CN110878263A

CN110878263A - Application of alcaligenes faecalis and metabolite thereof in prevention and treatment of storage-period grain and oil aspergillus flavus and toxin

Info

Publication number: CN110878263A
Application number: CN201910370879.1A
Authority: CN
Inventors: 宫安东; 孔宪巍; 吴楠楠; 闫建丽; 郜振; 周伶强; 袁景嘉; 张静柏; 廖玉才
Original assignee: Xinyang Normal University
Current assignee: Xinyang Normal University
Priority date: 2019-05-06
Filing date: 2019-05-06
Publication date: 2020-03-13

Abstract

The invention discloses an Alcaligenes faecalis (Alcaligenes faecalis) N1-4 with a preservation number of CCTCC M2019299. The metabolites include dimethyl disulfide (DMDS) and Methyl Isovalerate (MI). Meanwhile, the application also discloses application of the strain N1-4 and metabolites in inhibiting aspergillus flavus and toxin in the storage period. The Alcaligenes faecalis N1-4 and volatile metabolites thereof can effectively inhibit the aflatoxin attack and toxin pollution of high-water-activity peanuts, corns, soybeans, rice and the like, and four crop seeds in a closed culture environment. Meanwhile, the invention also proves that the volatile substance generated by N1-4 has broad-spectrum antibacterial action and can efficiently inhibit the growth of other 6 important pathogenic fungi.

Description

Application of alcaligenes faecalis and metabolite thereof in prevention and treatment of storage-period grain and oil aspergillus flavus and toxin

Technical Field

The invention belongs to the technical field of biological control of plant diseases, and particularly relates to an alcaligenes faecalis, a metabolite thereof and application thereof.

Background

Aspergillus flavus is an important soil-borne fungal disease, and can infect a plurality of important grain and oil crops such as peanuts, corns, soybeans, cottons and nuts and agricultural and sideline products in the field and in the storage period, so that serious economic loss is caused, and Aflatoxin (AFT) with high toxicity and strong carcinogenic effect can be generated to seriously affect the health of human bodies. To date, 18 aflatoxins have been found, of which AFB1, AFB2, AFG1 and AFG2 are the most common types of aflatoxins with the greatest crop pollution, and AFB1 is particularly the most harmful, and can cause serious pathological changes such as liver cancer, kidney cancer and rectal cancer after being eaten by mistake, so that the international agency for research on cancer (IARC) classifies them as a carcinogen.

The hazards of Aspergillus flavus and AFT are ubiquitous worldwide, with up to 50 billion of people worldwide being compromised annually (Williams et al 2004), and in the United states, the total losses due to AFT contamination are up to 5 million dollars annually, with up to 2500 million dollars for peanut loss alone, and an additional cost in disease control of about 2000 to 5000 million dollars. In addition, aflatoxin damage is more serious in developing countries with underdeveloped economy, and it has been reported that in 2004-2005, over 125 people in kenya die from eating aflatoxin-contaminated food, and in china, over 370 more than ten thousand people die from liver cancer each year due to the superimposed damage of hepatitis b virus and aflatoxin, accounting for over 50% of the world deaths.

In view of the great harm of AFT, the highest standard for aflatoxins in food and feed is clearly defined by legislation in many countries. Taking peanuts and their processed products as examples, the U.S. Food and Drug Administration (FDA) stipulates that the maximum amount of AFT is 20 ppb; the European Union has a maximum limit of 4ppb for AFT and 2ppb for AFB 1; kenya of 10 ppb; malaysia is 15 ppb; in China, the maximum limit standard of the AFB1 by the D is 20ppb, but the maximum limit standard of the AFT is not available. In addition, in some poor areas such as Africa, the highest quantity of aflatoxin is not available, and the aflatoxin has important influence on local human health.

Strict food limit standards reduce the pollution and potential hazard of aflatoxin to a certain extent, but local people are unable to bear the high cost of long-time aflatoxin monitoring due to low grain yield, low economy, poor living conditions and poor living conditions in partial areas, thereby increasing the exposure risk of aflatoxin. Therefore, it is the key of research to reduce the generation and harm of toxin from the source.

At present, the control of aspergillus flavus and AFT in the storage period is mainly realized by physical drying, sorting of diseased particles, chemical agents and the like. However, the first two methods are expensive, harsh in implementation conditions, long in period and difficult to implement in ordinary families. The chemical synthetic medicament has the potential problems of pesticide residue, environmental pollution, long degradation period and the like, and the storage period is difficult to be directly applied to the grain seeds, thereby seriously restricting the wide application of the chemical synthetic medicament. Therefore, screening a safe and effective control method is a hot spot of current research. The natural active bacteriostat is extracted from the organisms naturally existing in the nature, has relative safety and better biological activity compared with a chemical synthesis preparation, and is a good means for preventing and controlling the aflatoxin and the toxin in the fields and the storage period. To date, various biological extracts have been reported, and successfully applied to the prevention and control of aspergillus flavus and toxin, plant essential oil extracted from boldo tree, verbenaceae plant and cumin genus has proved to have significant inhibition effect on the growth and toxin production of aspergillus flavus, and some biological extracts have been successfully applied and commercially produced. Compared with the prior art, the microbial preparation has the advantages of small individual, fast propagation, high metabolic yield and obvious advantages in screening natural antibacterial drugs and application, and various microorganisms and metabolites thereof have been reported to have important inhibition effects on aspergillus flavus and toxins so far, such as non-toxigenic aspergillus flavus, bacillus, pseudomonas and the like, and have important prevention and control effects on field aspergillus flavus. However, there are still few studies on the prevention and treatment of aflatoxins and toxins during storage. In order to obtain a high-activity biocontrol strain in a storage period, microbial resources are screened from the nature, gas production characteristics and bacteriostasis of the microbial resources are researched, and research on prevention and control of aflatoxin in the storage period is developed.

Disclosure of Invention

The invention aims to provide an Alcaligenes Faecalis (Alcaligenes Faecalis) N1-4, a metabolite thereof and application thereof. The N1-4 can effectively inhibit the infection of aspergillus flavus and the generation of toxin, has good broad-spectrum antibacterial action, can effectively inhibit the infection of aspergillus flavus and the generation of toxin by utilizing the volatile gas generated by the N1-4 on the beef extract peptone culture medium, can also effectively inhibit the growth of various pathogenic fungi, and has high-efficiency biocontrol effect.

Based on the purpose, the invention adopts the following technical scheme:

alcaligenes Faecalis (Alcaligenes Faecalis) N1-4 with the collection number of CCTCC M2019299 CCTCC M2019299.

The 16S rRNA sequence of the Alcaligenes faecalis is shown in the table SEQ ID NO: 1.

The alcaligenes faecalis is applied to control of aspergillus flavus and toxin of crops in a storage period.

The crop seeds are peanuts, corns, rice and soybeans.

The metabolite of the Alcaligenes faecalis comprises dimethyl disulfide and methyl isovalerate.

The method collects the rhizosphere soil of the tea trees from a Yunshan mountain crest tea garden in Xinyang city of Henan province for separating microorganisms. The microorganism is separated from the soil by a microbiological method, and the high-activity bacteriostatic microorganism strain is screened for the storage period prevention and control of the aspergillus flavus and the toxin. In the research, the Alcaligenes Faecalis with efficient inhibition effect on aspergillus flavus is separated and named as Alcaligenes Faecalis N1-4, and the strain is delivered to China Center for Type Culture Collection (CCTCC) of Wuhan, China for preservation in 26.04.2019, with the preservation number of CCTCC M2019299.

Mycological characteristics of Alcaligenes faecalis N1-4:

the Alcaligenes faecalis N1-4 is a gram-negative bacterium, can utilize D-glucose, D-fructose, sucrose, L-arabinose, D-mannose, methyl pyruvate, alanine, lactic acid, aspartic acid, citric acid and the like, cannot utilize cellulose, cannot hydrolyze starch, cannot produce hydrogen sulfide, and cannot produce spores.

The 16S rRNA sequence of the strain N1-4 is subjected to PCR amplification, purified and then sent to Shenzhen Hua Dagenecompany for sequencing, and the nucleotide sequence is shown as the sequence table SEQ ID NO: 1.

The inhibition effect of the strain N1-4 on the growth and germination of aspergillus flavus is detected, the volatile bacteriostatic metabolite generated by N1-4 is identified, and the prevention and treatment effects of N1-4 on the incidence of the aspergillus flavus of peanuts, corns, soybeans and rice and the inhibition effect of toxin generation are analyzed under the closed storage condition.

The alcaligenes faecalis N1-4 has a good bacteriostatic action, can inhibit the morbidity and the toxicity of aspergillus flavus of peanuts, corns, soybeans and rice under the condition of a closed storage environment, and can be extended and applied to disease prevention and control of other grain and oil crops and processed products thereof in the storage period and disease prevention and planting of greenhouse vegetables and the like. In addition, the Alcaligenes faecalis N1-4 has broad-spectrum bacteriostatic action on other different pathogenic fungi.

Compared with the prior art, the invention has the following beneficial effects:

(1) the separated alcaligenes faecalis N1-4 is soil bacteria, is a high-efficiency novel bacteriostatic microorganism separated from the rhizosphere soil of tea trees, and can be used as a biocontrol strain of fungal diseases in the storage period of crops;

(2) the invention proves that the separated alcaligenes faecalis N1-4 can produce volatile antibacterial substances for the first time, and can completely inhibit the growth of aspergillus flavus hyphae and the germination of spores in a closed environment;

(3) the separated alcaligenes faecalis N1-4 has a remarkable bacteriostatic effect, and can efficiently inhibit the incidence of aspergillus flavus on peanut and corn grains and the synthesis of toxins in a closed space;

(4) the obtained alcaligenes faecalis N1-4 can generate 2 high-activity volatile antibacterial substances, wherein the relative content of dimethyl disulfide is the highest and is 69.90%;

(5) the obtained alcaligenes faecalis N1-4 has a remarkable bacteriostatic effect on dimethyl disulfide, can completely inhibit the germination of aspergillus flavus spores at the concentration of 50 mug/L (substance weight/space volume), is 100 mug/L, inhibits the growth of hyphae, and has a remarkable bacteriostatic effect.

Description of the drawings:

preservation date of N1-4: 26/04/2019, depository: china Center for Type Culture Collection (CCTCC), preservation number: CCTCC M2019299.

FIG. 1 phylogenetic tree analysis of 16S rRNA of Alcaligenes faecalis N1-4 strain and its allied species;

FIG. 2 shows the inhibition effect of Alcaligenes faecalis N1-4 on the growth of Aspergillus flavus hyphae and spore germination;

FIG. 3 analysis of the inhibition of Alcaligenes faecalis N1-4 on Aspergillus flavus of peanuts, corns, soybeans and rice grains with different water activities; in FIG. 3, CK is an Aspergillus flavus control group, and the diagram marked with N1-4+ CK is a group treated by adding N1-4 strain, aw is water activity, and the disease condition is treated after the closed culture at 28 ℃ for 7 days;

FIG. 4 is a scanning electron microscope observation of Aspergillus flavus on peanut skin, CK represents the form of peanut kernel inoculated with Aspergillus flavus spores after 5 days of culture; CK + N1-4 represents morphology observation of Aspergillus flavus spores on the surface of peanuts in the presence of N1-4 volatile substances; in the figure, co represents conidia, cp represents conidia, my represents mycelia, and sg represents sterile spores.

FIG. 5 is an identification of volatile substances produced by Alcaligenes faecalis N1-4; the detection equipment is a solid phase microextraction and gas chromatography-mass spectrometer, the horizontal coordinate of the chromatogram is retention time, and the vertical coordinate is substance abundance.

FIG. 6 is the minimum inhibitory concentration analysis of dimethyl disulfide on Aspergillus flavus; the concentration is the volume of dimethyl disulfide/volume of closed culture space.

FIG. 7 shows the broad spectrum inhibitory effect of Alcaligenes faecalis N1-4 on the growth of 6 different fungi.

Detailed Description

The present invention is further illustrated by the following specific examples.

EXAMPLE 1 screening of candidate Strain N1-4

The invention collects soil from the rhizosphere of tea trees in Yunshan, Xinyang city, Henan province, and separates an alcaligenes faecalis strain with efficient bacteriostatic action on aspergillus flavus from the soil by a microbiological screening method. The candidate strain was numbered N1-4.

(1) Isolation of candidate Strain N1-4

Collecting soil rich in humus in the rhizosphere region of tea tree in 10 cm depth, suspending in sterile water, and diluting to 10% gradient^-5And 10^-6Each 100. mu.L of the diluted solution was applied to the surface of NA medium and cultured in the dark at 37 ℃ for 48 hours. The NA culture medium comprises the following formula: (beef extract 3.0g/L, peptone 10.0g/L, NaCl 5.0g/L, agar 15.0g/L, distilled water supplemented to 1L). )

And after culturing for 48 hours by using the NA culture medium, selecting single bacterial colonies with obvious morphological difference, performing purification culture, analyzing the inhibition effect of the single bacterial strains on the aspergillus flavus, and selecting the bacterial strains with better inhibition effect for storage for subsequent research.

(2) Morphological characterization of N1-4 Strain

The N1-4 strain is cultured on the NA culture surface, the bacterial colony is light yellow, transparent and gram-negative, the thallus is short-rod-shaped, and no spore is produced.

(3) Molecular biological identification of N1-4

Fresh N1-4 strain was inoculated into NB medium (beef extract 3.0g/L, peptone 10.0g/L, NaCl 5.0g/L, distilled water supplemented to 1L, pH to 7.2), cultured at 28 ℃ for 48h at 200 rpm. After centrifugation at 12000rpm for 10 minutes, the cells were collected and used for DNA extraction. Amplifying the 16S rRNA sequence of the strain N1-4 by adopting a PCR method and universal primers (27f and 1541r), purifying and recovering an amplified fragment by using the kit, sending the amplified fragment to Wuhantianyihuiyuan company for sequencing, and comparing and analyzing the sequencing sequence in a GenBank database to determine the classification status.

The length of the sequencing sequence is 1397bp, and the specific sequence is shown as SEQ ID No.: 1 is shown.

DNA sequence of sequencing primer: AGAGTTTGATCCTGGCTC f

1541r:AAGGAGGTGATCCAGCCGCA

In GenBank database, 16S rRNA sequences of N1-4 strain were BLAST-aligned, homologous strains were selected, and 12 homologous strains of Alcaligenes faecalis 13, M14, QU1, VO3, cb4, 47N3, 58C2, etc., Alcaligenes aquatilis BUN33, and Alcaligenes endophyllicus AER10, AER11, etc. were selected for phylogenetic tree analysis, and a phylogenetic tree was constructed using MEGA software Neighbor-join method.

(4) Physiological and biochemical identification of Strain N1-4

N1-4 was streaked on NA medium, and single colonies were picked for Biolog GEN III physiobiochemical analysis. Single colonies of N1-4 were transferred to an IF-AGEN III inoculum and adjusted to an OD600 of 0.97. After mixing, the suspension was transferred to GEN III Microplate plates, to which 120. mu.L of the inoculum was added per well. Culturing at 37 ℃ in the dark for 12 hours, detecting the light absorption value in BIOLOG Microstation TM, comparing a bacterial database, searching for a strain with high physiological and biochemical reaction homology, determining the classification status, and specifically, the experimental results are shown in Table 1.

TABLE 1 comparison of physiological and biochemical analyses and results for strain N1-4

The result shows that the 16S rRNA sequence ratio of N1-4 has the highest homology with Alcaligenes; phylogenetic tree analysis showed that among the 12 homologous strains selected, N1-4 and Alcaligenes faecalis cb-4(FJ588233.1) and Alcaligenes faecalis 47N3(KX302626.1) had the highest homology (FIG. 1), and they clustered in the same branch and were closest in genetic distance, so they were primarily identified as Alcaligenes faecalis.

Biochemical analysis further proves that the strain N1-4 and BIOLOG Microstation^TMFeces in the systemAlcaligenes strains have great similarity, with similarity higher than 80%. They all utilize more than 18 nutrients including methyl pyruvate, L-alanine, L-lactic acid and L-aspartic acid, among others. They can grow in the presence of 1-4% NaCl and tolerate 14 antibiotics such as lincomycin, vancomycin, rifamycin and the like, so they are identified as Alcaligenes faecalis.

In conclusion, based on the phylogenetic analysis, morphological and biochemical characteristics of 16S rRNA, the strain N1-4 was identified as Alcaligenes faecalis, which the applicant named N1-4. And the strain is delivered to China, Wuhan university China typical microbiological culture collection center (CCTCC) for preservation in 26.04.2019, and the preservation number is CCTCC M2019299.

Example 2 inhibition of Alcaligenes faecalis N1-4 on Aspergillus flavus

Experiment for inhibiting growth of aspergillus flavus hyphae by alcaligenes faecalis N1-4

The method comprises the following steps: the Af conidia were inoculated into the PDB solution and cultured at 200rpm at 28 ℃ for 48 hours to produce mycelium pellets. Fresh mycelial pellets were placed in the center of PDA medium. N1-4 cells (100. mu.L, 10)⁹cfu/mL) were plated on NA medium. Two culture dishes are placed in a buckled manner, the PDA culture medium inoculated with the mycelium pellets is arranged above, and the NA culture medium without bacteria is used as a control, and the PDA inoculated with the Af mycelium pellets cultured in the buckled manner is used as a control. All treatments were incubated for 3 days in the dark at 28 ℃. The hyphal diameter of each group was recorded and the inhibition rate was calculated.

The inhibition ratio (%) (control group hypha diameter-treatment group hypha diameter)/control group hypha diameter × 100.

Experiment for inhibiting aspergillus flavus spore germination by alcaligenes faecalis N1-4

The method comprises the following steps: 10 μ L of Aspergillus flavus conidia (100 μ L, 10%⁵cfu/mL) were injected onto round filter paper (5 mm diameter) and placed in the center of PDA medium. The N1-4 bacterial liquid is coated on the surface of an NA culture medium, the NA culture medium is buckled on a PDA culture medium, and Af conidia treated by N1-4 bacteria are not added as a control. Cultured at 28 ℃ for 3 days in the dark. The diameter of the spores that grew in each experiment was recorded and the inhibition rate was calculated.

The experimental results showed that the mycelium on the PDA medium was able to grow rapidly and expand to 5.2cm in diameter in the control treatment. Conidia on the surface of PDA also germinated to hyphae and rapidly expanded (fig. 2). When the treatment is carried out under non-contact conditions by adding N1-4, the germination of the Aspergillus flavus conidia and the growth of mycelium are inhibited after the volatile substances are generated and diffused into a closed system, and new mycelium is hardly formed in the treatment of N1-4 (figure 2). Compared with a control, the inhibition rate of N1-4 on the growth of mycelium and the germination of conidium is as high as 100 percent

Example 3 biological control of Aspergillus flavus and toxin contamination of peanut, corn, soybean and rice by Alcaligenes faecalis N1-4

Sample preparation:

1) weighing 100g of peanuts, corns and rice grains respectively, storing in 250mL triangular bottles, weighing 2 triangular bottles for each crop, sterilizing at 121 ℃ and 1.01MPa for 20min, standing at room temperature and cooling;

2) each flask was inoculated with 1ml of conidia (1X 10)⁵cfu/ml), mixed well and 2 flasks of each crop were filled with different volumes of sterile water, Aqualab Series 3 model TE (decapon Devices, Pullman), to adjust the water activity (aw) to 0.9 and 0.8.

3) Dividing peanuts, corns, soybeans and rice under each water activity into two parts, taking 1 part of each crop, symmetrically arranging, placing in a culture dish, carrying out buckling culture with an NA culture medium inoculated with N1-4 bacterial liquid, placing the other part of each crop in another culture dish, and carrying out buckling culture with a blank NA culture medium. Each test was performed twice, and all dishes were incubated at 28 ℃ in the dark for 7 days. And collecting crop seeds in each group, drying for 4 days at 60 ℃, fully grinding, and extracting and quantitatively analyzing aflatoxin.

Extracting aflatoxin: 1 gram of the ground sample was suspended in 5ml acetonitrile/water (84/16, v/v) and sonicated for 60 minutes. Centrifuging at 12000rpm for 10 minutes, transferring the supernatant into a new tube, adding n-hexane with the same volume, fully and uniformly mixing, standing and layering to obtain a lower layer for quantitative analysis of aflatoxin.

Quantitative analysis of aflatoxin: quantitative analysis of aflatoxins was performed by an LC-ESI-MS system comprising a Thermo Surveyorplus HPLC system coupled to a TSQ Quantum Ultra mass spectrometer (Thermo Scientific, CA, USA). Aflatoxin standards (AFB1, AFB2, AFG1 and AFG2) were purchased from Sigma (Sigma-Aldrich, st.louis, MO, USA) for standard curve plotting, and for quantitative analysis of mycotoxins.

Experimental results show that the volatile gas generated by N1-4 can inhibit infection hazards of aspergillus flavus in corn, peanut, soybean and rice grains (figure 3). In the control treatment without adding N1-4, the aspergillus flavus conidia can rapidly germinate to form hypha which is attached to the surface of the selected seed, and further generate a large amount of conidia, thereby causing the seed to be seriously ill. Meanwhile, in the control group, the crop seeds with water activity of 0.9 have disease degree obviously higher than that of the seeds with water activity of 0.8; and in the four crop seeds, the peanut seeds have the heaviest morbidity and are obviously higher than the other three seeds. The N1-4 addition group is adopted, under the non-contact culture condition, aspergillus flavus spores cannot normally germinate to form hyphae and cannot cause crop seed attack; no obvious onset symptoms were seen above the four grain and oil crop seeds at both water activities (fig. 3). The results show that the volatile substances generated by N1-4 can effectively inhibit the growth and the morbidity of aspergillus flavus and have better biological activity.

Further analyzing the content of aflatoxin in different grains, wherein the result shows that in a control group, aflatoxin is detected from various grains under two water activity conditions, and the higher the water activity is, the higher the toxin content is; under the condition of water activity of 0.9, the total toxin content in the peanut sample of the control group is 45.51 mug/g, wherein the AFB1 is 42.63 mug/g, which is higher than that of the other three seeds under the same treatment condition, and is far higher than that of the peanut seeds under the treatment condition of water activity of 0.8 (the total toxin content is 0.37 mug/g). After the N1-4 is added, the toxin content is consistent with the morbidity of the aspergillus flavus, the toxin content is obviously reduced, the aflatoxin is detected from all four crop seeds under the condition of two water activities, and the N1-4 shows that the generation of the aflatoxin can be effectively inhibited, and the aflatoxin has high-efficiency biological activity.

Example 4 microscopic Observation of the inhibition of Aspergillus flavus by Alcaligenes faecalis N1-4

In order to further detect the influence of volatile gas generated by N1-4 on the cell structure of aspergillus flavus, scanning electron microscope observation is carried out. Selecting peanut seeds inoculated with aspergillus flavus, fumigating and fixing the peanut seeds in 1% osmic acid for 1h, tearing off small square peanut seed coats, spraying gold on the surfaces after fixation, and observing the shape of the aspergillus flavus on the surfaces of the seed coats by a scanning electron microscope, wherein the scanning electron microscope is Hitachi corporation (model JSM-4800, Hitachi corporation, Japan).

Scanning electron microscope results show that in the control group, a large amount of aspergillus flavus mycelia and spores are covered on the surface of the peanut, the mycelia further germinate to form conidial heads, conidial peduncles are generated, a large amount of conidia are born, and secondary infection of peanut seeds is caused. In the group with N1-4, only a few spores were seen on the surface of the peanuts, the spores were original for inoculation, and no evidence of germination was seen on the spores, and a large number of spores were cracked and had a sunken surface condition, so that the peanut kernels could not be infected again (FIG. 4). In conclusion, volatile gaseous substances generated by N1-4 can effectively inhibit the germination of aspergillus flavus spores, prevent and control peanut aspergillus flavus diseases and have high-efficiency biological activity.

Example 5 Alcaligenes faecalis N1-4 volatile gas detection

Adding 20mLNA culture medium into a 150mL triangular flask, naturally cooling, coating the bacterial suspension of the bacterial strain N1-4 on the surface of the NA culture medium, taking the NA culture medium triangular flask without inoculating N1-4 as a control, sealing the bottle mouth with a double-layer plastic film, culturing for 24h at 37 ℃ in the dark, and generating a large amount of volatile substances above the culture medium for subsequent detection and analysis. After the culture, the flask was transferred to a 40 ℃ water bath, equilibrated for 30min, and the last volatile substance was adsorbed by a solid phase micro-extraction (SPME) device (30min), and subjected to GC-MS detection, with 2 repetitions of each treatment.

The sample extraction method comprises the following steps:

and (3) enriching volatile substances by SPME, inserting a metal probe of the SPME into the plastic film, pushing out the adsorption probe to enable the fiber head to be positioned at the middle position above the sample bottle, and adsorbing for 30 min. And withdrawing the adsorption probe into the metal probe, pulling out the sample bottle, and transferring the sample bottle into a gas chromatography-mass spectrometer (GC-MS) for sample injection detection, wherein the detection parameters are designed as follows.

GC-MS condition settings:

the temperature of a sample inlet is 250 ℃; the carrier gas is helium, and the column flow rate is 1 mL/min; the sample introduction mode is non-shunting sample introduction. The column oven adopts a programmed heating method: maintaining the initial temperature at 40 deg.C for 3 min; heating to 160 deg.C at a speed of 3 deg.C/min, and maintaining for 2 min; then the temperature is raised to 220 ℃ at the speed of 8 ℃/min and is kept for 3 min. Mass separation was performed using an Agilent HP-5MS fused-C18 capillary column ((30 m.times.0.25 mm ID,0.25 μm thick contacting film).

The ion source temperature is 230 ℃, the quadrupole rod temperature is 150 ℃, and the ionization mode is as follows: EI source with energy of 70eV, and detecting with full scan mode in the detection range of 50-550 amu. The test substance was automatically subjected to library search for National institutes of standards and Technology (NIST 11), and the test substance was characterized. Gas chromatography mass spectrometry coupled with detection (GC-MS).

After GC-MS detection, the gas substances detected in the NA medium control group are subtracted from the substances detected after the N1-4 culture, namely the volatile gas generated by N1-4. As can be seen from FIG. 5, N1-4 detected several volatile components in the experiment, and compared with the NA control group, the two components were unique to the N1-4 volatile substance, and identified as dimethyl disulfide (DMDS) and Methyl Isovalerate (MI) by NIST library search. The main volatile substance is dimethyl disulfide with the highest abundance and the relative abundance of 10% (peak area/sum of all peak areas).

Example 6 identification of the inhibitory Effect of N1-4 volatile Compound

In order to detect the bacteriostatic action of the active substance produced by N1-4, a standard product of dimethyl disulfide and methyl isovalerate is purchased from the market, and after being diluted in a gradient manner, the standard product is co-cultured with aspergillus flavus to detect the minimum bacteriostatic concentration of the aspergillus flavus. A5 mm diameter sterilized filter paper sheet was placed in the center of a 9cm PDA plate, and 10. mu.L of fresh spores of Aspergillus flavus (10. mu.L) were inoculated⁵cfu/mL) in additionA round filter paper plate was placed in a petri dish of the same size, and the filter paper plate was inoculated with standard compound dilutions of different concentrations after ethanol dilution to final concentrations of 5. mu.L/L, 10. mu.L/L, 100. mu.L/L and 200. mu.L/L (compound volume/culture space volume) with the same volume of ethanol as a control. Two culture dishes are placed on aspergillus flavus spores, face-to-face buckling culture is carried out, the culture is carried out for 4 days at 28 ℃ in the dark, each experiment is carried out twice, the hypha diameter is counted, and the inhibition rate is calculated. Inhibition rate calculation formula: the inhibition ratio (%) - (control mycelium diameter-treated mycelium diameter)/control mycelium diameter]X 100. Inoculating Aspergillus flavus mycelium blocks in the center of PDA by the same inoculation method, inoculating metabolite diluents with different concentrations in a blank culture dish, carrying out buckling co-culture on the Aspergillus flavus mycelium blocks and the metabolite diluents, and detecting the inhibition effect of volatile substances on the growth of the mycelium.

The results prove that the two volatile substances DMDS and MI have high-efficiency inhibition effect, and the growth of aspergillus flavus hyphae and spore germination are obviously inhibited (figure 6). Under the condition of low concentration (10 mu L/L), both DMDS and MI have certain inhibiting effect, the hypha diameter is obviously smaller than that of a control group, and the DMDS inhibiting effect is superior to that of MI. The inhibition effect of the two substances is obviously enhanced along with the increase of the concentration, when the concentration reaches 50 mu L/L, the DMDS can completely inhibit the germination of the aspergillus flavus spores, and when the concentration reaches 100 mu L/L, the hypha growth can be completely inhibited. MI substance at 200 μ L/L can completely inhibit hypha growth. In conclusion, the DMDS has a good inhibition effect on aspergillus flavus, the minimum inhibition concentrations of the DMDS on hypha growth and spore germination are respectively 100 mu L/L and 50 mu L/L, the minimum inhibition concentrations are superior to MI with the same concentration, and the abundance of the DMDS is remarkably higher than that of MI, so that the key volatile substance with the bacteriostatic action of N1-4 is DMDS.

Example 7 broad-spectrum bacteriostasis of Alcaligenes faecalis N1-4

In order to further analyze the inhibition effect of the volatile substances produced by the strain N1-4 on different pathogenic fungi, a broad-spectrum bacteriostasis experiment is carried out. In the research, a double-culture dish (diameter of 9cm) buckling culture method is adopted, six important plant pathogenic fungi are selected, and after activation, fresh hypha blocks are selected and inoculated to the center of a PDA culture plate; coating N1-4 bacterial solution (10) on the surface of NA culture plate⁸cfu/ml, 100. mu.l). The N1-4 culture plate is buckled and cultured on a PDA culture plate, the PDA culture plate is sealed by a transparent adhesive tape and is preserved, and the culture plate is cultured for 5 days under the dark condition at the temperature of 28 ℃. And (5) counting the hypha diameter and calculating the inhibition rate. The calculation formula of the bacteriostatic rate is as follows:

the bacteriostatic ratio (%) - (control hypha diameter-treated hypha diameter)/control hypha diameter x 100.

The six selected pathogenic fungi comprise Fusarium graminearum (Fusarium graminearum), Fusarium equiseti (F.equiseti), Alternaria alternata (Alternaria alternata), Botrytis cinerea (Botrytis cinerea), Aspergillus niger (Aspergillus niger) and Colletotrichum graminearum (Colletotrichum graminicola), and after 5 days of culture, the six fungi in the control group grow rapidly, the diameters of the hyphae exceed 3cm, and the maximum diameter reaches 9 cm; in the N1-4 added group, the growth of six kinds of fungi hyphae is obviously inhibited, the hyphae diameter is lower than 3cm, and part of the fungi hyphae do not grow, the calculated bacteriostasis rate has the best inhibition effect on aspergillus niger up to 97.8 percent and slightly weaker inhibition effect on fusarium graminearum up to 64.1 percent (figure 7). The results show that the volatile substance generated by N1-4 has high-efficiency bacteriostatic effect, can inhibit the growth of various fungi and has broad-spectrum inhibitory activity.

Data analysis all statistical analyses were performed using one-way anova using SPSS 17.0 software (SPSS inc., Chicago, IL). Each experiment was repeated at least twice and the mean was taken. Analysis of variance was performed using the multi-range test of Duncan, comparing significant differences between different treatments at P < 0.05.

Claims

1. Alcaligenes faecalis (Alcaligenes faecalis) N1-4 with the preservation number of CCTCC M2019299.

2. The Alcaligenes faecalis according to claim 1 wherein said Alcaligenes faecalis is isolated microbially from tea tree rhizosphere soil.

3. The alcaligenes faecalis of claim 1 wherein the nucleic acid sequence of the 16S rRNA of alcaligenes faecalis N1-4 is as set forth in table SEQ ID NO:1 is shown.

4. The use of the alcaligenes faecalis and metabolites thereof according to any one of claims 1 to 3 for controlling aflatoxin infection and toxin production of crop seeds during storage.

5. The use of claim 4, wherein the crop seed includes but is not limited to peanut, corn, soybean or rice grain and oil crops and their processed products, and greenhouse vegetables.

6. The use of claim 4, wherein under closed storage conditions, Alcaligenes faecalis N1-4 acts on the crop seed to produce volatile metabolites comprising dimethyl disulphide and methyl isovalerate.

7. The broad-spectrum bacteriostatic application of the Alcaligenes faecalis and the metabolite thereof disclosed by any one of claims 1 to 3 to other different pathogenic fungi.

8. The broad spectrum bacteriostatic application of claim 7, wherein the different pathogenic fungi include but are not limited to fusarium graminearum, fusarium equiseti, alternaria, botrytis cinerea, aspergillus niger and anthrax graminearum.