CN110859868B

CN110859868B - Idesia polycarpa extract for treating non-alcoholic fatty liver disease and preparation method and application thereof

Info

Publication number: CN110859868B
Application number: CN201911229098.7A
Authority: CN
Inventors: 唐琳; 黄磊; 李娜
Original assignee: Sichuan University
Current assignee: Sichuan University
Priority date: 2019-12-04
Filing date: 2019-12-04
Publication date: 2021-12-24
Anticipated expiration: 2039-12-04
Also published as: CN110859868A

Abstract

The invention discloses a idesia polycarpa extract for treating non-alcoholic fatty liver, which is an extract obtained by separating an ethyl acetate extraction phase of idesia polycarpa fruits through high-speed counter-current chromatography; the ethyl acetate extraction phase is an alcohol extract of idesia polycarpa fruit, is dried and then is dissolved by adding water, and is extracted by ethyl acetate to obtain an ethyl acetate part; the solvent system of the high-speed counter-current chromatography is composed of n-hexane, ethyl acetate, methanol and water; the upper layer after the solvent system is extracted is a mobile phase, and the lower layer is a stationary phase. The idesia polycarpa extract has a remarkable effect on relieving non-alcoholic fatty liver, can remarkably reduce Triglyceride (TG) in cells, can lower the gene level of metabolic pathways related to fat synthesis and inflammation, and can raise the gene level of metabolic pathways related to fat catabolism and the like, and has popularization and application values.

Description

Idesia polycarpa extract for treating non-alcoholic fatty liver disease and preparation method and application thereof

Technical Field

The invention belongs to the field of development and application of biological medicines, and particularly relates to a idesia polycarpa extract for treating non-alcoholic fatty liver, and a preparation method and application thereof.

Background

Non-alcoholic fatty liver disease (NAFLD) is a clinical pathological syndrome characterized by hepatocellular steatosis and lipid storage without a history of excessive alcohol consumption. The pathological changes of the liver disease show simple fatty liver, steatohepatitis, steatohepatic fibrosis and cirrhosis along with the progress of the disease course. The common causes of NAFLD include obesity, type II diabetes, hyperlipidemia, hypertension, etc. In recent years, with the improvement of living standard, the incidence rate of NAFLD is obviously increased and the NAFLD is younger. Although much research has been conducted on the pathogenic mechanism of NAFLD, the exact mechanism is still unclear. However, the drugs (rosiglitazone, obeticholic acid, metformin hydrochloride and statins) currently on the market for relieving NAFLD have poor effects and large side effects, so the food and drug administration (FAD) and the association of american liver disease research (AASLD) do not approve any specific drug for nonalcoholic fatty liver disease. Therefore, the development of new drugs and the verification of the metabolic pathways of the drugs are an important research direction for treating the non-alcoholic fatty liver disease in the future.

Maoyeshan tung seed (a Chinese herbal medicine)Idesia polycarpa Maxim, var, vestita Diels) is a deciduous tree of the genus jatropha of the family chaulmaceae, which is only 1 species worldwide, distributed in south and taiwan regions of the mountain river of the Qinling mountain, and is mainly distributed abroad in Japan, the Korean peninsula and the Russian far east. Researches show that the idesia polycarpa fruit is rich in phenolic glycoside components with broad-spectrum biological activity, and the components have anti-inflammatory and antibacterial activities and have potential development and application values in the fields of cosmetics, medicines and the like. However, since the components of the fruit of idesia polycarpa are complex and separation of the components is difficult, research on the action of the specific components is limited.

At present, no report about the non-alcoholic fatty liver disease treatment of idesia polycarpa is reported.

Disclosure of Invention

In order to solve the problems, the invention provides a idesia polycarpa extract for treating non-alcoholic fatty liver, which is an extract obtained by separating an ethyl acetate extraction phase of idesia polycarpa fruits through high-speed counter-current chromatography;

the ethyl acetate extraction phase is an ethyl acetate part obtained by drying an alcohol extract of idesia polycarpa fruits, adding water for dissolving, adding ethyl acetate for extraction, and removing a solvent from an upper layer of extraction liquid;

the solvent system of the high-speed counter-current chromatography is composed of n-hexane, ethyl acetate, methanol and water; the upper layer after the solvent system is extracted is a stationary phase, and the lower layer is a mobile phase.

Furthermore, the method is characterized in that the ethyl acetate extraction phase of the idesia polycarpa fruit is dissolved in a solvent with the volume ratio of 1:1, separating by high-speed counter-current chromatography, and collecting the obtained extracts in two time periods of 57.5-62.5 min and 77.5-82.5 min.

Further, the volume ratio of the n-hexane to the ethyl acetate to the methanol to the water is 3-4: 1-2: 1-1: 5.

Furthermore, the volume ratio of the n-hexane to the ethyl acetate to the methanol to the water is 4:1:1:5 or 3:2:1: 5.

Further, the chromatographic conditions of the high-speed countercurrent chromatography are that the rotating speed is 800rpm, the flow rate is 5mL/min, and the wavelength is 312 nm.

The invention also provides a preparation method of the ethyl acetate extract phase of the idesia polycarpa fruit, which comprises the following steps:

1) taking idesia polycarpa fruits, drying, crushing, sieving, adding n-hexane for degreasing to obtain degreased fruit residues;

2) and (2) adding ethanol into the degreased pomace obtained in the step 1), uniformly stirring, soaking for 5-8h, filtering, drying the filtrate, adding water to dissolve the dried substance, adding ethyl acetate for extraction, and taking the upper layer liquid to remove the solvent to obtain the composition.

Further, the drying in the step 1) is natural drying in the shade; the sieving is to sieve through a 60-mesh sieve; the mass-volume ratio of the idesia polycarpa fruit powder to n-hexane is 1-2 g: 10-30 ml, preferably 1g: 20 ml.

Further, the ethanol in the step 2) is 60% ethanol; the mass volume ratio of the degreased pomace to the 60% ethanol is 1g to 40 ml; the dipping temperature is 80 ℃, and the time is 5 hours; the mass volume ratio of the dry matter to water to ethyl acetate is 0.1-0.3 g: 100-300 ml: 100-300 ml, preferably 0.2 g: 200 ml: 200 ml.

The invention also provides a preparation method of the idesia polycarpa extract, which comprises the following steps:

a) the preparation of a high-speed counter-current chromatography solvent system: mixing n-hexane, ethyl acetate, methanol and water, extracting, rapidly separating the system into upper and lower layers of solution, and separating the upper and lower layers of solution;

b) taking the ethyl acetate extract phase of the idesia polycarpa fruit, adding the mixed solution of the upper layer and the lower layer in the step a) for dissolving, injecting the dissolved solution into a high-speed counter-current chromatograph, and respectively collecting the fractions in two time periods of 57.5-62.5 min and 77.5-82.5 min to obtain the idesia polycarpa fruit extract;

the chromatographic conditions of the high-speed counter-current chromatograph are as follows: taking the lower layer solution of the step a) as a mobile phase and the upper layer solution of the step a) as a stationary phase.

Further, the volume ratio of the n-hexane, the ethyl acetate, the methanol and the water in the step a) is 3-4: 1-2: 1-1: 5; preferably: 4:1:1:5 or 3:2:1: 5; the extraction is performed by shaking and standing for 5-10min, preferably 5 min.

Further, the mass-volume ratio of the ethyl acetate extraction phase in the step b) to the mixed solution of the upper layer and the lower layer is 10 mg: 20ml of the solution; the volume ratio of the upper layer solution to the lower layer solution in the upper and lower phase mixed solution is 1: 1; in the chromatographic condition, the rotating speed is 800rpm, the flow rate is 5mL/min, and the wavelength is 312 nm.

The invention also provides application of the idesia polycarpa and the extract thereof in preparing a medicament for treating non-alcoholic fatty liver, wherein the extract is the idesia polycarpa extract.

Further, the drug is a drug that reduces TG, AST, and/or ALT content.

The invention finally provides application of idesia polycarpa and an extract thereof in preparing a medicament for accelerating fat metabolism or resisting oxidation, wherein the extract is the idesia polycarpa extract.

Further, the drug is a drug that scavenges DPPH radicals and/or ABTS radicals.

Experiments prove that the idesia polycarpa extract has a remarkable effect of relieving a non-alcoholic fatty liver disease (NAFLD) cell model formed by OA-induced HepG 2. Compared with a model group, the intracellular Triglyceride (TG) is obviously reduced, the gene level of metabolic pathways related to fat synthesis and inflammation is reduced, and the gene level of metabolic pathways related to fat catabolism and the like is increased. Therefore, the extract has practical application value for treating the non-alcoholic fatty liver and can be developed and applied.

Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.

The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.

Drawings

FIG. 1 is a UPLC detection chart of pomace ethyl acetate extract phase with a detection wavelength of 312 nm.

FIG. 2 HSCCC separation chromatogram of pomace ethyl acetate extract phase under the condition of detection wavelength of 312 nm.

FIG. 3 UPLC detection of the pomace ethyl acetate extract phase fraction at a wavelength of 312nm (a: UPLC detection of fraction IE-B, B: UPLC detection of fraction IE-D).

FIG. 4 DPPH radical scavenging ability results.

FIG. 5 ABTS radical scavenging ability results.

FIG. 6 shows the results of measurement of total reducing power.

FIG. 7 effects of different concentrations of IE-D on cell proliferation activity of HepG2 in the normal and model groups.

FIG. 8 effects of different concentrations of IE-D on cell proliferation activity of HepG2 in the normal and model groups.

FIG. 9 results of oil red O staining (x 400) of NAFLD cell model after different concentrations of IE-D treatment.

FIG. 10 relative lipid content determination in cells after different concentrations of IE-D treatment.

FIG. 11 Effect of different concentrations of IE-D treatment on triglyceride levels in cells.

FIG. 12 Effect of different concentrations of IE-D treatment on AST content in cell culture broth.

FIG. 13 Effect of different concentrations of IE-D treatment on ALT content in cell culture broth.

FIG. 14 effect of different concentrations of IE-D on oxidative stress-related gene expression in OA-induced hepatocellular steatosis.

Detailed Description

Example 1 Ethyl acetate extract phase of idesia polycarpa fruit

(1) Placing the idesia polycarpa fruit in a cool and ventilated place, naturally drying in the shade, crushing, sieving with a 60-mesh sieve, taking 10 g of idesia polycarpa powder, adding 200ml of n-hexane, soaking and degreasing for 5h to obtain degreased fruit residues.

(2) Adding 60% ethanol into the defatted pomace according to a material-liquid ratio of 1:40 (W/V; ml/g), stirring uniformly, placing in a constant-temperature water bath, keeping the temperature at 80 ℃ for 5h, and filtering.

(3) And (3) after spin-drying the filtrate obtained in the step (2), dissolving the filtrate in 1000 times (v/w; ml/g) of water, adding 1000 times (v/w; ml/g) of ethyl acetate for extraction, and taking the upper layer of extract liquor to remove the solvent to obtain an ethyl acetate extract phase of the idesia polycarpa fruit.

Example 2 extract of idesia polycarpa for the treatment of non-alcoholic fatty liver disease

a) Mixing n-hexane, ethyl acetate, methanol and water according to a volume ratio of 4:1:1:5, placing the mixture in a 2000mL separating funnel, shaking the mixture, standing the mixture for 5min at room temperature, and separating an upper layer solution and a lower layer solution;

b) 10mg of the ethyl acetate extract phase prepared in example 1 were taken and added to the mixture in the volume ratio of 1:1, dissolving 20ml of mixed solution consisting of the upper layer solution and the lower layer solution, injecting the dissolved solution into a high-speed counter-current chromatograph, and collecting fraction IE-B in a period of 57.5-62.5 min and fraction IE-D in a period of 77.5-82.5 min to obtain;

the mobile phase of the high-speed countercurrent chromatograph is the lower solution in the step a), and the stationary phase is the upper solution in the step a); HSCCC separation procedure:

firstly pumping a stationary phase, after the stationary phase is full, starting an ultraviolet detector to preheat, setting the rotating speed of a host computer to 800rpm, starting pumping a mobile phase when the rotating speed is increased to 800rpm, setting the flow rate to be 5mL/min at the moment, switching a sample injection six-way valve to Load when the mobile phase and the stationary phase realize dynamic balance, pumping a sample into HSCCC separation equipment, switching the Load to inject, detecting at 312nm, and finally collecting fractions of IE-B and IE-D sections.

The advantageous effects of the present invention are described below by way of test examples.

Test example 1 analysis of the Components of the Ethyl acetate extract phase of the fruit of idesia polycarpa

0.5 mg of the ethyl acetate extract phase prepared in example 1 was dissolved in 1 mL of acetonitrile, centrifuged at 12000 rpm for 5min and filtered through a 0.22 μm Polytetrafluoroethylene (PTFE) filter. The ethyl acetate extract phase was analyzed using UPLC, a Waters acquisition System H-CLASS equipped with a PDA detector, autosampler, online degasser, column oven, etc. The conditions of the ultra-high phase liquid chromatography are as follows: the column was Acquity UPLC HSS T3 (2.1 × 100 mm, 1.8 μm); the temperature of the column incubator is set to 40 ℃; the flow rate is 0.5 mL/min; the sample injection volume is 1.0 mu L; the detection wavelength was set to 312 nm; the mobile phase A was acetonitrile, B was an aqueous buffer salt (containing 0.1% formic acid and 25 mM ammonium formate), and the mobile phase was set up as a gradient with a flow rate of 0.5 mL/min. The mobile phase gradient was set as: 0-0.5 min, 10% A; 0.5-1 min, 10-25% A; 1-1.75 min, 25-30% A; 1.75-3.5 min, 30-45% A; 45-45% of A for 3.5-4 min; 4-4.01 min, 45% -10% A; 4.01-6 min, 10%.

The composition of the compounds in the ethyl acetate extract phase of the idesia polycarpa fruit prepared in example 1 was analyzed by UPLC assay using the above method, as seen from the liquid chromatogram (fig. 1): the total amount of the pomace ethyl acetate extraction phase is about 30 components, wherein 7 components are main components and account for about 70% of the total amount;

the chromatogram obtained by separating the ethyl acetate extract phase of the idesia polycarpa fruit by the high-speed counter-current chromatography separation system of example 2 is shown in figure 2, fractions in the time period of 57.5-62.5 min, namely IE-B, and fractions in the time period of 77.5-82.5 min, namely IE-D, are collected, and the solutions in the two time periods are respectively analyzed according to the above ultra-high-phase liquid chromatography analysis conditions to obtain a UPLC detection chart (figure 3), and as can be seen from figure 3, the components of the solutions in the 2 time periods are similar, wherein the components in the IE-D period are fewer than those in the IE-B period, and the content of single components is higher.

Test example 2 determination of Total phenols and Total Flavonoids in an extract from the fruit of idesia polycarpa

1 Experimental materials and instruments

1.1 Experimental materials: ethanol, n-hexane, ethyl acetate, vitamin C (Vc), a Folin phenol reagent, gallic acid, potassium ferricyanide, trichloroacetic acid, ferric trichloride and the like are practically all analytically pure (purchased from a Toxoridae reagent chemical plant) rutin standard (Sigma)

1.2 Experimental instruments: multifunctional enzyme mark instrument, rotary evaporator and electronic precision analysis balance

2 method of experiment

2.1 Total phenol content determination

The method for measuring the total phenol content adopts a Folin phenol method. Mixing 10 μ L of sample (0.2 mg/mL) or control gallic acid (0.015625-0.5 mg/mL) with 100 μ L of Folin phenol reagent, adding 90 μ L of 10% sodium carbonate solution after 5min, mixing, and standing at room temperature (25 deg.C) for 40 min. Measuring the absorption value at 765 nm with enzyme-labeling instrument, using gallic acid as reference, and solving total phenol content in the extract by linear equation method to obtain Gallic Acid Equivalent (GAE), i.e. mg GAE/mg extract.

2.2 measurement of Total Flavonoids content

Mixing 20 μ L of sample (1 mg/mL) or control rutin (0.0078125-0.25 mg/mL) with 30 μ L of 5% sodium nitrite, adding 50 μ L of 10% aluminum chloride solution after 6min, adding 100 μ L of 10% sodium hydroxide solution after 5min, mixing, standing at room temperature for 15min, and measuring the absorption value at 510 nm with microplate reader. Rutin is used as a reference substance, the content of total flavone in the extract is solved by using a linear equation method, and the result is expressed as rutin equivalent (RT), namely mg RT/mg extract.

2.3 test samples

CE (60% ethanol extract): example 1 filtrate obtained in step (2); EAE (ethyl acetate extract): example 1 ethyl acetate extract phase of idesia polycarpa fruit prepared in step (3); IE-B (fragment B in ethyl acetate extract): fractions collected from IE-B fractions prepared according to the procedure of example 2; IE-D (D fragment in ethyl acetate extract): fractions from IE-D fractions collected, prepared according to the preparation method of example 2.

3. Statistical analysis

Experimental data analysis of variance by Excel2010

4. Results of the experiment

The results are shown in Table 1:

TABLE 1 Total phenol and Total flavone contents of each component of idesia polycarpa fruit extract

Note: GAE, gallic acid equivalent; RT, rutin equivalent weight; a results are expressed as mean ± standard deviation (n = 3); b results are expressed as mean ± standard deviation (n = 3).

As can be seen from table 1, the linear equations obtained by the forsythol method for measuring the total phenol content of each component of the idesia polycarpa fruit extract at a concentration of 0.00313-0.4mg/mL using gallic acid as a control were y =3.381x +0.038 and R2=0.999, which showed good linear relationships. Using this equation, the polyphenol content of each fraction was determined (Table 1). Experimental results show that both IE-D and EAE contain higher content of phenolic components. The total flavone content is determined by taking rutin as a reference substance, and in the concentration range of 0.0375-1.2mg/mL, linear equations of y =0.419x + 0.002 and R2=0.999 are obtained, and the linear relation is good. Experimental results show that IE-D and CE both contain higher flavone content.

Test example 3 Ex-situ antioxidant experiment screening of idesia polycarpa fruit extract of the present invention

1 Experimental materials and instruments

1.1 Experimental materials: ethanol, petroleum ether, ethyl acetate, n-butanol, dimethyl sulfoxide (DMSO), vitamin C (Vc), 2, 6-di-tert-butyl-4-methylphenol (BHT), 1-diphenyl-2-trinitrophenylhydrazine (DPPH), 2, 2-dinitro-bis (3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt (ABTS), potassium ferricyanide, trichloroacetic acid, ferric trichloride and the like are practically pure and purchased from a Duke's reagent chemical plant;

1.2 Experimental instruments: a visible ultraviolet spectrophotometer (general analytical instruments, Beijing, Tu-1901;) rotary evaporator (Shanghai Yangrong Biochemical instruments, RE-52 AA;) -electronic precision analytical balance;

2 method of experiment

2.1 DPPH radical scavenging ability

Preparing 1mM DPPH mother liquor, using 70% ethanol as solvent, diluting 10 times with pure ethanol before use to obtain DPPH free radical working solution. 2 mL of samples (1-32. mu.g/mL) of different concentrations were mixed with 2 mL of DPPH working solution (0.1 mM) and reacted at room temperature for 30 min. The absorbance at 517 nm was measured with an ultraviolet spectrophotometer. The radical scavenging ability was calculated using the following formula:

DPPH radical scavenging ratio (%) = [1- (Ai-As)/Ac ]. times.100

Wherein Ac represents blank absorption value, Ai represents experimental group absorption value, As represents sample background absorption, and Vc is used As positive control. IC50 is the concentration of sample required at 50% clearance. IC50 was solved using the probit linear equation using SPSS software.

2.2 ABTS radical scavenging ability

ABTS free radicals are generated by reaction at a final concentration of 7 mM ABTS and 2.45 mM potassium persulfate in the dark for 12-16 h (solvent PBS (pH 7.4, 0.2M)). Before use, the solution is diluted with PBS to have an absorbance at 734 nm of 0.7 + -0.02 for use. mu.L of samples (0.25-8. mu.g/mL) of different concentrations were mixed with 100. mu.L of diluted ABTS free radical solution and reacted at room temperature for 3 min. The absorbance at 734 nm is measured by a microplate reader, and the ABTS free radical scavenging capacity calculation method is the same as the DPPH free radical scavenging capacity measurement method. Vc was used as a positive control.

2.3 Total reducing force measurement

1 mL of samples (1-128. mu.g/mL) at different concentrations were mixed with 2 mL of PBS (pH 6.6, 0.2M), 1 mL of potassium thiocyanate, incubated at 50 ℃ for 30 min, 2 mL of 10% trichloroacetic acid was added, and mixed well. 2 mL of the solution was taken out, and 2 mL of distilled water and 1 mL of 0.1% ferric chloride were added. The absorbance at 700 nm was measured with a UV spectrophotometer. The larger the absorption value, the stronger the reducing power. Vc and BHT as positive controls.

2.4 test samples

The same as the term "2.3" in test example 2

3. Statistical analysis

SPSS (20.0) and GraphPad Prism software were used for data analysis. In vitro antioxidant experiments were performed in at least three replicates and the results were expressed as Mean ± standard deviation (Mean ± SD) and the differential analysis was performed using the t-test. Animal experimental results are expressed as Mean ± standard error (Mean ± SEM), and the analysis of differences was performed using one-way analysis of variance (ANOVA) with Dunnett's t multiple tests. P <0.001, P <0.01, and P <0.05 were considered to have significant differences.

4. Results of the experiment

4.1 DPPH radical scavenging ability results (FIG. 4)

4.2 ABTS radical scavenging ability results (FIG. 5)

4.3 Total reducing force measurement results (FIG. 6)

As can be seen from FIG. 4, the ability of each fraction to scavenge DPPH free radicals shows a dose-dependent effect in the concentration range of 5-150 ug/mL. The graph shows that IE-D, CE shows stronger antioxidant capacity, wherein IE-D is close to the value of Vc of a positive control at about 120 ug/mL. As can be seen from FIG. 5, each fraction has strong ability to scavenge ABTS free radicals, and the maximum value of Vc, which is a positive control, is reached at a low concentration of 20ug/mL of IE-B, IE-D, indicating that IE-B, IE-D is an effective ABTS free radical scavenger. As can be seen from FIG. 6, the total reducing power of each part is higher and shows a dose-dependent effect in the concentration range of 5-100ug/mL, wherein IE-D, EAE shows higher reducing power, especially IE-D, which is equivalent to the positive control BHT, and IE-B, IE-D is selected as the optimal drug component for the non-alcoholic fatty liver model, and the next experiment is carried out.

Test example 4 treatment of HepG2 cell non-alcoholic fatty liver disease with the extract of idesia polycarpa fruit

1 Experimental materials and apparatus

1.1 test cells: HepG2(HB-8065, VA, USA), purchased from ATCC.

1.2 Experimental materials: triglyceride (TG) assay kit, alanine Aminotransferase (ALT) kit, aspartate Aminotransferase (AST) kit, oleic acid (Sigma), rosiglitazone (Sigma) high-sugar DMEM (Gibco), fetal bovine serum, bovine serum albumin, PBS buffer (Gibco)

1.3 Experimental instruments: centrifuge, microplate reader, CO₂Constant temperature incubator

2 establishment of cell model

Liver cancer HepG2 cells in DMEM high-sugar medium containing 10% fetal bovine serum and 5% CO₂And culturing at 37 deg.C, digesting with trypsin when the cell number reaches about 80%, and passaging.

Dividing the cells into a model group and a normal group, when the cell fusion reaches 70-80%, replacing the normal group with fresh DMEM culture solution, replacing the model group with a DMEM culture medium containing 1% BSA and 1mM oleic acid for induction culture for 24h, qualitatively observing intracellular lipid droplets by oil red O staining and electron microscopy, and simultaneously detecting intracellular triglyceride. As a result, lipid droplets were formed in the HepG2 cell in large amounts and the triglyceride was significantly increased.

3 screening the drug concentration according to the cell viability

HepG2 cells were seeded at 1.0X 104/well in 96-well plates at 100. mu.l per well. 1mM OA (oleic acid)

After 24h of induction, IE-B, IE-D prepared as in example 2 was added, and blank control groups (0. mu.g/mL) were set up at concentrations of 10, 20, 40, 60, 80, 100, 150, 200ug/mL, each group having 5 duplicate wells, and blank wells were set to zero. The final concentration of DMSO was < 1% in each experimental group. After 24h incubation under the above conditions, 10% CCK was added to each well, and incubation continued in the incubator for 40 min. The supernatant was discarded, the mixture was shaken in a micro-shaker for 10 minutes, and the absorbance (OD) of each well was measured at 450nm in a microplate reader. Cell viability (%) = OD value of experimental group/OD value of control group × 100%, and the concentration at which cell viability was 90% was selected as the working concentration of drug IE-D.

4 grouping of experiments and corresponding index determination

4.1 Normal HepG2 cells were normal group, and 1mM oleic acid was added to culture for 24 hours to obtain model group; model group + adding IE-D drugs with different concentrations to be drug adding groups (10, 40, 60, 80, 100 ug/mL); model group +10uM rosiglitazone was a positive control.

4.2 measurement of cellular triglyceride content and lipid deposition

Determination of triglyceride content in cells: and collecting cell precipitates of each group after each group of cells are treated, and measuring the content of triglyceride in each group of cells by using a triglyceride measuring kit after the cells are cracked. The reaction of lipid precipitation is a method depending on oil red 0 staining, and the specific operation is as follows: after each group of cells was treated, the cells were washed three times with precooled PBS, fixed with 5% fixative at 37 ℃ for 15min, then stained with 1% oil red O for 50min, and then the lipid content in each group of cells was observed with a fluorescence inverted microscope (400X). After observation, 200. mu.L of 60% isopropanol is added into each well for lysis, and the absorbance value is measured at 490nm, and the magnitude of the absorbance value quantitatively reflects the deposition amount of lipid in cells.

4.3 determination of Biochemical indicators in cell culture

After various treatments of cells, cell culture solution is collected, centrifuged for 5min at 3000rpm, supernatant is collected, and the contents of alanine Aminotransferase (ALT) and aspartate Aminotransferase (AST) in the cell culture solution of each experimental group are measured by using an alanine aminotransferase assay kit and an aspartate aminotransferase assay kit.

5 RT-PCR detection of related mRNA expression in cells

5.1 extraction of Total RNA from cells: trizol extracts total RNA from cells. The operation is carried out according to the instruction. The A260/A280 value of RNA was measured by an ultraviolet spectrophotometer to determine the purity of RNA.

5.2 cDNA Synthesis: the reverse transcription reaction system is 20uL, wherein the volume of the reverse transcription reaction system is 5 XPrimescript Buffer 4 mu l; PrimeScript RT Enzyme MixI 1. mu.l; random 6 mers 1 μ l; oligo Dt Primer 1. mu.l; cellular total RNA13 uL. After being mixed evenly, the mixture is put into a PCR instrument again to react for 15min at 37 ℃, and then reacted for 5s at 85 ℃ and stored at-20 ℃ for standby.

5.3 RT-PCR primer design: the design of each primer was performed based on the cDNA sequence in GenBank database, and each primer was as follows:

Nrf2-F(5’-3’): GCTCAACTTGCATTAATTCGGG

Nrf2-R(5’-3’):TCAGTAGGTGAAGGCTTTTCTC

NQ1-F:ATGGTCGGCAGAAGAGC

NQ1-R:GGAAATGATGGGATTGAAGT

HO1-F:TCTTCACCTTCCCCAACATTG

HO1-R:CTCTGGTCCTTGGTGTCATG

GSTA2-F:TGAGGAACAAGATGCCAAGC

GSTA2-R:CAGAGGGAAGCTGGAAATAAGG

PPARα-F:TGGTAGCGTATATGGAAATGGG

PPARα-R:CTACGTTTAGAAGGCCAGGAC

CPT1-F:TCATCTCCTACTGTCCCACG

CPT1-R:AGCTCCCACTGCCATAAATAC

SCD-F:CCCTACGGCTCTTTCTGATC

SCD-R:GTACTCCCCTTCTCTTTGACAG

NF-KB-F:CGAGCTTGTAGGAAAGGACTG

NF-KB-R:CACAGCATTCAGGTCGTAGTC

IL-6-F:GTACATCCTCGACGGCATC

IL-6-R:ACCTCAAACTCCAAAAGACCAG

6 data statistical analysis and description of data Using SPSS.19.0 software and Graphpad Prism5, comparison Using one-way analysis of variance

7 results of the experiment

7.1 results of cytotoxicity experiments (FIGS. 7 and 8)

FIGS. 7 and 8 show the cell viability after IE-B, IE-D (10, 40, 60, 80, 100, 150, 200 and 400 ug/mL) treatment alone for 24h and HepG2 cell treatment with 1mMOA for 24h, respectively, and it can be seen from the figure that after IE-B, IE-D with different concentrations alone for 24h, the cell viability is about 100% and has no toxicity to the cells, but after IE-B, IE-D treatment for 24h after the non-alcoholic fatty liver model group cells are formed after 24h treatment with 1mMOA, the cell viability of IE-B is reduced to below 80% at a low concentration of about 100ug/mL, which indicates that the component has great damage to the cells and strong toxicity. The cell activity of IE-D in the concentration range is still about 100 percent, which shows that the component is basically non-toxic to cells and can be used as an effective component for the next experiment.

7.2 results of measurement of lipid deposition in cells and triglyceride content (FIGS. 9, 10, and 11)

Fig. 9 is an electron microscope image (400 ×) of oil red O staining, from which it can be seen that the 1mM OA model group has significantly more fat droplets than the normal group and the medicated group, and the fat accumulation of the medicated group is significantly reduced relative to the model group, but the comparison between the medicated groups is not easily shown by the electron microscope image, so the oil red O staining is used to determine the lipid content in each group of cells.

After observation, 60% isopropanol is used for cracking stained cells, the light absorption value is measured at 492nm, the height of the light absorption value reflects the accumulation of lipid, the result of the content of oil red O is cracked in a graph 10, the staining condition of the oil red O is quantitatively reflected to a certain degree, IE-D obviously reduces the accumulation of lipid in the cells (P is less than 0.01), and the IE-D has obvious reducing effect on the accumulation of fat in non-alcoholic fatty liver. As can be seen from FIG. 11, the TG content in the model group was significantly higher than that in the normal group and the drug-added group, and the TG content in 10. mu.M rosiglitazone as a positive control drug was significantly reduced compared to that in the model group. Compared with the model group, the TG content of the drug adding group is obviously reduced (P is less than 0.01) and shows a dose-dependent effect, which shows that IE-D can effectively reduce the synthesis of intracellular lipid.

7.3 measurement results of AST and ALT biochemical indicators of cell culture supernatant (FIGS. 12 and 13)

AST and ALT are indexes reflected by liver injury, and as can be seen from fig. 12 and 13, the content of AST and ALT in the model group (1 mMOA) is obviously higher than that in the normal group (P <0.01) and the dosing group (P <0.05 and P <0.01), which indicates that IE-D obviously reduces liver injury and relieves non-alcoholic fatty liver to a certain extent.

7.4 RT-PCR results for related mRNA expression in cells (FIG. 14)

From FIG. 14, IE-D clearly induces Nrf-2 mediated oxidative stress pathways, HO-1 (hemoglobin oxygenase 1) and NQO-1 (quinone oxidoreductase), whose gene mRNA levels mainly acting in antioxidant and anti-inflammatory pathways were significantly up-regulated relative to the model group and showed dose-dependent effects. It has been shown that multiple signal pathways disrupted in obese and non-alcoholic fatty liver patients are regulated by receptor-activated lipid peroxide receptors (PPARS), and we found that IE-D significantly activates the expression of PPAR-alpha mRNA, thus activating CPT-1, a key gene for mitochondrial beta oxidation, accelerating fat metabolism, and thus alleviating fat accumulation in the liver, and that SCD is a key gene for fatty acid synthesis, especially oleic acid, and we can see that the expression of SCD mRNA in the model group is significantly higher than that in the drug group. Based on the above results, we also found that IE-D relieves non-alcoholic fatty liver disease and also passes through an inflammatory metabolic pathway, and mRNA levels of NF-KB and IL-6 are obviously reduced relative to the model group.

In summary, IE-D regulates OA-induced nonalcoholic fatty liver disease by down-regulating genes related to fat synthesis and up-regulating genes related to the lipolytic pathway, and by oxidative stress and anti-inflammatory pathways.

Claims

1. The idesia polycarpa extract for treating the non-alcoholic fatty liver is characterized in that: the method is characterized in that the ethyl acetate extraction phase of idesia polycarpa fruit is dissolved in a solvent with the volume ratio of 1:1, separating by high-speed counter-current chromatography in a mixed solution consisting of a mobile phase and a fixed phase of the high-speed counter-current chromatography, and collecting the obtained extract within a time period of 77.5-82.5 min;

the solvent system of the high-speed counter-current chromatography is composed of n-hexane, ethyl acetate, methanol and water in a volume ratio of 4:1:1: 5; the upper layer liquid after the solvent system is extracted is a stationary phase, and the lower layer liquid is a mobile phase.

2. The idesia polycarpa extract as claimed in claim 1, wherein: the chromatographic conditions of the high-speed countercurrent chromatography are that the rotating speed is 800rpm, the flow rate is 5mL/min, and the wavelength is 312 nm.

3. The idesia polycarpa extract as claimed in claim 1, wherein the preparation method of the ethyl acetate extract phase of the idesia polycarpa fruit comprises the following steps:

2) and (2) adding ethanol into the degreased pomace obtained in the step 1), uniformly stirring, soaking for 5-8h, filtering, drying the filtrate, dissolving the dried substance in water, adding ethyl acetate for extraction, and taking the upper-layer extract to remove the solvent to obtain the composition.

4. The idesia polycarpa extract as claimed in claim 3, wherein: step 1), the drying is natural shade drying; the sieving is to sieve through a 60-mesh sieve; the mass-volume ratio of the idesia polycarpa fruit powder to n-hexane is 1-2 g: 10 to 30 ml.

5. The idesia polycarpa extract as claimed in claim 4, wherein: the mass volume ratio of the idesia polycarpa fruit powder to n-hexane is 1g: 20 ml.

6. The idesia polycarpa extract as claimed in claim 3, wherein: step 2), the ethanol is 60% ethanol; the mass volume ratio of the degreased pomace to the 60% ethanol is 1g to 40 ml; the dipping temperature is 80 ℃, and the time is 5 hours; the mass volume ratio of the dry matter to water to ethyl acetate is 0.1-0.3 g: 100-300 ml: 100 to 300 ml.

7. The idesia polycarpa extract as claimed in claim 6, wherein: the mass volume ratio of the dry matter, water and ethyl acetate is 0.2 g: 200 ml: 200 ml.

8. A method for preparing the idesia polycarpa extract as claimed in claim 1, wherein the method comprises the steps of: it comprises the following steps:

a) mixing n-hexane, ethyl acetate, methanol and water, extracting, and separating upper and lower layer solutions; the volume ratio of the n-hexane to the ethyl acetate to the methanol to the water is 4:1:1: 5;

b) taking the ethyl acetate extract phase prepared by any one of claims 3-7, adding the mixed solution of the upper layer and the lower layer in the step a) for dissolving, injecting the dissolved solution into a high-speed counter-current chromatograph, and collecting the fraction in a period of 77.5-82.5 min to obtain the ethyl acetate extract phase;

9. The method of claim 8, wherein: the extraction in the step a) is performed by shaking and then standing for 5-10 min;

and/or the mass volume ratio of the ethyl acetate extraction phase in the step b) to the mixed solution of the upper layer and the lower layer is 10 mg: 20ml of the solution; the volume ratio of the upper layer solution to the lower layer solution in the upper and lower layer mixed solution is 1: 1; in the chromatographic condition, the rotating speed is 800rpm, the flow rate is 5mL/min, and the wavelength is 312 nm.

10. The method of claim 9, wherein: the extraction in the step a) is performed by shaking and then standing for 5 min.

11. Use of an extract of idesia polycarpa for the manufacture of a medicament for the treatment of non-alcoholic fatty liver disease, wherein the extract is the extract of idesia polycarpa according to claim 1 or 2; the drug is a drug that reduces the content of TG, AST and/or ALT.

12. Use of an idesia polycarpa extract for the manufacture of a medicament for accelerating fat metabolism or for oxidation resistance, wherein the extract is the idesia polycarpa extract of claim 1 or 2; the drug is a drug that scavenges DPPH free radicals and/or ABTS free radicals.