CN110885281A - Tetracyclic diterpenoid compounds and preparation method and application thereof - Google Patents
Tetracyclic diterpenoid compounds and preparation method and application thereof Download PDFInfo
- Publication number
- CN110885281A CN110885281A CN201911072144.7A CN201911072144A CN110885281A CN 110885281 A CN110885281 A CN 110885281A CN 201911072144 A CN201911072144 A CN 201911072144A CN 110885281 A CN110885281 A CN 110885281A
- Authority
- CN
- China
- Prior art keywords
- vena
- venezuelan
- vend
- venezuelae
- venc
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C13/00—Cyclic hydrocarbons containing rings other than, or in addition to, six-membered aromatic rings
- C07C13/28—Polycyclic hydrocarbons or acyclic hydrocarbon derivatives thereof
- C07C13/32—Polycyclic hydrocarbons or acyclic hydrocarbon derivatives thereof with condensed rings
- C07C13/62—Polycyclic hydrocarbons or acyclic hydrocarbon derivatives thereof with condensed rings with more than three condensed rings
- C07C13/66—Polycyclic hydrocarbons or acyclic hydrocarbon derivatives thereof with condensed rings with more than three condensed rings the condensed ring system contains only four rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C49/00—Ketones; Ketenes; Dimeric ketenes; Ketonic chelates
- C07C49/587—Unsaturated compounds containing a keto groups being part of a ring
- C07C49/613—Unsaturated compounds containing a keto groups being part of a ring polycyclic
- C07C49/617—Unsaturated compounds containing a keto groups being part of a ring polycyclic a keto group being part of a condensed ring system
-
- C—CHEMISTRY; METALLURGY
- C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
- C11B—PRODUCING, e.g. BY PRESSING RAW MATERIALS OR BY EXTRACTION FROM WASTE MATERIALS, REFINING OR PRESERVING FATS, FATTY SUBSTANCES, e.g. LANOLIN, FATTY OILS OR WAXES; ESSENTIAL OILS; PERFUMES
- C11B9/00—Essential oils; Perfumes
- C11B9/0042—Essential oils; Perfumes compounds containing condensed hydrocarbon rings
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
- C12N9/0036—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)
- C12N9/0038—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6) with a heme protein as acceptor (1.6.2)
- C12N9/0042—NADPH-cytochrome P450 reductase (1.6.2.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P15/00—Preparation of compounds containing at least three condensed carbocyclic rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C2603/00—Systems containing at least three condensed rings
- C07C2603/02—Ortho- or ortho- and peri-condensed systems
- C07C2603/40—Ortho- or ortho- and peri-condensed systems containing four condensed rings
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y106/00—Oxidoreductases acting on NADH or NADPH (1.6)
- C12Y106/02—Oxidoreductases acting on NADH or NADPH (1.6) with a heme protein as acceptor (1.6.2)
- C12Y106/02004—NADPH-hemoprotein reductase (1.6.2.4), i.e. NADP-cytochrome P450-reductase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
- C12Y205/01029—Geranylgeranyl diphosphate synthase (2.5.1.29)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses a tetracyclic diterpenoid compound which contains a chemical molecular formula of C20H32The venezuelan A and the chemical formula of C20H30Venezuelan B of O; the compound is prepared by reacting venezuelan A with venezuleneThe mode of activating the self-silencing gene cluster of the biosynthesis gene cluster B and heterogeneously expressing the gene cluster realizes the expression of genes in the venezuelan A and B biosynthesis gene clusters in streptomycete and escherichia coli, and the whole operation process is simple, mature in process, low in cost and environment-friendly. The venezuelan A and venezuelan B products obtained by the method are expected to be applied to the fields of food, spice, pharmaceutical chemicals and the like.
Description
Technical Field
The invention belongs to the fields of natural product chemistry, biochemistry, molecular biology and genetic engineering, and particularly relates to tetracyclic diterpenoid compounds and a preparation method and application thereof.
Background
To date, over 80,000 terpenoids have been found in humans, animals, plants and microorganisms. Terpenoids are composed of multiple isoprene building blocks and represent the largest class of natural products[1,2]. In general, biosynthesis of parent core structure (terpene) of terpenoids involves the catalytic cyclization of a carbon chain-limited polyprenyl pyrophosphate (C5n, n-2, 3, 4, etc.) by terpene synthase to give a complex hydrocarbon backbone containing multiple rings and chiral centers[3,4]. For example, monoterpenes are cyclized from geranylgeranyl pyrophosphate (C10), sesquiterpenes are cyclized from farnesyl pyrophosphate (C15), diterpenes are cyclized from geranylgeranyl pyrophosphate (C20), and the like. Further, a compound with a more complex and diverse structural skeleton and physicochemical properties is formed by the catalytic action of post-modification enzymes such as cytochrome P450 enzyme, FAD-dependent oxidase, methyl, acyl and glycosyltransferase[2]. The terpenoid has rich and diverse physiological activities, such as tumor resistance, malaria resistance, bacteria resistance, virus resistance, inflammation resistance, immunosuppression and the like, has wide application value and prospect in the fields of medical care, food, cosmetics, pesticides, veterinary drugs, chemical industry and the like, and is inseparable from the life production of people[5,6]. Typical terpenoids are represented by the class of "Nozaki" antimalarial drugs artemisinin[7](ii) a Paclitaxel as clinical candidate drug with strong antitumor activity[8](ii) a Steroid hormones essential for human and mammals and widely involved in growth, development and metabolic regulation in vivo[9](ii) a Active steroid saponin compound widely existing in traditional Chinese medicine[10]. Moreover, the natural pigment and the flavoring agent which are derived from plants are terpenoids, so the natural pigment and the flavoring agent have wide application in the industries of food, essence and flavor[11]For example, the commonly used natural pigments β -carotene, tomatoErythrogenin, astaxanthin, and the like; food flavoring agents such as menthol, stevioside, etc.; essence, spice, perfume and perfume fixative ambrox, etc.
However, due to resource and technical limitations, especially the disadvantages of long growth cycle, low yield of terpenoids and high acquisition cost of plants (main sources of terpenoids), it is increasingly difficult for people to obtain terpenoids with novel frameworks directly from nature to serve production and life. Meanwhile, the traditional chemical synthesis method for obtaining new terpenoid has the defects of multiple reaction steps, poor catalytic selectivity, inadequately mild conditions, environmental pollution and the like, and more importantly, the method has limited capability of obtaining a brand new structural framework. In recent years, with the rapid development of genome sequencing technology and bioinformatics, it has been found that microorganisms also have considerable terpenoid production potential. Therefore, through the whole genome analysis aiming at single microorganism, the strategy of combining biochemistry, molecular biology and natural product chemistry is an important means for exploring novel terpenoid for basic and application scientific research[12]。
Streptomyces venezuelae ATCC15439 is a model strain in the field of natural product biosynthesis research, high-quality whole genome data of the strain is published (GenBank: CP013129), secondary metabolites of the strain are rich, and a genetic operation system is complete. However, the search found that there is no report of expressing a gene in the biosynthetic gene cluster (GenBank: MN508361) of venezuelan in Streptomyces venezuelae (Streptomyces venezuelae ATCC 15439) by a silent gene activation method to produce a terpenoid, particularly venezuelan A or venezuelan B, or expressing a gene in the biosynthetic gene cluster of venezuelan in Streptomyces venezuelae (Streptomyces venezuelae ATCC 15439) by a heterologous expression method in Escherichia coli to produce a terpenoid, particularly venezuelan A or venezuelan B, and isolating and purifying the terpenoid.
Reference to the literature
[1]MURAI K,LAUTERBACH L,TERAMOTOK,et al.An unusual skeletalrearrangement in the biosynthesis of the sesquiterpene trichobrasilenol fromTrichoderma[J].Angew Chem,2019,131(42):15188-92.
[2]DICKSCHAT J S.Bacterial terpene cyclases[J].Nat Prod Rep,2016,33(1):87-110.
[3]CHRISTIANSON D W.Structural and chemical biology of terpenoidcyclases[J].Chem Rev,2017,117(17):11570-648.
[4]CHRISTIANSON D W.Structural biology and chemistry of the terpenoidcyclases[J].Chem Rev,2006,106(8):3412-42.
[5]HUANG M,LU J-J,HUANG M-Q,et al.Terpenoids:natural products forcancer therapy[J].Expert Opin Inv Drug,2012,21(12):1801-18.
[6]MORIKAWA T,MATSUDA H,YOSHIKAWA M.A review of anti-inflammatoryterpenoids from the incense gum resins frankincense and myrrh[J].J Oleo Sci,2017,ess16149.
[7]KLAYMAN D L.Qinghaosu(artemisinin):an antimalarial drug from China[J].Science,1985,228(4703):1049-55.
[8]ROWINSKY E K,DONEHOWER R C.Paclitaxel(taxol)[J].New Engl J Med,1995,332(15):1004-14.
[9]GOWER D.Modifiers of steroid-hormone metabolism:a review of theirchemistry,biochemistry and clinical applications[J].J Steroid Biochem,1974,5(5):501-23.
[10]MAHATO S B,SARKAR S K,PODDAR G.Triterpenoid saponins[J].Phytochemistry,1988,27(10):3037-67.
[11]BOHLMANN J,KEELING C I.Terpenoid biomaterials[J].The PlantJournal,2008,54(4):656-69.
[12]YAMADA Y,KUZUYAMA T,KOMATSU M,et al.Terpene synthases are widelydistributed in bacteria[J].Proc Natl Acad Sci,2015,112(3):857-62.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide a tetracyclic diterpenoid compound and a preparation method and application thereof.
The tetracyclic diterpenoid compounds comprise venezuelane A (venezuelaene A) and venezuelane B (venezuelane B), and specifically comprise the following components in parts by weight:
a tetracyclic diterpenoid compound characterized by: the compound is a compound containing a 5-5-6-7 tetracyclic diterpene framework, and the chemical molecular formula of the compound is C20H32The structural formula is shown as formula (1) and is named as: venezuelayene a (venezuelaenea);
a tetracyclic diterpenoid compound characterized by: the compound is a compound containing a 5-5-6-7 tetracyclic diterpene framework, and the chemical molecular formula of the compound is C20H30O, the structural formula is shown as formula (2), and the name is: venezuelanene b (venezuelaeneb);
the preparation method of the tetracyclic diterpenoid compound is characterized by comprising the following steps: the venezuelae A or the venezuelae B is obtained by expressing genes in a biosynthetic gene cluster of venezuelae in Streptomyces venezuelae (Streptomyces venezuelae ATCC 15439) by a method of self-silencing gene activation.
The preparation method of the tetracyclic diterpenoid compound is characterized by comprising the following steps: the venezuelae A or the venezuelae B is obtained by expressing genes in a biosynthetic gene cluster of venezuelae in Streptomyces venezuelae (Streptomyces venezuelae ATCC 15439) by a method of heterologous expression in Escherichia coli.
The venezuelan biosynthetic gene cluster described in the above method is characterized in that: the gene cluster contains 4 genes, namely a gene venA for coding diterpene synthase VenA or a functional equivalent thereof, 2 genes venB and venC for coding cytochrome P450 enzymes VenB and VenC or functional equivalents thereof, and a gene venD for coding geranylgeranyl pyrophosphate synthase VenD or functional equivalents thereof; wherein the nucleotide sequence of the venA is shown as SEQ ID NO: 1, the nucleotide sequence of venB is shown as SEQ ID NO: 2, the nucleotide sequence of venC is shown as SEQ ID NO: 3, the nucleotide sequence of venD is shown as SEQ ID NO: 4 is shown in the specification; or the nucleotide sequence of the gene is a corresponding DNA coding sequence with the amino acid sequence consistency of more than 80 percent with the coding proteins VenA, VenB, VenC and VenD respectively.
Specifically, the preparation method of the tetracyclic diterpenoid compound venezuelan A comprises the following steps:
(1) carrying out PCR amplification on gene venA of diterpene synthase, geranylgeranyl pyrophosphate synthase gene venD and cytochrome P450 enzyme gene venC by using a genome (GenBank: CP013129) of S.venezuelae ATCC15439 as a template and primers venA-F/venA-R, venD-F/venD-R and pDR4venC-F/pDR4venC-R respectively to obtain PCR products of the genes venA, venD and venC; then, constructing a co-expression vector pET28b-venAD of venA and venD by taking an escherichia coli expression vector pET28b or a functional equivalent thereof as a vector; wherein the nucleotide sequences of the primers are respectively:
VenA-F：CCTGGTGCCGCGCGGCAGCCATATGCAGCAACGCCTCCGCCCG
VenA-R：GTCCACCAGTCATGCTAGCCATATGTCAAACCAGCGGTCGGGTGGG
VenD-F：CCTGGTGCCGCGCGGCAGCCATATGACCCAGGCGACACTGTC
VenD-R：GTCCACCAGTCATGCTAGCCATATGTCATCCGTCGCGGTGGCTCA
pDR4VenC-F：CGTGCAGGACTGGGGGAGTTACTAGTATGACCTGGGCCGCTGCGGGpDR4VenC-R:ATGATTACGAATTCGAGCTCGGTACCTCATGACGCCACCGCCCGGG
(2) converting the co-expression vector pET28b-venAD into the chemical competence of Escherichia coli engineering bacteria Eco-P (Escherichia coli BL21(DE3)/pACYC-mavEmavS & pTrc-low) which can produce dimethylallyl pyrophosphate and isopentenyl pyrophosphate at high yield to obtain Escherichia coli engineering bacteria Eco-P/pET28b-venAD which can produce Venezuelaene A (venezuelane A);
(3) transferring the engineering bacteria Eco-P/pET28b-venAD seed liquid of escherichia coli into TB culture medium containing kanamycin, chloramphenicol and ampicillin according to the volume ratio of 1-2: 100, culturing at the temperature of 37 +/-2 ℃ and the rpm of 220 +/-20, and culturing when OD is obtained600When the concentration reaches 1.0-1.5, adding isopropyl- β -D-thiogalactose with final concentration of 0.1-1.0mMGlycoside, inducing protein expression and biosynthesizing venezuelan A under the conditions of 18 +/-2 ℃ and 220 +/-20 rpm.
Specifically, the preparation method of the tetracyclic diterpenoid compound venezuelan B comprises the following steps:
(1) carrying out PCR amplification on gene venA of diterpene synthase, gene venD of geranylgeranyl pyrophosphate synthase and gene venC of cytochrome P450 enzyme by taking S.venezuelae ATCC15439 genome (GenBank: CP013129) as a template and primers venA-F/venA-R, venD-F/venD-R and pDR4venC-F/pDR4venC-R respectively to obtain PCR products of the genes venA, venD and venC; then, by taking a streptomycete integrated vector pDR4-kasOp or a functional equivalent thereof as a vector, integrating the venC into SpeI and KpnI double-restriction enzyme linearized pDR4-kasOp to obtain an expression vector pDR 4-kasOp-venC; wherein the nucleotide sequences of the primers are respectively:
VenA-F：CCTGGTGCCGCGCGGCAGCCATATGCAGCAACGCCTCCGCCCG
VenA-R：GTCCACCAGTCATGCTAGCCATATGTCAAACCAGCGGTCGGGTGGG
VenD-F：CCTGGTGCCGCGCGGCAGCCATATGACCCAGGCGACACTGTC
VenD-R：GTCCACCAGTCATGCTAGCCATATGTCATCCGTCGCGGTGGCTCA
pDR4VenC-F：CGTGCAGGACTGGGGGAGTTACTAGTATGACCTGGGCCGCTGCGGG
pDR4VenC-R:ATGATTACGAATTCGAGCTCGGTACCTCATGACGCCACCGCCCGGG
(2) the expression vector pDR 4-kasOp-venC was transformed into commercial E.coli ET12567/pUZ8002 to obtain E.coli engineering bacteria Et12567/pUZ8002&pDR 4-kasOp-venC; mixing spore suspension of S.venezuelane ATCC15439 wild type with Escherichia coli engineering bacteria Et12567/pUZ8002&pDR 4-kasOp-venC, and uniformly spread on MgCl-containing glass2And CaCl2Culturing on MS plate at 30 + -2 deg.C for 16 + -1 h, covering each MS plate with sterile water containing hygromycin and nalidixic acid, drying, culturing at 30 + -2 deg.C, culturing for 3-5 days, collecting single colony on MS culture medium containing nalidixic acid and hygromycin, sporulating for 3 + -1 days, inoculating into 2 XYT culture solution, culturing at 28 + -1 deg.C and 220 + -20 rpm for 2 days, and extractingTaking a genome, and verifying that the genotype is correct by PCR to obtain a recombinant strain S.venezuelae ATCC 15439/pDR 4-kasOp-venC;
(3) transferring the recombinant strain S.venezuelae ATCC 15439/pDR4-kasOp x-venC seed solution into an SCM culture medium according to the volume ratio of 1-2: 10, culturing at 30 +/-2 ℃ and 220 +/-20 rpm for 12 hours, feeding venezuelan A at the final concentration of 5mg/L, and continuously culturing for 7-8 days to realize the biotransformation of venezuelan A to venezuelan B, thereby obtaining venezuelan B with the conversion rate of 95% detected by GC.
The preparation method of the tetracyclic diterpenoid compound comprises the following steps: the fermentation liquor containing the venezuelan A or the venezuelan B can be added with equal volume of ethyl acetate for extraction, and then the mixture is evaporated to dryness to obtain an extract, the extract is extracted by normal hexane to remove components with large polarity, and the extract is evaporated to dryness and dissolved in acetonitrile to be used for semi-preparation of an inverse phase C18 chromatographic column to obtain purified venezuelan A or venezuelan B; wherein the chromatographic column is Waters XbridgeTMC-18column, specification 10X 250mm,5 μm, elution program: eluting with 100% methanol for 30min at a flow rate of 1.5-2.5 mL/min.
The invention relates to application of a tetracyclic diterpenoid compound venezuelaene A (venezuelaene A) in preparing perfumes.
The invention relates to application of a tetracyclic diterpenoid compound venezuelaene B (venezuelaene B) in preparing perfumes.
The invention provides a tetracyclic diterpenoid compound and a preparation method and application thereof. In the development process, the inventor discovers a novel biosynthetic gene cluster of venezuelan A and B from Streptomyces venezuelae ATCC15439 through a genome mining strategy. The expression of genes in the venezuelan A and B biosynthetic gene clusters in streptomycete and escherichia coli is realized by a silent gene activation and heterologous expression mode. Finally, two 5-5-6-7 tetracyclic diterpenoid compounds with brand-new frameworks, namely venezuelan A and venezuelan B with fragrance are obtained by separation and purification. The innovation point is that a genetic engineering method is utilized to construct a self-sufficient engineering bacterium for generating a novel compound venezuelan A. Then, the transformation of the Venezuelae A to the new compound Venezuelene B is completed in one step by using an engineering bacterium S.venezuelae ATCC 15439/pDR 4-kasOp-venC for expressing the P450 gene venC by using a biotransformation method. The whole operation process is simple, the process is mature, the cost is low, and the whole process does not contain harmful impurities, is nontoxic and is very environment-friendly. The obtained venezuelan A and venezuelan B products are expected to be applied to the fields of food, spice, pharmaceutical chemicals and the like.
Drawings
Fig. 1 is a three-dimensional structure ellipsoid diagram of venezuelan a provided in an embodiment of the present invention.
Fig. 2 is a chemical structural diagram of venezuelane a (venezuelane a) and venezuelane b (venezuelane b) according to an embodiment of the present invention.
Fig. 3 is an ultraviolet-visible spectrum of venezuelan a according to an embodiment of the present invention.
FIG. 4 is a gas-phase mass spectrum of Venezuelene A provided by the embodiment of the invention.
FIG. 5 shows Venezuelene A provided in an embodiment of the present invention1H-1Key relevant signals for H COSY, HMBC and NOESY.
FIG. 6 shows Venezuelene A in CD provided by an embodiment of the present invention3In Cl1HNMR map.
FIG. 7 shows Venezuelene A in CD provided by an embodiment of the present invention3In Cl13A CNMR map.
FIG. 8 shows Venezuelene A in CD provided by an embodiment of the present invention3In Cl13C-DEPT 135 ℃ diagram.
FIG. 9 shows Venezuelene A in CD provided by an embodiment of the present invention3HSQC pattern in Cl.
FIG. 10 shows Venezuelene A in CD provided by an embodiment of the present invention3In Cl1H-1H COSY picture.
FIG. 11 shows Venezuelene A in CD provided by an embodiment of the present invention3HMBC pattern in Cl.
FIG. 12 shows Venezuelene A in CD provided by an embodiment of the present invention3NOSEY pattern in Cl.
FIG. 13 is a graph (2) showing the biotransformation of venezuelan A (1) to venezuelan B by GC assay according to the present invention.
Wherein: (i) venezuelae ATCC15439 was fed 5mg/L venezuelae a; (ii) the engineered bacterium S.venezuelae ATCC 15439/pDR4-kasOp x-venC was fed with 5mg/L of venezuelan A.
Fig. 14 is an ultraviolet-visible spectrum of venezuelan B according to an embodiment of the present invention.
FIG. 15 is a gas mass spectrum of Venezuelene B provided in the example of the present invention.
Fig. 16 is a high-resolution mass spectrum of venezuelan B according to an embodiment of the present invention.
FIG. 17 shows Venezuelene B provided in an embodiment of the present invention1H-1Key relevant signals for H COSY, HMBC and NOESY.
FIG. 18 shows Venezuelene B in CD provided by an embodiment of the present invention3In Cl1HNMR map.
FIG. 19 shows Venezuelene B in CD provided by an embodiment of the invention3In Cl13C-DEPTQ plot.
FIG. 20 shows Venezuelene B in CD provided by an embodiment of the invention3HSQC pattern in Cl.
FIG. 21 shows Venezuelene B in CD provided by an embodiment of the invention3In Cl1H-1H COSY picture.
FIG. 22 shows Venezuelene B in CD provided by an embodiment of the present invention3HMBC pattern in Cl.
FIG. 23 shows Venezuelene B in CD provided by embodiments of the present invention3NOSEY pattern in Cl.
Detailed Description
The present invention will be described in detail with reference to specific examples. The following examples are merely illustrative of the preferred embodiments of the present invention and are not intended to limit the present invention in any way, and any simple modifications, equivalent changes and modifications made to the embodiments according to the technical spirit of the present invention fall within the scope of the technical solution of the present invention.
Basic molecular biology experimental techniques such as PCR amplification, plasmid extraction, transformation, etc., which are used in the examples of the present invention, if no specific description is given, are generally performed according to conventional methods, and specifically, refer to molecular cloning instruction (third edition) (Sambrook J, Russell DW, Janssen K, Argentine J. Huang Peyer, et al, 2002, Beijing, science publishers, etc.), or according to the instructions provided by the relevant manufacturers.
The strain S.venezuelae ATCC15439 used in the embodiment of the invention is purchased from American strain collection; escherichia coli BL21(DE3) competent cells were purchased from Beijing Okame. The construction method of the Escherichia coli engineering bacterium Eco-P (Escherichia coli BL21(DE3)/pACYC-mavEmavS & pTrc-low) is shown in Microb CellFact 15,74 (2016); escherichia coli Et12567/pUZ8002 was purchased from Youbao Bio.
The one-step cloning kit used in the examples of the present invention was purchased from Nanjing Novozam; agarose gel DNA recovery kits were purchased from Omega; streptomyces integrative vector pDR4-kasOp was purchased from Addgene; coli expression vector pET28b was purchased from Invitrogen; high fidelity DNA polymerase was purchased from Takara; restriction enzymes were purchased from semer fly; PCR primer synthesis and DNA sequencing were performed by Beijing Okame.
The sporulation culture medium of the S.venezuelae ATCC15439 related by the embodiment of the invention is an MS culture medium, and the formula is as follows: 20g/L of bean flour, 20g/L of mannitol and 20g/L of agar powder; the seed culture medium is 2 XYT culture medium, and the formula is as follows: tryptone 16g/L, yeast extract 10g/L, NaCl 5 g/L; the fermentation medium is SCM medium, and the formula is as follows: 15g/L of soluble starch, 20g/L of soybean peptone and CaCl20.1g/L, yeast extract 1.5g/L, 3-morpholine propanesulfonic acid 10.5g/L, pH 7.2.
The seed culture medium of the enterobacter related to the embodiment of the invention is an LB culture medium, and the formula is as follows: 10g/L of tryptone, 5g/L of yeast extract and 10g/L of NaCl; the fermentation medium is a TB medium, and the formula is as follows: tryptone 12g/L, yeast extract 24g/L, glycerol 40g/L, K2HPO49.4g/L，KH2PO42.2g/L。
Example 1 Gene expression vector construction
Using S.venezuelae ATCC15439The genome is taken as a template, primers VenA-F/VenA-R, VenD-F/VenD-R and pDR4VenC-F/pDR4VenC-R (table 1) are respectively used for carrying out PCR amplification on gene venA of diterpene synthase, geranylgeranyl pyrophosphate synthase gene venD and cytochrome P450 enzyme gene venC, and the reaction system is as follows: 5 XPrimeSTAR GXLBuffer 10. mu.L, 200. mu.M dNTPs, 4. mu.L DMSO, upstream and downstream primers 0.3. mu.M each, appropriate amount of DNA template (10-100ng), high fidelity polymerase (PrimeSTAR GXL DNA polymerase) 2.5U, ddH2O is complemented to 50 mu L; the reaction conditions are as follows: pre-denaturation at 98 ℃ for 5min, denaturation at 98 ℃ for 30s, annealing at 60 ℃ for 15s, extension at 68 ℃ (1kb/min, time set according to the length of target fragment), reaction for 35 cycles, and final extension at 68 ℃ for 10 min. After PCR products of genes venA, venD and venC are purified by a nucleic acid purification kit, the venA and the venD are respectively integrated into linear pET28b digested by NdeI by utilizing a one-step cloning kit to respectively obtain protein expression plasmids pET28b-venA and pET28b-venD in escherichia coli; further, in order to construct a co-expression vector of venA and venD, PCR was carried out using pET28b-venA as a template and primers 28bVenA-F/28bVenA-R to obtain a linearized plasmid. Subsequently, PCR was carried out using pET28b-venD as a template and using primers T7VenD-F/T7VenD-R to obtain a DNA fragment containing the T7 promoter and terminator sequences and venD, and cloned into the above-prepared linearized pET28b-venA to obtain a co-expression vector pET28b-venD containing 2T 7 promoters of venA and venD.
Similarly, after the PCR products of the genes venA, venD and venC were purified by the nucleic acid purification kit as described above, the venC was integrated into SpeI and KpnI double-digested linearized pDR4-kasOp using the one-step cloning kit to obtain the expression vector pDR 4-kasOp-venC.
Table 1: primer sequences used in the examples
Example 2 construction of recombinant Escherichia coli and fermentation production of Venezuelene A
pET28b-venAD is transformed into a prepared high-yield Escherichia coli engineering bacterium Eco-P (Escherichia coli BL21(DE3)/pACYC-mavEmavS & pTrc-low) chemical competence for high-yield dimethylallyl pyrophosphate and isopentenyl pyrophosphate, and the Escherichia coli engineering bacterium Eco-P/pET28b-venAD which is self-sufficient for producing Venezuelene A (Venezuelae A) is obtained.
Eco-P/pET28b-venAD was picked from an LB solid plate (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, 15g/L agar powder) and inoculated into 20mL of LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L) containing 50. mu.g/mL kanamycin, 25. mu.g/mL chloramphenicol and 100. mu.g/mL ampicillin, and cultured overnight at 37 ℃ at 220 rpm. Then, the seed solution was transferred to 2L of TB medium (tryptone 12g/L, yeast extract 24g/L, glycerol 40g/L, K) containing 50. mu.g/mL kanamycin, 25. mu.g/mL chloramphenicol and 100. mu.g/mL ampicillin in a volume ratio of 1:1002HPO49.4g/L，KH2PO42.2g/L) at 37 ℃ and 220 rpm. When OD is reached600When 1.0-1.5 is reached, isopropyl- β -D-thiogalactoside is added to a final concentration of 0.2mM, protein expression is induced and venezuelan A is biosynthesized at 220rpm and 18 ℃.
Separation and purification and structure identification of venezuelan A
After the recombinant Escherichia coli Eco-P/pET28b-venAD is fermented for 3 days, adding equal volume of ethyl acetate for extraction three times, and evaporating the extract by using a rotary evaporator to obtain an extract. Then, the extract was extracted four times with 50mL of n-hexane to remove the components having large polarity. Finally, the n-hexane extract was evaporated to dryness and dissolved in acetonitrile for semi-preparative reverse phase C18 chromatography to obtain venezuelan A. The specific chromatographic column is Waters XbridgeTMC-18column (10X 250mm,5 μm), elution program: 100% methanol was eluted for 30min at a flow rate of 2.5 mL/min. The finally obtained venezuelan A is colorless transparent oily after being dried by nitrogen and has specific rotation
＝-20°(c 0.165,CH2Cl2) And has a long-lasting, pleasant fragrance. Furthermore, in order to complete the structure identification and analysis of the venezuelan A, 10mg of venezuelan A is dissolved in 0.5mL of chromatographic pure acetonitrile, and naturally volatilized at 4 ℃, and after about one week, needle-shaped crystals are formed and are subjected to X-ray single crystal diffraction analysis to obtain the three-dimensional structure (shown in figure 1). Based on a novel compound venezuelan A (molecular formula: C)20H32) The chemical structure of (fig. 2), and the corresponding uv-vis spectrum (fig. 3), gas mass spectrum (fig. 4), nmr spectrum (fig. 5-12) analysis, the chemical shifts of which are assigned to table 2.
Table 2: examples of venezuelan A
1H NMR(600MHz,CDCl3) And13C NMR(151MHz,CDCl3) Chemical shift assignment
Example 3 construction of recombinant Strain S.venezuelae ATCC 15439/pDR 4-kasOp-venC feeding venezulene A for biotransformation to venezuelan B
Fresh spores of the wild type S.venezuelae ATCC15439 cultured for 5-7 days were collected from MS medium (soybean powder 20g/L, mannitol 20g/L, agar powder 20g/L) and resuspended in 5mL of 2 XYT medium (tryptone 16g/L, yeast extract 10g/L, NaCl 5 g/L). After washing 3-5 times with an equal volume of 2 XYT solution, and centrifuging at 6000rpm for 2min, the spore suspension was concentrated to 500. mu.L. After heat shock at 50 ℃ for 10min, the spore suspension was cooled to room temperature. 100 μ L of the spore suspension of the wild type E.coli ATCC15439 was mixed with 100 μ L of E.coli Et12567/pUZ8002 prepared in advance&pDR 4-kasOp-venC were mixed and each was spread uniformly over a tube containing 50mM MgCl2And 50mM CaCl2On the MS plate of (1). After incubation at 30 ℃ for 16h, each MS plate was covered with 1mL sterile water containing 25mg hygromycin and 0.5mg nalidixic acid, dried, and then re-incubated at 30 ℃. After colonies grew for 3-5 days, single colonies were picked to MS medium containing 25. mu.g/mL nalidixic acid and 50. mu.g/mL hygromycin. After about 3 days of sporulation, the cells were inoculated into 4mL of 2 XYT medium, cultured at 28 ℃ and 220rpm for 2 days, and the genome was extracted for PCR gene validationThe correct type was obtained, i.e., the recombinant strain S.venezuelae ATCC 15439/pDR 4-kasOp-venC.
From MS plate picking engineering bacteria S, venezuelae ATCC 15439/pDR4-kasOp x-venC monoclonal inoculated into 500mL 2 XYT culture solution. After culturing at 30 ℃ and 220rpm for 2 days, the cells were transferred to 5LSCM medium (15 g/L soluble starch, 20g/L soytone, CaCl) at a volume ratio of 1:1020.1g/L, yeast extract 1.5g/L, 3-morpholinopropanesulfonic acid 10.5g/L, pH 7.2). After culturing for 12h at 30 ℃ and 220rpm, the venezuelan A is fed with 5mg/L of final concentration, and the culture is continued for 7 days, so that the biotransformation from venezuelan A to venezuelan B is realized, and the conversion rate can reach 95 percent by GC detection (shown in figure 13). In contrast, the biosynthetic gene cluster of venezuelae in the wild strain s.venezuelae ATCC15439 of the control group was silent under conventional culture conditions, and thus the biotransformation of fed venezuelae a to venezuelae B could not be achieved (fig. 13).
Separation and purification and structure identification of venezuelan B
The 5L S.venezuelae ATCC 15439/pDR4-kasOp + venC fermentation broth was extracted three times with an equal volume of ethyl acetate and the resulting extract was evaporated to dryness using a vacuum rotary evaporator. And extracting the obtained extract by using 50mL of normal hexane for four times to remove components with large polarity, evaporating the extract to dryness, dissolving the extract in acetonitrile, and carrying out semi-preparation on an inverse phase C18 chromatographic column to obtain the venezuelan B. The specific chromatographic column is Waters XbridgeTMC-18column (10X 250mm,5 μm), elution program: 100% methanol was eluted for 30min at a flow rate of 1.5 mL/min. Finally obtaining the venezuelan B which is white powder after being dried by nitrogen and has specific rotation
＝-113.1(c 0.065,CH2Cl2) And has a pleasant fragrance like venezuelan a. Combining ultraviolet-visible spectroscopy (fig. 14), gas mass spectrometry (M/z 286, fig. 15) and high resolution mass spectrometry ([ M + H)]+Calc.287.2369; obs.287.2357, figure 16), nuclear magnetic resonance spectrum (figures 17-23), determining the chemical structure of venezuelan B (figure 2), and assigning its chemical shiftsIn table 3.
Table 3: examples of venezuelan B
1H NMR(600MHz,CDCl3) And13C NMR(151MHz,CDCl3) Chemical shift assignment
Example 4 application of the tetracyclic diterpenoid compound Venezuelaene A (venezuelaene A) in the preparation of perfumery
At room temperature, the tetracyclic diterpenoid compound venezuelane A (venezuelae A) is dissolved in a volatile solvent with the concentration of 1mg/mL, such as methanol, ethanol, acetone, ethyl acetate and the like, and persistent and light costustoot similar to sclareol can be shown. Also, venezuelan a oily liquid, when obtained by rotary evaporation under vacuum conditions, exhibited a rich smell similar to durian. Based on the fragrance characteristic of venezuelan A and no cytotoxicity through in vitro tests, the venezuelan A is expected to be widely applied to the preparation industry of essences and flavors and to replace diterpene flavors such as sclareol and the like.
Example 5 application of the tetracyclic diterpenoid compound Venezuelaene B (venezuelaene B) in the preparation of perfumes
At room temperature, the tetracyclic diterpenoid compound venezuelane B (venezuelae B) is dissolved in a volatile solvent with the concentration of 1mg/mL, such as methanol, ethanol, acetone, ethyl acetate and the like, and persistent and light costustoot similar to sclareol can be shown. Also, when venezuelan B was obtained as an oily liquid by rotary evaporation under vacuum conditions, it exhibited a rich smell like durian. Based on the fragrance characteristic of venezuelan B and no cytotoxicity through in vitro tests, the venezuelan B is expected to be widely applied to the preparation industry of essences and flavors and to replace diterpene flavors such as sclareol and the like.
Sequence listing
<110> institute of bioenergy and Process in Qingdao, national academy of sciences, Shandong university
<120> tetracyclic diterpenoid compounds, and preparation method and application thereof
<141>2019-10-30
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>1161
<212>DNA
<213> Streptomyces venezuelae (Streptomyces venezuelae) ATCC15439
<221> nucleotide sequence of gene venA
<400>1
atgcagcaac gcctccgccc gcttccgccg atctggagaa ccaaggtgat caccgacgtc 60
gacctcaccc gtcgcctcct gcccggtgac gggccgggag agttcttcct gccgccgctg 120
ccgcggctgc tgcccgcggg ctaccacccc gacgccgccc gcatcgagat cgcctccaac 180
ggctgggtgc ggcggatgct ggcggactgc ttcgactccg aggagtcgct gctgttcttc 240
ctgcgtcagc gtaacgggat ctacgggccg ctgacggtgc cgtacgccga ggcggacagg 300
gcccagaaca tcgccgactg gtaccagttc gtcacggtga tcgacagctt cgtctccgac 360
gaggcggcac tgggcgccga ccacgcggcg gccgccgaga ccttcgccgc cgtcgtcgcc 420
gacctgcgcg agggcggggc cggcggcccc gccgcgagcc tgtacggccg cgccgcccag 480
gacctgtggc ggcgtatcgc ggccgggatg agcgcacggc aggtcgatcg gctcgtcgcg 540
gccctcgagg cgttcctgcg cgggtgcgcg gaggagatcc gcagcaaact cgacaagcag 600
gtaccgcact tcgaggcgtg catgcgggtg cgggtcgaca gcttcgggtg cgagttcctg 660
gaactgctca ccgagtacgc ggccgaggtc gacatgagcc gggccgcgac agagggcctg 720
ttcgacgagg tccaccacca cggcatgcgg cagctgatcc tcgtcaacga cctgctctcg 780
tggcgcaagg agtacgccca gcgggacacc atgacgaccg tccgcgtgct gtgcgaggtc 840
gaagggcttg agctgcagga cgccgtcgac cggctgtgcg ccctcgtgga gcaccacgaa 900
cgcgcctaca tcacggcacg cgacgcggtg ctggccggcc cccacgggca ccgcgaggac 960
gtccgcgcct atctgtcggg gctcgaccat ctgatcggcg gaagccagga gttcgagtat 1020
ctgacgccgc gctacttcgg cgacggctcg gtgtgggacg gctcgacctc cggctggatc 1080
agtctcaccg cgtcggtggc ccgcttccgt gacgcacccg ctcccgcgcc gagcgcccga 1140
cccacccgac cgctggtttg a 1161
<210>2
<211>1437
<212>DNA
<213> Streptomyces venezuelae (Streptomyces venezuelae) ATCC15439
<221> nucleotide sequence of gene venB
<400>2
ttgaggagcg ccgtgaccac cgtctcgcca ccgccccgca cgatgtccta cgcgctcgcg 60
cccggggccc tgcccctgct cggccacgcc gtgccgctgg cccgccgacc gctggagttc 120
ctgaccgggt tgccccggca cggggacctg gtggaggtcc ggctggggcg ccgccccgcc 180
ctcatggtct gccaccccga gttgatcaag cgtgtactgc tggagccgcg gaccttcgac 240
aagggcgggc cgctgttcga gaaggccgag caactcgtcg gcagcgggct gttcgcggcg 300
acctgggagc cgcaccgcag gcagcggcgg atgatgcagc cgggcttcca caagtcgcgg 360
atgcccgggt acgtggcggt gatgcggcag gagatcgcgg cgctgctcga cggctgggcc 420
gacggccagg aacgcgacgt acgcgatgag atgcacacgg tgacgctccg catcgcctcg 480
cgcaccatgt tcaccaaccc gatgagcggg cgcgccgcgg ccgaggtgca ggagtgcatg 540
ccgatcatca accgcggcgt ctacaagcgg atggtcgcgc cgaccgcgct gctggagaag 600
ctgcccaccc gggagaaccg cgagttccag ctcgcgcacg agcggatgga gcaggtcgtc 660
gacgagacga tcgagcagta ccgcagtgcg ggcgtcgacc acggcgacct gatgtcgatc 720
ctgatcggcg cggtcgacga gggctccggg cagaacatgt ccgagacgga gatccacaag 780
caggtcatga cgctgctggc cggcggcatg gagacgacgg cgaacgcgat ctgctcggcc 840
ctgcacctga tcaccgagca ccccgaggtc gaacggcggc tgtgcgcgga gctcgacgag 900
gtgctggccg gcaggccgcc ggagttcgag gaccttcccc gcctgccgta tctgtaccgg 960
gtgctgtacg agaccctgcg gatccgtccg ccggtgtggc tgctgacccg gatgaccacg 1020
tgcgacaccg agctgggcgg ccaccgcatc ggccgggaca ccatcgtgct gctcagcccc 1080
tatctgctgc accacaaccc ggacctgttc gcccggcccg agacgttcga cccggaccgg 1140
tggctgccgg agcgcgtcga cgacatcacc gaggccgcca tgcagccctt catcatgggc 1200
aaccgcaagt gcatcggtga caagttcgcg ctgaacgagg cgatgatcgt catcgcgacg 1260
atcctgtcgg gctggtcgct tcggatgatc ccggacgcca agcgggtctc gctgcccgag 1320
gcgacgctcg gccccggccc gatgccgatg gtgctgcacc gccgcgccgc cgcgcatcac 1380
gccccggtgc cctcggcccg accgggcgaa tgcccctacc agggcgggcg ttcatga 1437
<210>3
<211>1398
<212>DNA
<213> Streptomyces venezuelae (Streptomyces venezuelae) ATCC15439
<221> nucleotide sequence of gene venC
<400>3
atgacctggg ccgctgcggg accggccgag gccccgcacg ggctgccggt cgtgggccat 60
gccgtgcagt tgtggcggcg cccgctgccc ttcctgcgtg agctgtccgg gcgcggtgac 120
ctcgtgacgc tgcgcctggg ccgccaccgc gcctatctgg cgtgcggcat cgacgcggtg 180
cgcaccgtgc tgcacgatcc gcggacgttc gacaagggcg gcccgctgtt cgagaaggcc 240
cggctgctgg tgggtgacgg tctggtcagt tcggacttcg ccacgcaccg caggcagcgc 300
ctgctgatgc agcccgcgtt cggcacctcg cggcttcccg gctacaccgg gctgatggcc 360
gagcagatcg acacggcgct ggaccggtgg cagcacggcc ggacactcga cgtgggccgg 420
gagatgcaca cgctggccct cgaggtcgcg gcacggacgt tgttcggtgc ccacctgggc 480
gagcgggccg tcaccgaggt cgtcgcgtgc atgccgctgg tcatgcggggtgtctaccgg 540
cgcatgctcg tcccggccga ctgggtgcac cgcctgccgc tgcccgccaa ccgccgcttc 600
gaccgggccc gggccacgat gcaccgcgtc atcgccgaca ccgtccgctc ctaccgcgac 660
gccgggaagg accacggcga cgtcctgtcg atcctggtga gctcccgcga cgagcacggt 720
acgtcactga gcgacgccga gatccacgac caggtcatga cgctgctcat cggggcgacc 780
gagcccccgg gctccgcgct gacctgggtg ttccagctgc tgtcggagca tcccgaggcc 840
gagcgcgccc tgcgggccga ggccgacgac gtgctgcgcg gcaggccggc cggcgccctg 900
agcgcggcgg acctggcgcg cctggagcac acgcggcaca tcgtgctcga ggcgctgcgg 960
ctctacccgc cggcgtggct gctcagccgc gtcgccacca aggacaccga ccttatgggc 1020
catccggtgc ccaagggtgc cacggtgctg ttcagcccgt accaactcca ccatgaccag 1080
gacgtgttcc cgcatccgtc gcgcttcgac ccgggccgct ggcgctcccc ctcccccgcc 1140
gcccgcgccg cactgctgcc cttcggggcc ggcaaccgca agtgcatcgg cgacgaagtg 1200
gccctgacgg aactgtctct cgcggtcgcc gccgtggcgt cccggttcag gctgcgggcc 1260
gttcccggta cgacggcacg gcccctcgtc cgtgcttcgc tcggtgccga gcacgtggtg 1320
ctgagagtcg aggcacgtac ccccctcggc gcggccgccg gcggcgcgtc ggtcgggtcc 1380
cgggcggtgg cgtcatga 1398
<210>4
<211>1080
<212>DNA
<213> Streptomyces venezuelae (Streptomyces venezuelae) ATCC15439
<221> nucleotide sequence of gene venD
<400>4
atgacccagg cgacactgtc ggccgttctc gtggacgccc cgctgcgccc gcccgtcgag 60
ggcatgcggc ccaccgcggc gtacggtgtg ctggtcgggc ggctgggagc cgccaccgtg 120
cacgcggacc tgcgggcctg cctggagggc atcgacaccg tcgtccgcgc cgcgccgctg 180
gtcatcccgc cggccatggc cgacgtcttc tcgggtggca aacggctgcg tccgctgctg 240
gtcctggccg gcgcgcacgc cgccggcccg ccgtcggcga gcacgcgcgg ccgcgccgtg 300
agcggtgccc gtgccgtgga actgctgcat ctggcgagtc tcgtccacga cgacatcatg 360
gacgaggcgg tgacccggca cggggtcgcg accatcagcg cacgggccgg caacagccgc 420
gccctgctcg ccggcgacta cctcatcggc cacgcgcaca tcgccgcttc cggcctcggc 480
gccgaggcgg gaactctcct gggccacacc ctcgtgcggc tgtgcgaggg ccaggccgag 540
gaagcctcca cgctcttcga cgccgaccgc ggtgaagagt cgtacttcag ggcgatcggc 600
gggaagaccg gtgccctgat cgacgcggcg tgccgcacgg gcgcgctcgc cgcaggcctt 660
gacgccacca cgacccgggc cctgggacgc ttcggccacc atctcggcgt ggggttccaa 720
ctcctcgacg acatgcttga cctgacggca agtcatgcct ctgcgggcaa gccggtgggg 780
cacgacatcg ccaacggcgt ctacacctat cccacgctct gggcgctgcg ccgcgacccc 840
gggctgcggc gactccttga ggaactcgcc cggtgcgaag ggccccgcac cgggccggcc 900
ggcgaggcgg cccaccgggt ccgtgcctcg ggtgcgctca ccgcgacccg gcgggcgatc 960
gcccgtcggc gtgaacgctg cctgggaatc ctggacgagg cggtcgacgg catcggcccc 1020
gacggcgtcg gcctgctggc cgatctcgcc atcgccgtcc tgagccaccg cgacggatga1080
Claims (10)
1. A tetracyclic diterpenoid compound characterized by: the compound is a compound containing a 5-5-6-7 tetracyclic diterpene framework, and the chemical molecular formula of the compound is C20H32The structural formula is shown as formula (1) and is named as: venezuelane a (venezuelaene a);
2. a tetracyclic diterpenoid compound characterized by: the compound is a compound containing a 5-5-6-7 tetracyclic diterpene framework, and the chemical molecular formula of the compound is C20H30O, the structural formula is shown as formula (2), and the name is: venezuelane b (venezuelaene b);
3. a process for the preparation of tetracyclic diterpenoids according to claims 1 or 2, characterized in that: the venezuelae A or the venezuelae B is obtained by expressing genes in a biosynthetic gene cluster of venezuelae in Streptomyces venezuelae (Streptomyces venezuelae ATCC 15439) by a method of self-silencing gene activation.
4. A process for the preparation of tetracyclic diterpenoids according to claims 1 or 2, characterized in that: the venezuelae A or the venezuelae B is obtained by expressing genes in a biosynthetic gene cluster of venezuelae in Streptomyces venezuelae (Streptomyces venezuelae ATCC 15439) by a method of heterologous expression in Escherichia coli.
5. A Venezuelene biosynthetic gene cluster according to claim 3 or 4, characterized in that: the gene cluster contains 4 genes, namely a gene venA for coding diterpene synthase VenA or a functional equivalent thereof, 2 genes venB and venC for coding cytochrome P450 enzymes VenB and VenC or functional equivalents thereof, and a gene venD for coding geranylgeranyl pyrophosphate synthase VenD or functional equivalents thereof; wherein the nucleotide sequence of the venA is shown as SEQ ID NO: 1, the nucleotide sequence of venB is shown as SEQ ID NO: 2, the nucleotide sequence of venC is shown as SEQ ID NO: 3, the nucleotide sequence of venD is shown as SEQ ID NO: 4 is shown in the specification; or the nucleotide sequence of the gene is a corresponding DNA coding sequence with the amino acid sequence consistency of more than 80 percent with the coding proteins VenA, VenB, VenC and VenD respectively.
6. The method for preparing the tetracyclic diterpenoid compound according to claim 1, comprising the steps of:
(1) using a genome of S.venezuelae ATCC15439 as a template, and respectively carrying out PCR amplification on a gene venA of diterpene synthase, a gene venA of geranylgeranyl pyrophosphate synthase and a gene venC of cytochrome P450 enzyme by using primers venA-F/venA-R, venD-F/venD-R and pDR4venC-F/pDR4venC-R to obtain PCR products of the genes venA, nAD and venC; then, constructing a co-expression vector pET28b-venAD of venA and venD by taking an escherichia coli expression vector pET28b or a functional equivalent thereof as a vector; wherein the nucleotide sequences of the primers are respectively:
VenA-F：CCTGGTGCCGCGCGGCAGCCATATGCAGCAACGCCTCCGCCCG
VenA-R：GTCCACCAGTCATGCTAGCCATATGTCAAACCAGCGGTCGGGTGGG
VenD-F：CCTGGTGCCGCGCGGCAGCCATATGACCCAGGCGACACTGTC
VenD-R：GTCCACCAGTCATGCTAGCCATATGTCATCCGTCGCGGTGGCTCA
pDR4VenC-F：CGTGCAGGACTGGGGGAGTTACTAGTATGACCTGGGCCGCTGCGGG
pDR4VenC-R:ATGATTACGAATTCGAGCTCGGTACCTCATGACGCCACCGCCCGGG
(2) converting the co-expression vector pET28b-venAD into the chemical competence of Escherichia coli engineering bacteria Eco-P (Escherichia coli BL21(DE3)/pACYC-mavEmavS & pTrc-low) which can produce dimethylallyl pyrophosphate and isopentenyl pyrophosphate at high yield to obtain Escherichia coli engineering bacteria Eco-P/pET28b-venAD which can produce Venezuelaene A (venezuelane A);
(3) transferring the engineering bacteria Eco-P/pET28b-venAD seed liquid of escherichia coli into TB culture medium containing kanamycin, chloramphenicol and ampicillin according to the volume ratio of 1-2: 100, culturing at the temperature of 37 +/-2 ℃ and the rpm of 220 +/-20, and culturing when OD is obtained600When reaching 1.0-1.5, isopropyl- β -D-thiogalactoside with a final concentration of 0.1-1.0mM is added, protein expression is induced and venezuelan A is biosynthesized under the conditions of 18 +/-2 ℃ and 220 +/-20 rpm.
7. The method for preparing the tetracyclic diterpenoid compound according to claim 2, comprising the steps of:
(1) carrying out PCR amplification on genes venA of diterpene synthase, venD pyrophosphate synthase gene venD and cytochrome P450 enzyme gene venC by respectively using primers venA-F/venA-R, venD-F/venD-R and pDR4venC-F/pDR4venC-R by using an S.venezuelae ATCC15439 genome as a template to obtain PCR products of the genes venA, venD and venC; then, by taking a streptomycete integrated vector pDR4-kasOp or a functional equivalent thereof as a vector, integrating the venC into SpeI and KpnI double-restriction enzyme linearized pDR4-kasOp to obtain an expression vector pDR 4-kasOp-venC; wherein the nucleotide sequences of the primers are respectively:
VenA-F：CCTGGTGCCGCGCGGCAGCCATATGCAGCAACGCCTCCGCCCG
VenA-R：GTCCACCAGTCATGCTAGCCATATGTCAAACCAGCGGTCGGGTGGG
VenD-F：CCTGGTGCCGCGCGGCAGCCATATGACCCAGGCGACACTGTC
VenD-R：GTCCACCAGTCATGCTAGCCATATGTCATCCGTCGCGGTGGCTCA
pDR4VenC-F：CGTGCAGGACTGGGGGAGTTACTAGTATGACCTGGGCCGCTGCGGG
pDR4VenC-R:ATGATTACGAATTCGAGCTCGGTACCTCATGACGCCACCGCCCGGG
(2) the expression vector pDR 4-kasOp-venC was transformed into commercial Escherichia coli Et12567/pUZ8002 to obtain Escherichia coli engineering bacteria Et12567/pUZ8002&pDR 4-kasOp-venC; mixing spore suspension of S.venezuelane ATCC15439 wild type with Escherichia coli engineering bacteria Et12567/pUZ8002&pDR 4-kasOp-venC, and uniformly spread on MgCl-containing glass2And CaCl2Culturing on MS plates at 30 +/-2 ℃ for 16 +/-1 h, covering each MS plate with sterile water in which hygromycin and nalidixic acid are dissolved, drying, culturing at 30 +/-2 ℃ again, picking a single colony to an MS culture medium containing nalidixic acid and hygromycin after 3-5 days of colony growth, sporulating for 3 +/-1 days, inoculating to 2 XYT culture solution, culturing at 28 +/-1 ℃ and 220 +/-10 rpm for 2 days, extracting a genome, and verifying that the genotype is correct through PCR (polymerase chain reaction), namely the recombinant strain S.venezuelae ATCC 15439/pDR 4-kasOp-venC;
(3) transferring the recombinant strain S.venezuelae ATCC 15439/pDR4-kasOp x-venC seed solution into an SCM culture medium according to the volume ratio of 1-2: 10, culturing at 30 +/-2 ℃ and 220 +/-20 rpm for 12 hours, feeding venezuelan A at the final concentration of 5mg/L, and continuously culturing for 7-8 days to realize the biotransformation of venezuelan A to venezuelan B, thereby obtaining venezuelan B with the conversion rate of 95% detected by GC.
8. The method for preparing tetracyclic diterpenoids according to claims 6 or 7, characterized in that: adding fermentation liquor containing the venezuelan A or the venezuelan B into equal volume of ethyl acetate for extraction, evaporating to obtain an extract, extracting the extract by using normal hexane to remove components with high polarity, evaporating the extract again, and dissolving the extract in acetonitrile for semi-preparation of an inverse phase C18 chromatographic column to obtain purified venezuelan A or venezuelan B; wherein the chromatographic column is Waters XbridgeTMC-18column, specification 10X 250mm,5 μm, elution program: eluting with 100% methanol for 30min at a flow rate of 1.5-2.5 mL/min.
9. Use of the tetracyclic diterpenoid compound venezuelane a (venezuelae a) according to claim 1 for the preparation of fragrances.
10. Use of the tetracyclic diterpenoid compound venezuelane b (venezuelae b) according to claim 2 for the preparation of fragrances.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911072144.7A CN110885281B (en) | 2019-11-05 | 2019-11-05 | Tetracyclic diterpenoid compounds and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911072144.7A CN110885281B (en) | 2019-11-05 | 2019-11-05 | Tetracyclic diterpenoid compounds and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110885281A true CN110885281A (en) | 2020-03-17 |
| CN110885281B CN110885281B (en) | 2021-05-11 |
Family
ID=69746908
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911072144.7A Active CN110885281B (en) | 2019-11-05 | 2019-11-05 | Tetracyclic diterpenoid compounds and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110885281B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116199564A (en) * | 2023-03-02 | 2023-06-02 | 山东大学 | Novel diterpenoid compound and preparation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1629173A (en) * | 2003-12-16 | 2005-06-22 | 中国科学院微生物研究所 | Novel antibiotic preparing process |
| WO2008039177A2 (en) * | 2006-09-22 | 2008-04-03 | Rice University | Pantothenate kinase expressing cells |
| KR101189756B1 (en) * | 2010-10-01 | 2012-10-10 | 이화여자대학교 산학협력단 | New Trichostatin analog and anti-tumor agent including this |
-
2019
- 2019-11-05 CN CN201911072144.7A patent/CN110885281B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1629173A (en) * | 2003-12-16 | 2005-06-22 | 中国科学院微生物研究所 | Novel antibiotic preparing process |
| WO2008039177A2 (en) * | 2006-09-22 | 2008-04-03 | Rice University | Pantothenate kinase expressing cells |
| KR101189756B1 (en) * | 2010-10-01 | 2012-10-10 | 이화여자대학교 산학협력단 | New Trichostatin analog and anti-tumor agent including this |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116199564A (en) * | 2023-03-02 | 2023-06-02 | 山东大学 | Novel diterpenoid compound and preparation method and application thereof |
| CN116199564B (en) * | 2023-03-02 | 2024-03-29 | 山东大学 | Novel diterpenoid compound and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110885281B (en) | 2021-05-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bringmann et al. | Different polyketide folding modes converge to an identical molecular architecture | |
| Deng et al. | Systematic identification of Ocimum sanctum sesquiterpenoid synthases and (−)-eremophilene overproduction in engineered yeast | |
| Rateb et al. | Medium optimization of Streptomyces sp. 17944 for tirandamycin B production and isolation and structural elucidation of tirandamycins H, I and J | |
| CN112142585B (en) | Mangicols sesterterpene compounds, synthetic method, gene cluster, nucleic acid molecule, construct and application thereof | |
| Huang et al. | Marine bacterial aromatic polyketides from host-dependent heterologous expression and fungal mode of cyclization | |
| CN115197172B (en) | Sesterterpene compound, synthetic gene cluster and synthetic method thereof | |
| Halder et al. | Enhanced trans-resveratrol production in genetically transformed root cultures of Peanut (Arachis hypogaea L.) | |
| Biswas et al. | Endophytic sources of diosgenin, a natural steroid with multiple therapeutic values | |
| Wang et al. | Genome mining and biosynthesis of the Acyl-CoA: cholesterol acyltransferase inhibitor beauveriolide I and III in Cordyceps militaris | |
| O'Connor | Strategies for engineering plant natural products: the iridoid-derived monoterpene indole alkaloids of Catharanthus roseus | |
| Karunanithi et al. | Functional characterization of the cytochrome P450 monooxygenase CYP71AU87 indicates a role in marrubiin biosynthesis in the medicinal plant Marrubium vulgare | |
| Yuan et al. | Biosynthesis of mushroom-derived type II ganoderic acids by engineered yeast | |
| Luo et al. | Characterization of a sesquiterpene cyclase from the glandular trichomes of Leucosceptrum canum for sole production of cedrol in Escherichia coli and Nicotiana benthamiana | |
| Zhao et al. | Biosynthesis of plant-specific alkaloids tetrahydroprotoberberines in engineered Escherichia coli | |
| CN110885281B (en) | Tetracyclic diterpenoid compounds and preparation method and application thereof | |
| Jiang et al. | Schultriene and nigtetraene: Two sesterterpenes characterized from pathogenetic fungi via genome mining approach | |
| Bernardi et al. | Secondary metabolites of endophytic actinomycetes: Isolation, synthesis, biosynthesis, and biological activities | |
| Tong et al. | Eudesmane-type sesquiterpene diols directly synthesized by a sesquiterpene cyclase in Tripterygium wilfordii | |
| Hirte et al. | From microbial upcycling to biology-oriented synthesis: combining whole-cell production and chemo-enzymatic functionalization for sustainable taxanoid delivery | |
| CN104862326B (en) | A kind of green muscardine fungus oxygen transmethylase and its application | |
| Jayasuriya et al. | Discovery and antibacterial activity of glabramycin A–C from Neosartorya glabra by an antisense strategy | |
| Heo et al. | Construction of an artificial biosynthetic pathway for the styrylpyrone compound 11-methoxy-bisnoryangonin produced in engineered Escherichia coli | |
| CN106987578A (en) | A kind of Terpene synthase for producing koraiol and its application | |
| Liu et al. | Cloning and functional characterization of the polyketide synthases based on genome mining of Preussia isomera XL-1326 | |
| Li et al. | Biotransformation of limonene by marine bacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |