CN110878278A - Engineering strain for treating salt-containing organic wastewater and application thereof - Google Patents

Abstract

The invention discloses an engineering strain for treating salt-containing organic wastewater and application thereof, wherein the engineering strain is classified and named as Shewanella aquimarina XMS-1, is preserved in Guangdong province microorganism strain preservation center with the preservation number of GDMCC60908 and the preservation date of 2019, 11 and 25 days. The engineering strain has high transfer efficiency of extracellular electrons, and can efficiently degrade organic pollutants under the condition of high salt; in addition, the in-situ reduction of the graphene oxide is realized through the efficient reduction capability of the engineering bacteria, so that the efficient 3D composite biomembrane electrode is constructed, and the power generation capability of the strain by utilizing the wastewater is further improved.

Description

Engineering strain for treating salt-containing organic wastewater and application thereof

Technical Field

The invention relates to the field of microorganisms, and particularly relates to an engineering strain for treating salt-containing organic wastewater.

Background

Dissimilatory metal-reducing bacteria (DMRB) are a class of microorganisms that are capable of transferring electrons obtained during the metabolism of intracellular organic substrates to the outside of the cell and coupling the reduction of extracellular metal oxides. DMRB can take an important role in the fields of geochemical cycle of metal elements and energy recovery as a final electron acceptor by using insoluble metal oxides and solid-state electrodes. Meanwhile, the unique extracellular electron transfer process of the DMRB also plays a role in promoting the conversion of organic pollutants in the environment. Therefore, the DMRB also has potential application value in the field of environmental pollution remediation.

In the field of energy, Microbial Fuel Cells (MFCs) are a device for generating electric energy directly from the oxidation process of organic substances through the catalytic activity of microorganisms, and since MFCs can utilize various organic substances as fuels in an environmentally friendly manner, much attention and research have been drawn in the past decades, but their output power is small and thus they are greatly limited in practical use, mainly due to the lack of means for effectively improving the efficiency of transferring electrons in microbial cells to solid electrodes.

In recent years, many kinds of bacteria including genera of Shewanella, Geobacter, Desulfuromonas, Aeromonas, etc. have been identified as DMRB. Shewanella, a typical DMRB, is widely present in the natural environment. The Shewanella can proliferate in a complex and variable environment, and has diversity and flexibility in metabolic modes due to the fact that Shewanella can couple oxidation of various carbon sources and reduction of terminal electron acceptors. As facultative anaerobes, Shewanella bacteria can perform aerobic respiration by oxygen and intracellular respiration by soluble electron acceptors such as fumarate, nitrate, nitrite, thiosulfate, sulfite, and trimethylamine N-oxide (TMAO) that permeate into the periplasm of cells under anaerobic conditions. Meanwhile, as dissimilatory metal-reducing bacteria, Shewanella also has a special ability to perform extracellular dissimilatory reductive metabolism by using insoluble metal oxides such as Fe (III) and Mn (III/IV) as electron acceptors. The anaerobic respiratory metabolism of Shewanella bacteria is essentially the interaction between electrons generated by carbon source oxidation and a terminal electron acceptor, the terminal electron acceptor exists in the periplasm of cells and even outside the cells, the transport of electrons is needed in the metabolic process, and the diversified metabolic capability of Shewanella bacteria is bound to be supported by an efficient and diversified electron transport system. Currently, there are three major mechanisms for extracellular electron transfer, including direct electron transfer through bacterial surface redox proteins, conductive pili (also known as "nanowires"), and indirect electron transfer through an electron mediator.

Currently, most of the research on anaerobic metabolic pathway and electron transfer of Shewanella bacteria focuses on mild and laboratory conditions. However, a large amount of salt-containing components are often present in actual industrial wastewater. For example, in the printing and dyeing industry wastewater, the salt concentration can reach 15-20%. Too high salinity may cause bacterial plasmolysis, inhibiting bacterial activity and normal growth. Therefore, sludge treatment systems generally require pretreatment of wastewater to dilute the excess salt concentration prior to biological treatment, which tends to increase the time and cost of wastewater treatment. Therefore, it is very important to construct engineering strains with high-efficiency electricity generation and pollutant reduction capacity on the basis of the Shewanella halodurans.

Disclosure of Invention

The invention aims to solve the technical problem of obtaining the engineering strain with better reduction degradation capability and electricity generation capability on pollutants under the condition of salt.

In order to solve the technical problems, the invention adopts the following technical scheme:

an engineering strain for treating organic wastewater containing salt is characterized in that: the engineering strain is classified and named as Shewanella aquimarina XMS-1, is preserved in Guangdong province microorganism strain preservation center, and has the preservation number of GDMCC NO: 60908, preservation date of 2019, 11 and 25 months, preservation address: guangzhou city, first furious Zhonglu No. 100 large yard No. 59 building No. 5.

The engineering strain for treating the organic wastewater containing salt is constructed by taking Shewanella as an initial strain and overexpressing a riboflavin synthesis gene cluster by a molecular biological means. The specific construction steps are as follows:

(1) taking a riboflavin expression gene cluster, and amplifying the riboflavin expression gene cluster by adopting primers 1F and 1R to obtain an amplified riboflavin expression gene cluster, wherein the gene sequence of the primer 1F is shown as SEQ ID NO.1, and the gene sequence of the primer 1R is shown as SEQ ID NO. 2;

(2) taking a host plasmid, and amplifying the host plasmid by using primers 2F and 2R to obtain an amplified host plasmid, wherein the gene sequence of the primer 2F is shown as SEQ ID NO.3, and the gene sequence of the primer 2R is shown as SEQ ID NO. 4;

(3) assembling the amplified riboflavin expression gene cluster and the amplified host plasmid in a Gibson assembly mode to obtain an overexpression plasmid;

(4) and (3) conjugatively transferring the overexpression plasmid into Shewanella to obtain the engineering strain for treating the salt-containing organic wastewater.

Further, the riboflavin expression gene cluster was controlled using an arabinose promoter. The arabinose promoter has strong controllability for gene expression or silencing; compared with other promoters, the arabinose has the advantages of small toxicity to bacteria, stable induction effect, good expression effect and lower use cost.

Further, the DNA sequence of the riboflavin expression gene cluster is shown in SEQ ID NO. 5.

Further, the host plasmid is selected from plasmid pYYDT, and the gene sequence of the plasmid pYYDT is shown in SEQ ID NO. 6. The pYYDT plasmid is used as a broad-host plasmid of gram-negative bacteria, can be transferred into host cells in a combined transfer mode, and has simple and convenient operation and high success rate; and the pYYDT plasmid has the advantages of high copy number, good expression effect and stable expression in host cells.

Further, the gene sequence of the overexpression plasmid is shown as SEQ ID NO. 7.

Further, Shewanella uses a strain having a deposit name of Shewanella aquimarinasW-120(T) with accession number JCM 12193. The strain is a model strain with dissimilatory metal reduction capacity, is widely distributed in marine environment, can efficiently reduce and degrade various heavy metals, azo dyes and other organic pollutants under anaerobic conditions, and can normally grow under 6% of NaCl concentration. The main biological characteristics are as follows: gram-negative bacteria, facultative anaerobe, carry on the extracellular respiration through the complicated extracellular electron transport network, can utilize many substances as the terminal electron acceptor under the anaerobic condition, thus realize the reduction or degradation of different kinds of extracellular electron acceptors.

The invention also provides application of the engineering strain for treating the salt-containing organic wastewater in preparation of a microbial fuel cell or a pollutant treating agent.

The invention also provides a composite biological film of graphene and engineering strains, wherein the composite biological film is formed on the surface of the anode of the two-chamber microbial fuel cell, and is formed by performing closed culture on the engineering strains in the anode chamber of the two-chamber microbial fuel cell and realizing in-situ reduction of graphene oxide by using the reducing capability of the engineering strains, so that a layer of composite biological film of graphene and the engineering strains is formed on the surface of the anode.

The preparation method of the graphene and engineering strain composite biological membrane comprises the following steps: adding a mineral salt culture medium taking sodium lactate as a substrate into an anode chamber of the double-chamber microbial fuel cell to serve as a culture solution, then adding graphene oxide, then adding the engineering strain Shewanella aquimarina XMS-1 as claimed in claim 1, and performing closed culture to form a layer of composite biomembrane of graphene and the engineering strain on the surface of the anode.

Further, the concentration of graphene oxide added in the anode chamber was 0.2mg/mL, the initial concentration of the engineered strain in the anode chamber was OD600 ═ 0.3, and the culture temperature was 30 ℃.

The invention has the beneficial effects that:

there are two major mechanisms of extracellular electron transfer: (1) in the indirect electron transfer process, bacteria secrete electroactive metabolites as electron mediators; (2) electrons are transferred directly from the cell to the electrode through membrane cytochromes or conductive pili. Riboflavin is a redox active compound secreted by many microorganisms and plays an important role in the transfer of extracellular electrons. The invention takes high-salt-tolerance Shewanella as an original strain, takes a host plasmid as a vector skeleton, constructs a riboflavin over-expression plasmid by connecting riboflavin expression gene clusters, and can ensure that a large amount of riboflavin is secreted by an engineering strain in the growth process after the riboflavin over-expression plasmid is transformed into the Shewanella, thereby obviously improving the transfer efficiency of extracellular electrons of the Shewanella, simultaneously improving the reductive degradation capability of the strain on organic pollutants under the condition of salt, and having very good application prospect in the biological treatment process of salt-containing wastewater.

The invention constructs the composite biological membrane of the 3D graphene oxide and the engineering bacteria by modifying the electrode in a physical mode, and further improves the extracellular electron transfer efficiency of the engineering strain. Graphene is a novel carbon material with a two-dimensional honeycomb lattice structure formed by sp2 hybridization and close packing of single-layer carbon atoms. The graphene has the characteristics of ultrahigh mechanical property, low density, high heat conductivity, high specific surface area and the like. The graphene shows unique and excellent physical and electronic characteristics, so that the graphene has wide application prospects in various fields of composite materials, sensors, lithium batteries, hydrogen storage materials and the like. The graphene material has strong conductivity, high specific surface area and excellent biocompatibility. Therefore, the graphene is used for constructing the 3D reduced graphene oxide and engineering bacteria composite biological membrane on the surface of the electrode, so that the extracellular electron transfer efficiency of the bacteria is greatly improved.

Drawings

FIG. 1 is a map of an expression plasmid contained in the engineered strain Shewanella aquimarina XMS-1;

FIG. 2 is a schematic diagram showing the growth of the wild strain Shewanella aquimarinaSW-120(T) at a NaCl concentration of 1% to 8%;

FIG. 3 is a graph showing the rate of reduction of Methyl Orange (MO) by wild and engineered strains;

FIG. 4 is a graph showing the rate of reduction of Rocarsone (ROX) by wild and engineered strains;

FIG. 5 is a schematic of current densities in wild strains, engineered strains, and 3D composite biofilm electrodes;

FIG. 6 is a schematic of polarization curves and power densities in wild strains, engineered strains, and 3D composite biofilm electrodes;

FIG. 7 is a SEM diagram of the attachment growth of engineered strains on electrodes in an MFC setup;

fig. 8 is a SEM schematic of a 3D composite biofilm constructed on an electrode in an MFC device.

Detailed Description

The invention is further described below with reference to the following examples:

the experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The formulations of the media and solutions used in the following examples are as follows:

the LB liquid culture medium has the formula: 10g/L peptone, 40g/L NaCl, 5g/L yeast extract, and autoclaving at 121 deg.C for 20 min.

The formula of the mineral salt culture medium is as follows: HEPES buffer salt 11.91g/L, NaCl 40g/L, K₂HPO₄0.05g/L，KH₂PO₄0.035g/L，(NH₄)₂SO₄0.225g/L，MgSO₄·H₂0.117g/L of O, 10mM of sodium lactate and 100 Xof trace elements, and adjusting the pH of the culture medium to 7.2 after all the medicines are fully dissolved. The formula of the 100 x trace element mixed concentrated solution is shown in the following table:

NTA	1.5g/L
		MnCl2·4H2O	0.1g/L
FeSO4·7H2O	0.3g/L
		CoCl2·6H2O	0.17g/L
ZnCl2	0.1g/L
		CuSO4·5H 20	0.04g/L
AlK(SO4)2·12H 20	0.005g/L
		H3BO3	0.005g/L
Na2MoO4	0.09g/L
		NiCL2	0.12g/L
NaWO4·2H 20	0.02g/L
		Na2SeO4	0.1g/L

the LB solid culture medium has the formula: 10g/L peptone, 40g/L NaCl, 5g/L yeast extract and 15g/L agar, sterilizing at 121 deg.C under high pressure for 20min, and cooling and solidifying.

The formula of the potassium ferricyanide solution is as follows: na (Na)₂HPO₄·12H₂O 11.543g/L，NaH₂PO₄·2H₂O 3.133g/L，K₃Fe(CN)₆16.463g/L。

Example 1 construction of engineered Strain useful for treatment of organic wastewater containing salt

The expression plasmid used in this example is a broad-host plasmid pYYDT (the gene sequence is shown in SEQ ID NO. 6); the riboflavin expression gene cluster (controlled by an arabinose promoter and the DNA sequence of which is shown as SEQ ID NO. 5) is synthesized by a general biological system (Anhui) limited company, and the specific construction method is as follows:

adopting a primer 1F/1R (the gene sequence of the primer 1F is shown as SEQ ID NO.1, and the gene sequence of the primer 1R is shown as SEQ ID NO. 2) and taking a riboflavin expression gene cluster synthesized in a general biological system (Anhui) company Limited as a template, and obtaining a riboflavin expression module by utilizing a PCR (polymerase chain reaction) instrument for amplification; the pYYDT skeleton is obtained by using a PCR instrument to amplify by using a primer 2F/2R (the gene sequence of the primer 2F is shown as SEQ ID NO.3, and the gene sequence of the primer 2R is shown as SEQ ID NO. 4) and taking the pYYDT plasmid as a template. The PCR amplification conditions are shown in the following table (wherein, after step 1 is completed, steps 2 to 4 are cycled for 30 times, and then steps 5 and 6 are performed):

step 1	Step 2	Step 3	Step 4	Step 5	Step 6
						95℃	95℃	56℃	72℃	72℃	4℃
3min	15s	15s	30s/kb	5min	10min

Adding the product of the riboflavin gene fragment rib and the pYYDT plasmid skeleton obtained by PCR into 15 mu L of Gibson enzyme, uniformly mixing, placing in a PCR instrument, and keeping at a constant temperature of 50 ℃ for 1h to obtain the over-expression plasmid pYYDT-rib of the assembled product. And then, transferring the over-expression plasmid pYYDT-rib assembled by Gibson into an escherichia coli competent cell (purchased from Beijing holotype gold biology, Inc.), uniformly mixing, carrying out ice bath on the mixture for 30min, carrying out water bath at 42 ℃ for 2min, carrying out ice bath again for 2min, and transferring the over-expression plasmid pYYDT-rib into the escherichia coli competent cell through sudden temperature change. The E.coli competent transformation solution was spread evenly on LB plates (containing 50. mu.g/mL kanamycin) and cultured in a 37 ℃ incubator until a single colony grew out.

Coli single colonies grown on LB plates (containing 50. mu.g/mL kanamycin) were picked up, inoculated into LB liquid medium (to which 50. mu.g/mL kanamycin was added), and cultured in a 37 ℃ incubator for 12 hours. Meanwhile, a strain (hereinafter referred to as a wild strain) with the accession number of JCM12193 and the name of Shewanella aquimarina SW-120(T) is inoculated into an LB liquid culture medium and cultured in a constant temperature incubator at 30 ℃ for 12 h. And after 12h, respectively sucking 500 mu L of wild strain and escherichia coli bacterial liquid containing the over-expression plasmid, co-culturing, and transferring the over-expression plasmid pYYDT-rib into the wild strain through conjugal transfer to obtain the engineering strain (hereinafter referred to as engineering strain) for treating the salt-containing organic wastewater. The engineering strain is classified and named as Shewanella aquimarina XMS-1, is preserved in Guangdong province microorganism culture collection center, has the preservation number of GDMCC60908 and the preservation date of 2019, 11 and 25 days.

Example 2 comparison of the degradation rates of MO by engineered and wild strains under anaerobic conditions

The anaerobic reaction system used in this example is a serum bottle filled with 30mL of mineral salt medium, and after being exposed to nitrogen for 15min, the serum bottle is sealed with a butyl rubber plug and an aluminum cap to ensure a stable anaerobic environment in the reaction system. After autoclaving the medium at 121 ℃ for 20min, MO (to be sterilized by filtration through a 0.22 μm filter) was added to the flask by syringe to a final concentration of 50mg/L for further use.

Activating strains: carrying out plate streaking on an LB solid culture medium plate by using the engineering strain stored at the low temperature of minus 80 ℃, and then placing the engineering strain in a constant temperature incubator at the temperature of 30 ℃ for culturing until a single clone grows out. Scraping a single engineering strain on a solid plate culture medium by using an inoculating loop, inoculating the single engineering strain into 100mL of LB liquid culture medium, adding arabinose with the final concentration of 20mM to induce gene expression, simultaneously adding 30 mu g/mL of kanamycin to ensure the stability of plasmids, and then placing the strains on a shaking table with the temperature of 30 ℃ and the rotating speed of 200rpm for culturing for 16 hours to obtain activated bacteria liquid. After activation, bacteria in LB liquid medium were collected by centrifugation (6000rpm, 5min), and the collected bacteria were washed several times with mineral salt medium autoclaved at 121 ℃ for 20min to determine the concentration of bacterial liquid.

The washed bacterial solution was added to the anaerobic reaction system with a syringe so that the bacterial concentration in 30mL of the anaerobic reaction system was OD600 ═ 0.1. Placing the serum bottle in a constant temperature incubator at 30 ℃ for standing culture, and extracting a sample by using an injector at regular time for detection. The concentration of MO was measured at 465nm using an ultraviolet spectrophotometer.

For comparison, the wild strain was treated in the same manner.

As shown in FIG. 3, the engineered strain of the invention can degrade MO, and compared with the wild strain, the engineered strain has a higher removal rate of MO. Within 11h, the engineering strain completely decolorizes MO, while the decolorization rate of the wild strain is 64%, which shows that the engineering strain obtained by modification can degrade MO more efficiently under the salt-containing condition.

Example 3 comparison of the degradation rates of engineered and wild strains on roxarsone under anaerobic conditions

The anaerobic reaction system used in this example is a serum bottle filled with 30mL of mineral salt medium, and after being exposed to nitrogen for 15min, the serum bottle is sealed with a butyl rubber plug and an aluminum cap to ensure a stable anaerobic environment in the reaction system. After autoclaving the serum bottle with the medium at 121 ℃ for 20min, a final concentration of 0.2mM roxarsone (requiring filter sterilization through a 0.22 μm filter) was added via syringe for further use.

Activating strains: same as in example 2.

The washed bacterial solution was added to the anaerobic reaction system with a syringe so that the bacterial concentration in 30mL of the anaerobic reaction system was OD600 ═ 0.3. Placing the serum bottle in a constant temperature incubator at 30 ℃ for standing culture, and extracting a sample by using an injector at regular time for detection. The roxarsone concentration was determined by high performance liquid chromatography, HPLC, with the main HPLC test conditions shown in the table below:

for comparison, the wild strain was treated in the same manner.

As shown in FIG. 4, the engineering strain can degrade roxarsone, compared with a wild strain, the engineering strain has a higher speed for removing roxarsone, the engineering strain can completely degrade roxarsone within 25h, and the degradation rate of the wild strain is 70%, which shows that the engineering strain obtained through modification can more efficiently degrade roxarsone under the salt-containing condition.

Example 4 comparison of the Power Generation Capacity of engineered Strain and wild Strain Using wastewater under anaerobic conditions

Electrochemical tests of electrogenesis capacities of different strains are carried out in a reagent bottle type double-chamber microbial fuel cell, the volume of a positive chamber and a negative chamber is 100mL, and protons are transferred between the two chambers through a proton exchange membrane. The anode chamber takes a mineral salt culture medium as a culture solution, and the cathode chamber is added with a potassium ferricyanide solution. The cathode and the anode are made of 2cm × 2cm carbon felts, the two electrodes are connected by copper wires, and the external resistance is 1000 Ω. The anode chamber reactor is sealed by a seal cover with a frosted opening after being aerated and deoxidized by nitrogen.

Activating strains: same as in example 2.

The washed bacterial liquid was added to the anode chamber of the MFC device by a syringe so that the initial bacterial concentration in the anode chamber was OD600 ═ 0.3. The MFC device was placed in a 30 ℃ incubator for static culture and the current change was monitored by a multichannel potentiostat connected to a computer.

For comparison, the wild strain was treated in the same manner.

The electricity generating capacities of different strains in an electrochemical cell are compared by an electrochemical method, and the result is shown in figure 5, the two strains almost reach the maximum current at the same time after 10h of cultivation, and the maximum current density of the wild strain reaches 250mA/m²The maximum current density of the engineering strain reaches 450mA/m²1.8 times of the wild strain.

As shown in FIG. 6, the output power of the engineered strain was also significantly higher than that of the wild strain, comparing the polarization and power output curves of the wild strain and the engineered strain of the present invention. The maximum power density in MFC operated by wild strain can reach 20mW/m²In the MFC operated by the engineering strain, the maximum power density reaches 125mW/m²6.25 times of the wild strain.

The experimental result shows that the method provided by the invention can effectively improve the electricity generation performance of the wastewater utilized by Shewanella aquimarina.

Example 5 construction of composite biofilm of 3D graphene and engineering Strain on MFC electrode and measurement of Electricity Generation capability

The same assembly method as MFC in example 4, using a reagent bottle type two-chamber microbial fuel cell, the volume of both the positive and negative chambers was 100mL, and protons were transferred between the two chambers through a proton exchange membrane. The anode chamber takes a mineral salt culture medium as a culture solution, and a potassium ferricyanide solution is added into the cathode chamber. The cathode and the anode are made of 2cm × 2cm carbon felts, the two electrodes are connected by copper wires, and the external resistance is 1000 Ω.

Graphene Oxide (GO) (final concentration of 0.2mg/mL) is added to the MFC anode chamber, nitrogen is used for aeration to remove dissolved oxygen, and then the MFC anode chamber is sealed by a frosted opening sealing cover.

Activating strains: same as in example 2.

The washed bacterial liquid was added to the anode chamber of the MFC device by a syringe so that the initial bacterial concentration in the anode chamber was OD600 ═ 0.3. The MFC device was incubated in a 30 ℃ incubator with a magnetic stirrer at 50rpm and the current change was monitored by a multichannel potentiostat connected to a computer.

The electricity generating capacity of the 3D composite biological membrane in the electrochemical cell is tested by an electrochemical method, and the result is shown in figure 5. The engineering strain control group without 3D composite biomembrane reaches the maximum current of 450mA/m after 10h²And always maintain a stable output current. The output current of the experimental group for constructing the 3D composite biological membrane keeps a stable increasing trend all the time, and reaches the maximum output current of 650mA/m for about 90 hours²Is 1.44 times of the engineering strain and 2.6 times of the wild strain.

As shown in fig. 6, in the polarization and power output curves, the output power of the experimental group in which the 3D composite biofilm was constructed using graphene oxide was also significantly higher than that of the control group in which the 3D composite biofilm was not constructed. The maximum power density in MFC operated by experimental group for constructing 3D composite biological membrane reaches 165mW/m²The strain is 1.32 times of the engineering strain without 3D biomembrane and 8.25 times of the wild strain.

Fig. 7 is a view showing growth and adhesion of engineered bacteria on a carbon felt electrode prepared by a conventional method in example 4, and fig. 8 is a schematic view showing a scanning electron microscope of a 3D composite biofilm electrode prepared by this example. The reduced graphene oxide can be seen to form a thick layer of 3D biomembrane on the surface of the anode carbon felt, the biomass attached to the electrode is greatly improved, and more electrons can be transferred to the electrode.

The above experimental results show that: the invention successfully utilizes the engineering strain to reduce the graphene oxide, and further improves the electricity generation performance of the wastewater utilized by the Shewanella aquimarina.

According to the invention, the high-efficiency degradation of pollutants MO and ROX under the high-salt condition is realized by utilizing the transformed dissimilatory metal reducing bacterium Shewanella quimarina XMS-1 with high salt tolerance, and the reduction of graphene oxide is realized through the reduction capability of the engineering strain, so that a 3D biomembrane is constructed, and the degradation efficiency and the electricity generation performance of Shewanella quimarina on pollutants in wastewater are greatly improved. The strain has important application value in the fields of salt-containing organic wastewater treatment and microbial fuel cells.

It should be understood that the examples and embodiments described herein are for illustrative purposes only and are not intended to limit the scope of the present disclosure, and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this disclosure.

Sequence listing

<110> university of fertilizer industry

<120> engineering strain for treating salt-containing organic wastewater and application thereof

<130>2019

<160>7

<170>SIPOSequenceListing 1.0

<210>1

<211>24

<212>DNA

<213> Artificial sequence ()

<400>1

ctgcaggcat gcaagctttt aaaa 24

<210>2

<211>25

<212>DNA

<213> Artificial sequence ()

<400>2

tacaacgtcg tgactgggaa aactg 25

<210>3

<211>48

<212>DNA

<213> Artificial sequence ()

<400>3

ttttaaaagc ttgcatgcct gcagttatga caacttgacg gctacatc 48

<210>4

<211>48

<212>DNA

<213> Artificial sequence ()

<400>4

agttttccca gtcacgacgt tgtattaaga cattttagcc atcaaatc 48

<210>5

<211>3435

<212>DNA

<213> Artificial sequence ()

<400>5

atggaaaatg atgagcattt tatgaattta gcaatcctac tggctcgaaa aggaggggga 60

aacgttaatc caaatcctca agtaggagcg attattgtca atgatggtcg aattattggt 120

caaggttatc atgagaaata tggagaagca catgcggaaa tcaatgcatt taaatcttgt 180

atagaatcac cggaggggtc aaccatttat gtgaccttag aaccttgtgc ccaccaaggc 240

aagcaaccgc cttgttttga agcaatcatc aaaaataaag tgaagcgtgt agtcattggg 300

agtctagacc caaatccttt agtagctggt aagggaattg aagcaatgaa aaaagctgga 360

attgatgttt cattaaaagt tctagaaaaa gagtgcaaag acttaaataa gatttttttt 420

cattacgtca ctcaaagaac cccctacgtc atgatgaagt atgcgatgac tcttgatgga 480

aaaattgcga cttataaagg tcaatccaaa tggattacag gtgaaaaagc aagacaaaag 540

gtacatgaag accgttcacg tttcatggca atcatgattg gtgttgaaac acttctgaaa 600

gatgacccac aattaactgc cagaataaaa aatgggataa atccaattag aattatttgt 660

gatactcaac ttcgaacccc tcttacgtct aagattgttt ctactgcatt tgaaattcca 720

acaatcattg ctacctcaaa tgaaaacatt caaaaacatc aagcttttat tgaagccggt 780

tgcgagattt tactagtttc ttccatatct aaacatttgg atttgaaaga tttaatcact 840

aagttaggag aaagagaaat tgatagtctt attttagaag ggggagcaag actcaacgcc 900

tcagcattaa aagcaggaat tgttcaaaaa gttcaagcct atattgcccc taaaatattt 960

ggtgggaaag aagctccaag ttctgttgaa ggtctaggag tagagcatcc cgatcaagcc 1020

tatttactag accgacctca agtggcctat ttaggagaag atatattatt agaaagtgag 1080

ctcatttaat gtttacagga attattgagg aaataggaga ggtaactcaa attcaaaaga 1140

gagataagtc gtctaaatta atcattcgag cttccagcat cttagaagat ttaaaacttg 1200

gggattctat ctcaacaaat ggtctctgtt tgactgtttc cgcatttaat cataaagaat 1260

ttacagcaga tgttatgcca gagagtttca agcgttcaaa tttaggggaa ttaacagtag 1320

gaagtaaagt taatttagag cgagcagtgg ctctaaatgg tcgatttggc ggacatattg 1380

tttcagggca tattgatggt acaggaaaga ttttatcaat caagaaggaa gaaaatgcgg 1440

tttggtttga atttcaaaca actgtagact taatgaaata tgttgttgaa aaaggctcta 1500

ttacgattga tggcatcagt cttacggtgg ctcatgtgac ttcaaaatct tttagtgtgt 1560

caataattcc tcatactatc aaagagacca tattgtctgc aaagaaggtt ggagataaag 1620

ttaatttgga gaacgatata ttgggtaaat atatcgaaaa attacttact gggaaagatt 1680

cttttacagg gccttccttg ctgacaaagg ataaaataat tgattatgga ttttaagagg 1740

agataaaatg tttcaatata atacagtaga agaagcctta acagccctta aagcaggtga 1800

aataattatt gtcactgatg atgagaatag agaaaatgaa ggagatctga tttgtgcagc 1860

cgaaatgatt agtccagaaa agataaattt catggccagt caggcaaagg gattaatttg 1920

tagtccgatg agtgaaaaat atgctaagag tctgcatttg tcagcaatga cggagagaaa 1980

tacagacaac cacgggacag cttttactgt ttctgtcgat catgtagaga caagtacagg 2040

ggtatcagcc tttgaccgtt cgctgactat tagaaaactt gctgatgaag aaagttcagt 2100

cgaagatttt cgaagacctg gtcatgtctt tcctctgatt gcaaggaaaa atggagtctt 2160

agaacgcaat ggacacacag aagcaacagt tgatttgtta cgacttgctg gtctaaagga 2220

agtgggagtt tgtgttgaaa taatggccga agatggtagc atgatgcgca cagaagaact 2280

tcaagaaaaa gcaaaagaat gggacttgaa ttttatcaca atcaaggcca tacaaaaata 2340

tcgaaaacaa aatgaacaac tggttgagca agttaccaga gcgaaacttc caacaaaata 2400

tggttatttt gaaatctttg gatttgtcaa taaaataaat ggtgagcatc atgtcgccct 2460

agttaagggg gacattggag agggagaagc agtgctttgc cgagttcatt cggaatgttt 2520

gactggagat gcttttggct caatgaaatg tgattgtggt gaacaattag aacaagctct 2580

aacacagata aatgtcgagg gacgagggat tttattatat cttcggcaag aagggcgagg 2640

aatcggttta atcaacaaac ttcgtgcata ttcacttcaagatgaggggc ttgatacaat 2700

tgaagcaaat ttagccctag gttttgaaga agatgcgcgt gaatactcca taggtgctca 2760

aattttgaaa acacttggtg tgaagtcttt aagattaatg actaataacc cacaaaaaat 2820

caatgatttt tcaaaatatg gactaccagt taaagaaaga gttccaattc aaattaaaga 2880

aaatgaattt gatcaggatt atttaaaagt aaagcaaact aaaatgggac atttgttcga 2940

ttaaaataaa aagaaagcat ggatagaaaa atgacagtat ttgagggaaa tttaacaaca 3000

ggaaatgcca aatatggaat tgtagttgca cgttttaacg aattcatcaa cgcaaaactc 3060

ttagcagggg ccttagatgc tctcaaaaga catggtgttc aagaagaaca aattgatatt 3120

gcttgggtgc caggagcatt tgaaattccg cttattgcgc aaaaaatggc gagttcagat 3180

aaatatgatg ccattatctg cttaggtacg gtgattcgag gttctacttc acattatgat 3240

tttgtttgta gcgaggtttc taaagggatt gcccatgttt cactgaattc aaatatccct 3300

gttatgtttg gagtactgac gacagagaat attgaacaag cgattgaacg ttcaggaaca 3360

aaagcaggaa ataaaggatt tgaggtagca gttggtgcga ttgagatggt tgatttgatg 3420

gctaaaatgt cttaa 3435

<210>6

<211>5904

<212>DNA

<213> Artificial sequence ()

<400>6

cacctcgcta acggattcac cgtttttatc aggctctggg aggcagaata aatgatcata 60

tcgtcaatta ttacctccac ggggagagcc tgagcaaact ggcctcaggc atttgagaag 120

cacacggtca cactgcttcc ggtagtcaat aaaccggtca gaatttcaga taaaaaaaat 180

ccttagcttt cgctaaggat gatttctgtg gtacctcgga tcccggggag ctagcacgaa 240

ttcgcggccg cttctagacc gacaccatcg aatggtgcaa aacctttcgc ggtatggcat 300

gatagcgccc ggaagagagt caattcaggg tggtgaatgt gaaaccagta acgttatacg 360

atgtcgcaga gtatgccggt gtctcttatc agaccgtttc ccgcgtggtg aaccaggcca 420

gccacgtttc tgcgaaaacg cgggaaaaag tggaagcggc gatggcggag ctgaattaca 480

ttcccaaccg cgtggcacaa caactggcgg gcaaacagtc gttgctgatt ggcgttgcca 540

cctccagtct ggccctgcac gcgccgtcgc aaattgtcgc ggcgattaaa tctcgcgccg 600

atcaactggg tgccagcgtg gtggtgtcga tggtagaacg aagcggcgtc gaagcctgta 660

aagcggcggt gcacaatctt ctcgcgcaac gcgtcagtgg gctgatcatt aactatccgc 720

tggatgacca ggatgccatt gctgtggaag ctgcctgcac taatgttccg gcgttatttc 780

ttgatgtctc tgaccagaca cccatcaaca gtattatttt ctcccatgaa gacggtacgc 840

gactgggcgt ggagcatctg gtcgcattgg gtcaccagca aatcgcgctg ttagcgggcc 900

cattaagttc tgtctcggcg cgtctgcgtc tggctggctg gcataaatat ctcactcgca 960

atcaaattca gccgatagcg gaacgggaag gcgactggag tgccatgtcc ggttttcaac 1020

aaaccatgca aatgctgaat gagggcatcg ttcccactgc gatgctggtt gccaacgatc 1080

agatggcgct gggcgcaatg cgcgccatta ccgagtccgg gctgcgcgtt ggtgcggata 1140

tctcggtagt gggatacgac gataccgaag acagctcatg ttatatcccg ccgttaacca 1200

ccatcaaaca ggattttcgc ctgctggggc aaaccagcgt ggaccgcttg ctgcaactct 1260

ctcagggcca ggcggtgaag ggcaatcagc tgttgcccgt ctcactggtg aaaagaaaaa 1320

ccaccctggc gcccaatacg caaaccgcct ctccccgcgc gttggccgat tcattaatgc 1380

agctggcacg acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc aattaatgta 1440

agttagctca ctcattaggc acaattctca tgtttgacag cttatcatcg actgcacggt 1500

gcaccaatgc ttctggcgtc aggcagccat cggaagctgt ggtatggctg tgcaggtcgt 1560

aaatcactgc ataattcgtg tcgctcaagg cgcactcccg ttctggataa tgttttttgc 1620

gccgacatca taacggttct ggcaaatatt ctgaaatgag ctgttgacaa ttaatcatcg 1680

gctcgtataa tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagccagtcc 1740

gtttaggtgt tttcacgagc acttcaccaa caaggaccat agcatatgcc actagtagcg 1800

gccgcctgca ggtggtcgac cactcgaggc caggcatcaa ataaaacgaa aggctcagtc 1860

gaaagactgg gcctttcgtt ttatctgttg tttgtcggtg aacgctctct actagagtca 1920

cactggctca ccttcgggtg ggcctttctg cgtttataac cggtaaacca gcaatagaca 1980

taagcggcta tttaacgacc ctgccctgaa ccgacgaccg ggtcgaattt gctttcgaac 2040

cccagagtcc cgctcagaag aactcgtcaa gaaggcgata gaaggcgatg cgctgcgaat 2100

cgggagcggc gataccgtaa agcacgagga agcggtcagc ccattcgccg ccaagctctt 2160

cagcaatatc acgggtagcc aacgctatgt cctgatagcg gtccgccaca cccagccggc 2220

cacagtcgat gaatccagaa aagcggccat tttccaccat gatattcggc aagcaggcat 2280

cgccatgggt cacgacgaga tcctcgccgt cgggcatgcg cgccttgagc ctggcgaaca 2340

gttcggctgg cgcgagcccc tgatgctctt cgtccagatc atcctgatcg acaagaccgg 2400

cttccatccg agtacgtgct cgctcgatgc gatgtttcgc ttggtggtcg aatgggcagg 2460

tagccggatc aagcgtatgc agccgccgca ttgcatcagc catgatggat actttctcgg 2520

caggagcaag gtgagatgac aggagatcct gccccggcac ttcgcccaat agcagccagt 2580

cccttcccgc ttcagtgaca acgtcgagca cagctgcgca aggaacgccc gtcgtggcca 2640

gccacgatag ccgcgctgcc tcgtcctgca gttcattcag ggcaccggac aggtcggtct 2700

tgacaaaaag aaccgggcgc ccctgcgctg acagccggaa cacggcggca tcagagcagc 2760

cgattgtctg ttgtgcccag tcatagccga atagcctctc cacccaagcg gccggagaac 2820

ctgcgtgcaa tccatcttgt tcaatcatgc gaaacgatcc tcatcctgtc tcttgatcag 2880

atcttgatcc cctgcgccat cagatccttg gcggcaagaa agccatccag tttactttgc 2940

agggcttccc aaccttacca gagggcgccc cagctggcaa ttccggttcg cttgctgtcc 3000

ataaaaccgc ccagtctagc tatcgccatg taagcccact gcaagctacc tgctttctct 3060

ttgcgcttgc gttttccctt gtccagatag cccagtagct gacattcatc ccaggtggca 3120

cttttcgggg aaatgtgcgc gcccgcgttc ctgctggcgc tgggcctgtt tctggcgctg 3180

gacttcccgc tgttccgtca gcagcttttc gcccacggcc ttgatgatcg cggcggcctt 3240

ggcctgcata tcccgattca acggccccag ggcgtccagaacgggcttca ggcgctcccg 3300

aaggtctcgg gccgtctctt gggcttgatc ggccttcttg cgcatctcac gcgctcctgc 3360

ggcggcctgt agggcaggct catacccctg ccgaaccgct tttgtcagcc ggtcggccac 3420

ggcttccggc gtctcaacgc gctttgagat tcccagcttt tcggccaatc cctgcggtgc 3480

ataggcgcgt ggctcgaccg cttgcgggct gatggtgacg tggcccactg gtggccgctc 3540

cagggcctcg tagaacgcct gaatgcgcgt gtgacgtgcc ttgctgccct cgatgccccg 3600

ttgcagccct agatcggcca cagcggccgc aaacgtggtc tggtcgcggg tcatctgcgc 3660

tttgttgccg atgaactcct tggccgacag cctgccgtcc tgcgtcagcg gcaccacgaa 3720

cgcggtcatg tgcgggctgg tttcgtcacg gtggatgctg gccgtcacga tgcgatccgc 3780

cccgtacttg tccgccagcc acttgtgcgc cttctcgaag aacgccgcct gctgttcttg 3840

gctggccgac ttccaccatt ccgggctggc cgtcatgacg tactcgaccg ccaacacagc 3900

gtccttgcgc cgcttctctg gcagcaactc gcgcagtcgg cccatcgctt catcggtgct 3960

gctggccgcc cagtgctcgt tctctggcgt cctgctggcg tcagcgttgg gcgtctcgcg 4020

ctcgcggtag gcgtgcttga gactggccgc cacgttgccc attttcgcca gcttcttgca 4080

tcgcatgatc gcgtatgccg ccatgcctgc ccctcccttt tggtgtccaa ccggctcgac 4140

gggggcagcg caaggcggtg cctccggcgg gccactcaat gcttgagtat actcactaga 4200

ctttgcttcg caaagtcgtg accgcctacg gcggctgcgg cgccctacgg gcttgctctc 4260

cgggcttcgc cctgcgcggt cgctgcgctc ccttgccagc ccgtggatat gtggacgatg 4320

gccgcgagcg gccaccggct ggctcgcttc gctcggcccg tggacaaccc tgctggacaa 4380

gctgatggac aggctgcgcc tgcccacgag cttgaccaca gggattgccc accggctacc 4440

cagccttcga ccacataccc accggctcca actgcgcggc ctgcggcctt gccccatcaa 4500

tttttttaat tttctctggg gaaaagcctc cggcctgcgg cctgcgcgct tcgcttgccg 4560

gttggacacc aagtggaagg cgggtcaagg ctcgcgcagc gaccgcgcag cggcttggcc 4620

ttgacgcgcc tggaacgacc caagcctatg cgagtggggg cagtcgaagg cgaagcccgc 4680

ccgcctgccc cccgagcctc acggcggcga gtgcgggggt tccaaggggg cagcgccacc 4740

ttgggcaagg ccgaaggccg cgcagtcgat caacaagccc cggaggggcc actttttgcc 4800

ggagggggag ccgcgccgaa ggcgtggggg aaccccgcag gggtgccctt ctttgggcac 4860

caaagaacta gatatagggc gaaatgcgaa agacttaaaa atcaacaact taaaaaaggg 4920

gggtacgcaa cagctcattg cggcaccccc cgcaatagct cattgcgtag gttaaagaaa 4980

atctgtaatt gactgccact tttacgcaac gcataattgt tgtcgcgctg ccgaaaagtt 5040

gcagctgatt gcgcatggtg ccgcaaccgt gcggcaccct accgcatgga gataagcatg 5100

gccacgcagt ccagagaaat cggcattcaa gccaagaaca agcccggtca ctgggtgcaa 5160

acggaacgca aagcgcatga ggcgtgggcc gggcttattg cgaggaaacc cacggcggca 5220

atgctgctgc atcacctcgt ggcgcagatg ggccaccaga acgccgtggt ggtcagccag 5280

aagacacttt ccaagctcat cggacgttct ttgcggacgg tccaatacgc agtcaaggac 5340

ttggtggccg agcgctggat ctccgtcgtg aagctcaacg gccccggcac cgtgtcggcc 5400

tacgtggtca atgaccgcgt ggcgtggggc cagccccgcg accagttgcg cctgtcggtg 5460

ttcagtgccg ccgtggtggt tgatcacgac gaccaggacg aatcgctgtt ggggcatggc 5520

gacctgcgcc gcatcccgac cctgtatccg ggcgagcagc aactaccgac cggccccggc 5580

gaggagccgc ccagccagcc cggcattccg ggcatggaac cagacctgcc agccttgacc 5640

gaaacggagg aatgggaacg gcgcgggcag cagcgcctgc cgatgcccga tgagccgtgt 5700

tttctggacg atggcgagcc gttggagccg ccgacacggg tcacgctgcc gcgccggtag 5760

cacttgggtt gcgcagcaac ccgtaagtgc gctgttccag actatcggct gtagccgcct 5820

cgccgcccta taccttgtct gcctccccgc gttgcgtcgc ggtgcatgga gccgggccac 5880

ctcgacctga atggaagccg gcgg 5904

<210>7

<211>9107

<212>DNA

<213> Artificial sequence ()

<400>7

cacctcgcta acggattcac cgtttttatc aggctctggg aggcagaata aatgatcata 60

tcgtcaatta ttacctccac ggggagagcc tgagcaaact ggcctcaggc atttgagaag 120

cacacggtca cactgcttcc ggtagtcaat aaaccggtca gaatttcaga taaaaaaaat 180

ccttagcttt cgctaaggat gatttctgtg gtacctcgga tcccggggag ccgacactga 240

atttgctcaa atttttgttt gtagaattag aatatattta tttggctcat atttgctttt 300

taaaagcttg catgcctgca gttatgacaa cttgacggct acatcattca ctttttcttc 360

acaaccggca cggaactcgc tcgggctggc cccggtgcat tttttaaata cccgcgagaa 420

atagagttga tcgtcaaaac caacattgcg accgacggtg gcgataggca tccgggtggt 480

gctcaaaagc agcttcgcct ggctgatacg ttggtcctcg cgccagctta agacgctaat 540

ccctaactgc tggcggaaaa gatgtgacag acgcgacggc gacaagcaaa catgctgtgc 600

gacgctggcg atatcaaaat tgctgtctgc caggtgatcg ctgatgtact gacaagcctc 660

gcgtacccga ttatccatcg gtggatggag cgactcgtta atcgcttcca tgcgccgcag 720

taacaattgc tcaagcagat ttatcgccag cagctccgaa tagcgccctt ccccttgccc 780

ggcgttaatg atttgcccaa acaggtcgct gaaatgcggc tggtgcgctt catccgggcg 840

aaagaacccc gtattggcaa atattgacgg ccagttaagc cattcatgcc agtaggcgcg 900

cggacgaaag taaacccact ggtgatacca ttcgcgagcc tccggatgac gaccgtagtg 960

atgaatctct cctggcggga acagcaaaat atcacccggt cggcaaacaa attctcgtcc 1020

ctgatttttc accaccccct gaccgcgaat ggtgagattg agaatataac ctttcattcc 1080

cagcggtcgg tcgataaaaa aatcgagata accgttggcc tcaatcggcg ttaaacccgc 1140

caccagatgg gcattaaacg agtatcccgg cagcagggga tcattttgcg cttcagccat 1200

acttttcata ctcccaccat tcagagaaga aaccaattgt ccatattgca tcagacattg 1260

ccgtcactgc gtcttttact ggctcttctc gctaacccaa ccggtaaccc cgcttattaa 1320

aagcattctg taacaaagcg ggaccaaagc catgacaaaa acgcgtaaca aaagtgtcta 1380

taatcacggc agaaaagtcc acattgatta tttgcacggcgtcacacttt gctatgccat 1440

agcattttta tccataagat tagcggatcc tacctgacgc tttttatcgc aactctctac 1500

tgtttctcca tacccgtttt tttggacgcg tacaactcaa gtctgacata aatggaaaat 1560

gatgagcatt ttatgaattt agcaatccta ctggctcgaa aaggaggggg aaacgttaat 1620

ccaaatcctc aagtaggagc gattattgtc aatgatggtc gaattattgg tcaaggttat 1680

catgagaaat atggagaagc acatgcggaa atcaatgcat ttaaatcttg tatagaatca 1740

ccggaggggt caaccattta tgtgacctta gaaccttgtg cccaccaagg caagcaaccg 1800

ccttgttttg aagcaatcat caaaaataaa gtgaagcgtg tagtcattgg gagtctagac 1860

ccaaatcctt tagtagctgg taagggaatt gaagcaatga aaaaagctgg aattgatgtt 1920

tcattaaaag ttctagaaaa agagtgcaaa gacttaaata agattttttt tcattacgtc 1980

actcaaagaa ccccctacgt catgatgaag tatgcgatga ctcttgatgg aaaaattgcg 2040

acttataaag gtcaatccaa atggattaca ggtgaaaaag caagacaaaa ggtacatgaa 2100

gaccgttcac gtttcatggc aatcatgatt ggtgttgaaa cacttctgaa agatgaccca 2160

caattaactg ccagaataaa aaatgggata aatccaatta gaattatttg tgatactcaa 2220

cttcgaaccc ctcttacgtc taagattgtt tctactgcat ttgaaattcc aacaatcatt 2280

gctacctcaa atgaaaacat tcaaaaacat caagctttta ttgaagccgg ttgcgagatt 2340

ttactagttt cttccatatc taaacatttg gatttgaaag atttaatcac taagttagga 2400

gaaagagaaa ttgatagtct tattttagaa gggggagcaa gactcaacgc ctcagcatta 2460

aaagcaggaa ttgttcaaaa agttcaagcc tatattgccc ctaaaatatt tggtgggaaa 2520

gaagctccaa gttctgttga aggtctagga gtagagcatc ccgatcaagc ctatttacta 2580

gaccgacctc aagtggccta tttaggagaa gatatattat tagaaagtga gctcatttaa 2640

tgtttacagg aattattgag gaaataggag aggtaactca aattcaaaag agagataagt 2700

cgtctaaatt aatcattcga gcttccagca tcttagaaga tttaaaactt ggggattcta 2760

tctcaacaaa tggtctctgt ttgactgttt ccgcatttaa tcataaagaa tttacagcag 2820

atgttatgcc agagagtttc aagcgttcaa atttagggga attaacagta ggaagtaaag 2880

ttaatttaga gcgagcagtg gctctaaatg gtcgatttgg cggacatatt gtttcagggc 2940

atattgatgg tacaggaaag attttatcaa tcaagaagga agaaaatgcg gtttggtttg 3000

aatttcaaac aactgtagac ttaatgaaat atgttgttga aaaaggctct attacgattg 3060

atggcatcag tcttacggtg gctcatgtga cttcaaaatc ttttagtgtg tcaataattc 3120

ctcatactat caaagagacc atattgtctg caaagaaggt tggagataaa gttaatttgg 3180

agaacgatat attgggtaaa tatatcgaaa aattacttac tgggaaagat tcttttacag 3240

ggccttcctt gctgacaaag gataaaataa ttgattatgg attttaagag gagataaaat 3300

gtttcaatat aatacagtag aagaagcctt aacagccctt aaagcaggtg aaataattat 3360

tgtcactgat gatgagaata gagaaaatga aggagatctg atttgtgcag ccgaaatgat 3420

tagtccagaa aagataaatt tcatggccag tcaggcaaag ggattaattt gtagtccgat 3480

gagtgaaaaa tatgctaaga gtctgcattt gtcagcaatg acggagagaa atacagacaa 3540

ccacgggaca gcttttactg tttctgtcga tcatgtagag acaagtacag gggtatcagc 3600

ctttgaccgt tcgctgacta ttagaaaact tgctgatgaa gaaagttcag tcgaagattt 3660

tcgaagacct ggtcatgtct ttcctctgat tgcaaggaaa aatggagtct tagaacgcaa 3720

tggacacaca gaagcaacag ttgatttgtt acgacttgct ggtctaaagg aagtgggagt 3780

ttgtgttgaa ataatggccg aagatggtag catgatgcgc acagaagaac ttcaagaaaa 3840

agcaaaagaa tgggacttga attttatcac aatcaaggcc atacaaaaat atcgaaaaca 3900

aaatgaacaa ctggttgagc aagttaccag agcgaaactt ccaacaaaat atggttattt 3960

tgaaatcttt ggatttgtca ataaaataaa tggtgagcat catgtcgccc tagttaaggg 4020

ggacattgga gagggagaag cagtgctttg ccgagttcat tcggaatgtt tgactggaga 4080

tgcttttggc tcaatgaaat gtgattgtgg tgaacaatta gaacaagctc taacacagat 4140

aaatgtcgag ggacgaggga ttttattata tcttcggcaa gaagggcgag gaatcggttt 4200

aatcaacaaa cttcgtgcat attcacttca agatgagggg cttgatacaa ttgaagcaaa 4260

tttagcccta ggttttgaag aagatgcgcg tgaatactcc ataggtgctc aaattttgaa 4320

aacacttggt gtgaagtctt taagattaat gactaataac ccacaaaaaa tcaatgattt 4380

ttcaaaatat ggactaccag ttaaagaaag agttccaatt caaattaaag aaaatgaatt 4440

tgatcaggat tatttaaaag taaagcaaac taaaatggga catttgttcg attaaaataa 4500

aaagaaagca tggatagaaa aatgacagta tttgagggaa atttaacaac aggaaatgcc 4560

aaatatggaa ttgtagttgc acgttttaac gaattcatca acgcaaaact cttagcaggg 4620

gccttagatg ctctcaaaag acatggtgtt caagaagaac aaattgatat tgcttgggtg 4680

ccaggagcat ttgaaattcc gcttattgcg caaaaaatgg cgagttcaga taaatatgat 4740

gccattatct gcttaggtac ggtgattcga ggttctactt cacattatga ttttgtttgt 4800

agcgaggttt ctaaagggat tgcccatgtt tcactgaatt caaatatccc tgttatgttt 4860

ggagtactga cgacagagaa tattgaacaa gcgattgaac gttcaggaac aaaagcagga 4920

aataaaggat ttgaggtagc agttggtgcg attgagatgg ttgatttgat ggctaaaatg 4980

tcttaataca acgtcgtgac tgggaaaact gcaggtggtc gaccactcga ggccaggcat 5040

caaataaaac gaaaggctca gtcgaaagac tgggcctttc gttttatctg ttgtttgtcg 5100

gtgaacgctc tctactagag tcacactggc tcaccttcgg gtgggccttt ctgcgtttat 5160

aaccggtaaa ccagcaatag acataagcgg ctatttaacg accctgccct gaaccgacga 5220

ccgggtcgaa tttgctttcg aaccccagag tcccgctcag aagaactcgt caagaaggcg 5280

atagaaggcg atgcgctgcg aatcgggagc ggcgataccg taaagcacga ggaagcggtc 5340

agcccattcg ccgccaagct cttcagcaat atcacgggta gccaacgcta tgtcctgata 5400

gcggtccgcc acacccagcc ggccacagtc gatgaatcca gaaaagcggc cattttccac 5460

catgatattc ggcaagcagg catcgccatg ggtcacgacg agatcctcgc cgtcgggcat 5520

gcgcgccttg agcctggcga acagttcggc tggcgcgagc ccctgatgct cttcgtccag 5580

atcatcctga tcgacaagac cggcttccat ccgagtacgt gctcgctcga tgcgatgttt 5640

cgcttggtgg tcgaatgggc aggtagccgg atcaagcgta tgcagccgcc gcattgcatc 5700

agccatgatg gatactttct cggcaggagc aaggtgagat gacaggagat cctgccccgg 5760

cacttcgccc aatagcagcc agtcccttcc cgcttcagtg acaacgtcga gcacagctgc 5820

gcaaggaacg cccgtcgtgg ccagccacga tagccgcgct gcctcgtcct gcagttcatt 5880

cagggcaccg gacaggtcgg tcttgacaaa aagaaccggg cgcccctgcg ctgacagccg 5940

gaacacggcg gcatcagagc agccgattgt ctgttgtgcc cagtcatagc cgaatagcct 6000

ctccacccaa gcggccggag aacctgcgtg caatccatct tgttcaatca tgcgaaacga 6060

tcctcatcct gtctcttgat cagatcttga tcccctgcgc catcagatcc ttggcggcaa 6120

gaaagccatc cagtttactt tgcagggctt cccaacctta ccagagggcg ccccagctgg 6180

caattccggt tcgcttgctg tccataaaac cgcccagtct agctatcgcc atgtaagccc 6240

actgcaagct acctgctttc tctttgcgct tgcgttttcc cttgtccaga tagcccagta 6300

gctgacattc atcccaggtg gcacttttcg gggaaatgtg cgcgcccgcg ttcctgctgg 6360

cgctgggcct gtttctggcg ctggacttcc cgctgttccg tcagcagctt ttcgcccacg 6420

gccttgatga tcgcggcggc cttggcctgc atatcccgat tcaacggccc cagggcgtcc 6480

agaacgggct tcaggcgctc ccgaaggtct cgggccgtct cttgggcttg atcggccttc 6540

ttgcgcatct cacgcgctcc tgcggcggcc tgtagggcag gctcataccc ctgccgaacc 6600

gcttttgtca gccggtcggc cacggcttcc ggcgtctcaa cgcgctttga gattcccagc 6660

ttttcggcca atccctgcgg tgcataggcg cgtggctcga ccgcttgcgg gctgatggtg 6720

acgtggccca ctggtggccg ctccagggcc tcgtagaacg cctgaatgcg cgtgtgacgt 6780

gccttgctgc cctcgatgcc ccgttgcagc cctagatcgg ccacagcggc cgcaaacgtg 6840

gtctggtcgc gggtcatctg cgctttgttg ccgatgaact ccttggccga cagcctgccg 6900

tcctgcgtca gcggcaccac gaacgcggtc atgtgcgggc tggtttcgtc acggtggatg 6960

ctggccgtca cgatgcgatc cgccccgtac ttgtccgcca gccacttgtg cgccttctcg 7020

aagaacgccg cctgctgttc ttggctggcc gacttccacc attccgggct ggccgtcatg 7080

acgtactcga ccgccaacac agcgtccttg cgccgcttct ctggcagcaa ctcgcgcagt 7140

cggcccatcg cttcatcggt gctgctggcc gcccagtgct cgttctctgg cgtcctgctg 7200

gcgtcagcgt tgggcgtctc gcgctcgcgg taggcgtgct tgagactggc cgccacgttg 7260

cccattttcg ccagcttctt gcatcgcatg atcgcgtatg ccgccatgcc tgcccctccc 7320

ttttggtgtc caaccggctc gacgggggca gcgcaaggcg gtgcctccgg cgggccactc 7380

aatgcttgag tatactcact agactttgct tcgcaaagtc gtgaccgcct acggcggctg 7440

cggcgcccta cgggcttgct ctccgggctt cgccctgcgc ggtcgctgcg ctcccttgcc 7500

agcccgtgga tatgtggacg atggccgcga gcggccaccg gctggctcgc ttcgctcggc 7560

ccgtggacaa ccctgctgga caagctgatg gacaggctgc gcctgcccac gagcttgacc 7620

acagggattg cccaccggct acccagcctt cgaccacata cccaccggct ccaactgcgc 7680

ggcctgcggc cttgccccat caattttttt aattttctct ggggaaaagc ctccggcctg 7740

cggcctgcgc gcttcgcttg ccggttggac accaagtgga aggcgggtca aggctcgcgc 7800

agcgaccgcg cagcggcttg gccttgacgc gcctggaacg acccaagcct atgcgagtgg 7860

gggcagtcga aggcgaagcc cgcccgcctg ccccccgagc ctcacggcgg cgagtgcggg 7920

ggttccaagg gggcagcgcc accttgggca aggccgaagg ccgcgcagtc gatcaacaag 7980

ccccggaggg gccacttttt gccggagggg gagccgcgcc gaaggcgtgg gggaaccccg 8040

caggggtgcc cttctttggg caccaaagaa ctagatatag ggcgaaatgc gaaagactta 8100

aaaatcaaca acttaaaaaa ggggggtacg caacagctca ttgcggcacc ccccgcaata 8160

gctcattgcg taggttaaag aaaatctgta attgactgcc acttttacgc aacgcataat 8220

tgttgtcgcg ctgccgaaaa gttgcagctg attgcgcatg gtgccgcaac cgtgcggcac 8280

cctaccgcat ggagataagc atggccacgc agtccagaga aatcggcatt caagccaaga 8340

acaagcccgg tcactgggtg caaacggaac gcaaagcgca tgaggcgtgg gccgggctta 8400

ttgcgaggaa acccacggcg gcaatgctgc tgcatcacct cgtggcgcag atgggccacc 8460

agaacgccgt ggtggtcagc cagaagacac tttccaagct catcggacgt tctttgcgga 8520

cggtccaata cgcagtcaag gacttggtgg ccgagcgctg gatctccgtc gtgaagctca 8580

acggccccgg caccgtgtcg gcctacgtgg tcaatgaccg cgtggcgtgg ggccagcccc 8640

gcgaccagtt gcgcctgtcg gtgttcagtg ccgccgtggt ggttgatcac gacgaccagg 8700

acgaatcgct gttggggcat ggcgacctgc gccgcatccc gaccctgtat ccgggcgagc 8760

agcaactacc gaccggcccc ggcgaggagc cgcccagcca gcccggcatt ccgggcatgg 8820

aaccagacct gccagccttg accgaaacgg aggaatggga acggcgcggg cagcagcgcc 8880

tgccgatgcc cgatgagccg tgttttctgg acgatggcga gccgttggag ccgccgacac 8940

gggtcacgct gccgcgccgg tagcacttgg gttgcgcagc aacccgtaag tgcgctgttc 9000

cagactatcg gctgtagccg cctcgccgcc ctataccttg tctgcctccc cgcgttgcgt 9060

cgcggtgcat ggagccgggc cacctcgacc tgaatggaag ccggcgg 9107

Claims (6)

1. An engineering strain for treating organic wastewater containing salt is characterized in that: the engineering strain is classified and named as Shewanella aquimarina XMS-1, is preserved in Guangdong province microorganism strain preservation center, and has the preservation number of GDMCC NO: 60908, the preservation date is 11 months and 25 days in 2019.

2. Use of the engineered strain of claim 1 for treatment of salt-containing organic wastewater in the preparation of a pollutant treating agent for treatment of salt-containing organic wastewater.

3. Use of the engineered strain of claim 1 for treatment of organic wastewater containing salts in a microbial fuel cell.

4. A composite biological membrane of graphene and engineering strains is characterized in that: the composite biofilm is formed on the surface of an anode of a double-chamber microbial fuel cell, and is formed by performing closed culture on the engineering strain according to claim 1 in an anode chamber of the double-chamber microbial fuel cell, and simultaneously realizing in-situ reduction of graphene oxide by utilizing the reduction capability of the engineering strain, so that a layer of composite biofilm of graphene and the engineering strain is formed on the surface of the anode.

5. A method for preparing the graphene and engineering strain composite biological membrane according to claim 4, which is characterized in that: adding a mineral salt culture medium taking sodium lactate as a substrate into an anode chamber of the double-chamber microbial fuel cell to serve as a culture solution, then adding graphene oxide, then adding the engineering strain Shewanella aquimarina XMS-1 as claimed in claim 1, and performing closed culture to form a layer of composite biomembrane of graphene and the engineering strain on the surface of the anode.

6. The method of claim 5, wherein: the addition concentration of graphene oxide in the anode chamber was 0.2mg/mL, the initial concentration of the engineering strain in the anode chamber was OD600 ═ 0.3, and the culture temperature was 30 ℃.

Images