 10 PCR procedure
Figure BDA0001793143500000222
The XP Beads were equilibrated at room temperature for 30 min.
Transferring the 2-tube PCR product into a 1.5mL EP tube, then placing the EP tube on a magnetic frame until the EP tube is clarified, transferring the supernatant into the EP tube with the corresponding tube number, and discarding the streptomycin magnetic beads. 1 time of magnetic beads (200. mu.L) were added to the supernatant, and the mixture was pipetted and mixed. Standing at room temperature for 10min to make the magnetic beads and DNA fully combined.
The EP tube was placed on a magnetic stand until the liquid was clear and the supernatant was removed.
500 μ L of 70% ethanol (now ready for use) was added and the ethanol was removed by inverting ten times. This step is repeated.
Standing at room temperature until the residual ethanol volatilizes and the surface of the magnetic beads does not reflect light.
Adding 45 mu l of TE, sucking, beating and uniformly mixing; the mixture was allowed to stand at room temperature for 5min to completely elute the DNA from the beads.
The EP tube was placed on a magnetic stand until clear, and 40. mu.l of the supernatant was pipetted into the EP tube of the corresponding tube number.
After purification is completed, the purified PCR product is quantified by the Qubit HS and sent to QC detection 2100 and enrichment.
2.11 cyclization
The initial amount of sample used in the next library preparation reaction was normalized to the concentration determined in the previous step, adjusted uniformly to 330ng, pooled to 60. mu.L with TE, and subtracted from the water of the circularized Mix if the volume is greater than 60. mu.L.
To the homogenized sample, 10. mu.L of 10mM Ad153splin oligo was added, and the mixture was centrifuged.
Placing the sample in a PCR instrument for reaction at 95 ℃ for 3 min; after the reaction, the reaction mixture was quickly taken out and placed on ice for cooling.
The reaction Mix was prepared in advance as in table 11:
TABLE 11 cyclization reaction Mix
Figure BDA0001793143500000223
Figure BDA0001793143500000231
Adding reaction Mix 50 μ L into the single-chain separation product, mixing and centrifuging.
Placing the reaction system on a PCR instrument for reaction: 37 ℃ for 60 min.
2.12make DNB
And (3) taking 20 mu L of the cyclized DNA library to a 0.2mL PCR tube, adding 20 mu L of DNB preparation buffer solution into the PCR tube, shaking and uniformly mixing, performing instantaneous centrifugation, and placing the mixture in a PCR instrument for reaction. The PCR procedure was: 1min at 95 ℃, 1min at 65 ℃, 1min at 40 ℃ and infinity (1cycle) at 4 ℃. And (3) taking out the PCR tube after the procedure is finished, adding 40 mu L of DNB polymerase mixed solution I, adding 4 mu L of DNB polymerase mixed solution II, shaking, uniformly mixing, centrifuging instantaneously, and immediately placing in a PCR instrument for reaction. The PCR procedure was: 30 ℃ for 20min, 4 ℃ infinity (1 cycle). When the temperature of the PCR instrument was lowered to 4 ℃, the running procedure was immediately terminated, the PCR tube was taken out and placed on an ice box, and 20. mu.L of DNB stop buffer was immediately added. After DNB preparation was complete, DNB concentration was measured using a Qubit fluorometer and ssDNA detection kit. The concentration is generally 10-40 ng/mul.
2.13 sequencing
The invention selects a BGISEQ-500 high-throughput sequencing platform and a PE100 sequencing strategy for sequencing.
3. Mutation detection, annotation, and database comparison
Using SOAPnuke (https:// githu)com/BGI-flexlab/soapunke) the raw sequencing data obtained above was processed, filtered to remove contamination, and then used with SOAPaligner/SOAP2 (see: li R, Li Y, Kristiansen K, et al, SOAP: short oligonucleotide alignment program. bioinformatics 2008,24(5): 713-; li R, Yu C, Li Y, ea al, SOAP2, amplified ultra fast tool for short read alignment. bioinformatics 2009,25(15):1966-,http://genome.ucsc.edu/) In order to obtain a unique alignment sequence aligned to the genome. The genotype of the target region is then determined using SOAPsnp (see: Li R, Li Y, Fang X, Yang H, et al, SNP detection for mapping parallel gene-genotyping. genome Res 2009,19(6): 1124-1132).
Among them, after obtaining the sequencing results, three types of most likely pathologically relevant mutations, i.e., non-synonymous mutations, splice acceptor/donor site mutations, coding region insertion and deletion mutations, were studied. Then through four public databases: dbSNP database (http://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/ snp132.txt.gzWorking), HapMap database (ftp://ftp.ncbi.nlm.nih.gov/hapmap) Thousand people genome database (ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp) Yanhuang database (http:// yh.genomics.org.cn/) Removing all known variations with allele frequencies greater than 0.005 in the database.
Through normal human SNP screening, the following mutations are found not to be included in databases such as dbSNP, HapMap, thousand human genome database and the like. Studies have found that humans have a large number of rare varieties, many of which are harmful due to rapid population growth and weakness in negative selection (Nelson MR, Wegmann D, Ehm MG, et al. an unprecedented of random functional varieties in 202 drug target genes sequence in 14,002 pest science (New York, NY) 2012; 337(6090):100-104.doi: 10.1126/science.1217876.).
TABLE 11 sites of mutations
Gene Subregions Coordinates of genome Nucleotide changes Amino acid changes
FN1 Exon42 chr2:216232610 c.6994G>C p.G2332R
Further, we used protein function prediction software SIFT: (http://sift.jcvi.org/www/SIFT_ enst_submit.html)，PolyPhen-2v2.2.2r398(http://genetics.bwh.harvard.edu/ pph2/)，PROVEAN(http://provean.jcvi.org/seq_submit.php)，MutatiorTaster(http:// www.mutationtaster.org/) The function of this site was predicted and the results are shown in Table 12. The predicted result is consistent with the hypothesis that the site will lead to the change of protein function, and is strongly related to diseases.
TABLE 12 functional prediction software results
Figure BDA0001793143500000241
In addition, functional domains and conservation of genes are analyzed, and the conserved sequence generally indicates that the gene has potential functions or may play an important role in cell development and regulation. Reference CDD database (https:// www.ncbi.nlm.nih.gov/cdd) The mutation site is located in the fibronectin type 1 domain (FIG. 4), this junctionThe domain is about 40 residues long with two conserved disulfide bridges. FN1 is one of three types of internal repeats of the gene structure that form a larger domain in fibronectin. Fibronectin is a plasma protein that binds to cell surfaces and various compounds (including collagen, fibrin, heparin, DNA, and actin), usually in the form of dimers in plasma, and insoluble polymers in the extracellular matrix. Dimers of nearly identical subunits are linked by disulfide bonds near their C-termini. The FN1 domain is also found in factor XII, HGF activators and tissue plasminogen activator. In tissue plasminogen activators, the FN1 domain may form a functional fibrin-binding unit with an EGF-like domain C-terminal to FN1 (1.Williams M J, Phan I, Harvey T S, et al. solution structure of antibody of fibrin type 1 modules with fibrin binding activity, [ J.].Journalof Molecular Biology,1994,235(4):1302-1311.2.Baron M,Norman D,Willis A,etal.Structure of the fibronectin type 1module.[J].Nature,1990,345(6276):642.3.Potts J R,Campbell I D.Fibronectin structure and assembly[J]CurrentOption in Cell Biology,1994,6(5): 648). We selected 8 mammals: humans (Homosapiens), cattle (Bos taurus), dogs (Canis lupus farmiaris), horses (Equus caballus), rhesus monkeys (Macaca mulatta), mice (mus musculus), rats (Rattus norvegicus), and wild pigs (Susscrofa); birds 1 species: rooster (Gallus gallous). The alignment was performed based on the amino acids of the FN1 protein queried at NCBI. Running CLUSTALW (http://www.genome.jp/tools-bin/clustalw) The alignment is shown in FIG. 5, which shows that the site is highly conserved. Based on the above results, the inventors found that c.6994G on FN1 gene>The C mutation may be the site of pathogenesis in patients with fibronectin deposit glomerulopathy type 2.
In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.
Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

Claims (10)

1. An isolated nucleic acid that hybridizes to SEQ ID NO:1, the isolated nucleic acid has a mutation selected from the group consisting of: c.6994G > C;
optionally, the isolated nucleic acid is DNA.
2. A genetic mutation which hybridizes to SEQ ID NO:1, having a mutation selected from the group consisting of: c.6994G > C.
3. An isolated protein that hybridizes to SEQ ID NO:1, the amino acid sequence of said isolated protein has a mutation selected from the group consisting of: p.G2332R.
4. Use of a reagent for detecting the isolated nucleic acid of claim 1 or the genetic mutation of claim 2 or the isolated protein of claim 3 in the preparation of a kit for diagnosing a predisposition to fibronectin deposit glomerulopathy type 2;
optionally, the reagent comprises at least one of an antibody, a probe, and a primer;
optionally, the probe or primer has the sequence as shown in SEQ ID NO: 2 or 3.
5. Use of a biological model carrying the isolated nucleic acid of claim 1 and/or the genetic mutation of claim 2 and/or expressing the isolated protein of claim 3 for screening for a drug;
optionally, the biological model is a cellular model or an animal model.
6. A medicament for the treatment of fibronectin deposit glomerulopathy type 2, comprising:
a reagent that specifically alters the isolated nucleic acid of claim 1 or the genetic mutation of claim 2 or the isolated protein of claim 3.
7. A system for screening a biological sample susceptible to fibronectin deposit glomerulopathy type 2 comprising:
a nucleic acid extraction device for extracting a nucleic acid sample from the biological sample;
a nucleic acid sequence determining device connected with the nucleic acid extracting device and used for analyzing the nucleic acid sample so as to determine the nucleic acid sequence of the nucleic acid sample;
a judging means connected to the nucleic acid sequence determining means so as to compare the nucleic acid sequence of the nucleic acid sample or a complementary sequence thereof with the nucleic acid sequence of SEQ ID NO:1, has a mutation selected from the group consisting of: c.6994G > C mutation, judging whether the biological sample is susceptible to fibronectin deposit glomerulopathy type 2;
optionally, the nucleic acid extraction device further comprises:
an RNA extraction unit for extracting an RNA sample from the biological sample; and
a reverse transcription unit connected to the RNA extraction unit for performing a reverse transcription reaction on the RNA sample to obtain a cDNA sample, the cDNA sample constituting the nucleic acid sample;
optionally, the mutation is a heterozygous mutation;
optionally, the nucleic acid sequence determination apparatus further comprises:
a library construction unit for constructing a nucleic acid sequencing library for the nucleic acid sample; and
the sequencing unit is connected with the library construction unit and is used for sequencing the nucleic acid sequencing library so as to obtain a sequencing result consisting of a plurality of sequencing data;
optionally, the library construction unit further comprises:
a PCR amplification module, wherein FN1 gene exon specific primers are arranged in the PCR amplification module so as to perform PCR amplification on the nucleic acid sample by using the specific primers;
optionally, the specific primer has the sequence shown in SEQ ID NO: 2 or 3 or a nucleotide sequence shown in the sequence table,
optionally, the sequencing unit comprises at least one selected from the group consisting of hipseq 2000, SOLiD, 454 and a single molecule sequencing device.
8. A kit for screening a biological sample susceptible to fibronectin deposit glomerulopathy type 2 comprising:
a reagent suitable for detecting at least one of the isolated nucleic acid of claim 1 or the genetic mutation of claim 2 or the isolated protein of claim 3, wherein
And SEQ ID NO:1, the isolated nucleic acid or gene mutation has a mutation selected from the group consisting of: c.6994G > C;
optionally, the reagent comprises at least one of an antibody, a probe, and a primer,
optionally, the probe or primer has the sequence as shown in SEQ ID NO: 2 or 3.
9. A construct comprising the isolated nucleic acid of claim 1 or the genetic mutation of claim 2.
10. A recombinant cell obtained by transforming a recipient cell with the construct of claim 9 or expressing the isolated protein of claim 3.
CN201811045298.2A 2018-09-07 2018-09-07 FN1 gene mutation and application thereof Pending CN110885830A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811045298.2A CN110885830A (en) 2018-09-07 2018-09-07 FN1 gene mutation and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811045298.2A CN110885830A (en) 2018-09-07 2018-09-07 FN1 gene mutation and application thereof

Publications (1)

Publication Number Publication Date
CN110885830A true CN110885830A (en) 2020-03-17

Family

ID=69744731

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811045298.2A Pending CN110885830A (en) 2018-09-07 2018-09-07 FN1 gene mutation and application thereof

Country Status (1)

Country Link
CN (1) CN110885830A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112941081A (en) * 2021-04-16 2021-06-11 广州启点生物科技有限公司 Coding sequence of fibronectin mutant with high expression quantity and strong activity and application thereof
CN113527525A (en) * 2021-09-14 2021-10-22 美慕(北京)科技有限公司 Recombinant protein and construction method and application thereof
CN114085900A (en) * 2021-11-22 2022-02-25 百世诺(北京)医学检验实验室有限公司 Mutant gene related to hereditary glomerular disease and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102084000A (en) * 2008-02-01 2011-06-01 总医院有限公司 Use of microvesicles in diagnosis, prognosis and treatment of medical diseases and conditions
CN104822844A (en) * 2012-10-01 2015-08-05 米伦纽姆医药公司 Biomarkers and methods to predict response to inhibitors and uses thereof
CN108410979A (en) * 2018-05-25 2018-08-17 安徽华大医学检验所有限公司 Chip that is a kind of while detecting single-gene disorder and chromosomal disorders and its application

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102084000A (en) * 2008-02-01 2011-06-01 总医院有限公司 Use of microvesicles in diagnosis, prognosis and treatment of medical diseases and conditions
CN104822844A (en) * 2012-10-01 2015-08-05 米伦纽姆医药公司 Biomarkers and methods to predict response to inhibitors and uses thereof
CN108410979A (en) * 2018-05-25 2018-08-17 安徽华大医学检验所有限公司 Chip that is a kind of while detecting single-gene disorder and chromosomal disorders and its application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
FEDERICA CASTELLETTI: "Mutations in FN1 cause glomerulopathy with fibronectin deposits", 《PROC NATL ACAD SCI U S A》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112941081A (en) * 2021-04-16 2021-06-11 广州启点生物科技有限公司 Coding sequence of fibronectin mutant with high expression quantity and strong activity and application thereof
CN112941081B (en) * 2021-04-16 2023-04-21 广州启点生物科技有限公司 Fibronectin mutant and preparation method and application thereof
CN113527525A (en) * 2021-09-14 2021-10-22 美慕(北京)科技有限公司 Recombinant protein and construction method and application thereof
CN114085900A (en) * 2021-11-22 2022-02-25 百世诺(北京)医学检验实验室有限公司 Mutant gene related to hereditary glomerular disease and application thereof

Similar Documents

Publication Publication Date Title
Bonnet et al. An innovative strategy for the molecular diagnosis of Usher syndrome identifies causal biallelic mutations in 93% of European patients
Schlecht et al. Expression profiling of mammalian male meiosis and gametogenesis identifies novel candidate genes for roles in the regulation of fertility
Yu et al. A comparative analysis of liver transcriptome suggests divergent liver function among human, mouse and rat
US20070172853A1 (en) Use of deletion polymorphisms to predict, prevent, and manage histoincompatibility
JP7232643B2 (en) Deep sequencing profiling of tumors
Hitzemann et al. A strategy for the integration of QTL, gene expression, and sequence analyses
Rentas et al. Diagnosing Cornelia de Lange syndrome and related neurodevelopmental disorders using RNA sequencing
CN110885830A (en) FN1 gene mutation and application thereof
JP6568162B2 (en) Genetic factors associated with the development of inhibitors in hemophilia A
CN110684838A (en) Kit for detecting gene of hypertrophic cardiomyopathy
WO2002006536A2 (en) Methods and compositions for perioperative genomic profiling
WO2015184249A2 (en) Sle and sle-related disease-associated risk markers and uses thereof
AU2016351311B9 (en) SCAP gene mutant and the application thereof
WO2015133911A1 (en) Gene expression profiling for the diagnosis of prostate cancers
KR101927343B1 (en) Composition, kit for predicting the risk of developing hypertriglyceridemia, and method using the same
WO2010057132A1 (en) Genetic alterations associated with schizophrenia and methods of use thereof for the diagnosis and treatment of the same
WO2005072152A2 (en) Apoc1 genetic markers associated with age of onset of alzheimer's disease
CN104178487A (en) ATM gene mutant and its application
US20130157873A1 (en) Methods of assessing a risk of developing necrotizing meningoencephalitis
Shen et al. Identification of HLA-DQA1 as a susceptibility gene for spinal tuberculosis by exome sequencing
EP4041921A1 (en) Use of simultaneous marker detection for assessing difuse glioma and responsiveness to treatment
CN105802974B (en) BCS1L gene mutant and application thereof
AU2004281738A1 (en) NTRK1 genetic markers associated with age of onset of Alzheimer's Disease
CN105779463B (en) VPS13B gene mutation body and its application
CA2547033A1 (en) Ntrk1 genetic markers associated with progression of alzheimer's disease

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination