CN110853700A - Application of microRNA (ribonucleic acid) induced open type DNA (deoxyribonucleic acid) fluorescence nano robot in tumor and construction method thereof - Google Patents
Application of microRNA (ribonucleic acid) induced open type DNA (deoxyribonucleic acid) fluorescence nano robot in tumor and construction method thereof Download PDFInfo
- Publication number
- CN110853700A CN110853700A CN201911059920.XA CN201911059920A CN110853700A CN 110853700 A CN110853700 A CN 110853700A CN 201911059920 A CN201911059920 A CN 201911059920A CN 110853700 A CN110853700 A CN 110853700A
- Authority
- CN
- China
- Prior art keywords
- robot
- dna
- nano
- microrna
- fluorescence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B5/00—ICT specially adapted for modelling or simulations in systems biology, e.g. gene-regulatory networks, protein interaction networks or metabolic networks
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B45/00—ICT specially adapted for bioinformatics-related data visualisation, e.g. displaying of maps or networks
Landscapes
- Physics & Mathematics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Bioinformatics & Computational Biology (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Evolutionary Biology (AREA)
- General Health & Medical Sciences (AREA)
- Medical Informatics (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Theoretical Computer Science (AREA)
- Molecular Biology (AREA)
- Physiology (AREA)
- Data Mining & Analysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention belongs to the technical field of genetic engineering, and discloses an application of a tumor marker microRNA induced open type DNA nano-robot in tumor cells and a construction method thereof. The tumor marker microRNA is used for inducing and starting the nano-robot, the construction mode is not reported, a new thought is provided for the rational design of the functionalized DNA nano-robot, and a new tool is provided for the fluorescence imaging technology; the multifunctional nano robot is used for imaging and inhibiting tumor cells and is novel.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a construction method of a microRNA (ribonucleic acid) induced open type DNA (deoxyribonucleic acid) fluorescence nano robot and application of the microRNA induced open type DNA fluorescence nano robot in tumor cell diagnosis and treatment integration.
Background
Currently, the current state of the art commonly used in the industry is such that:
in the fifties of the 19 th century, j.d.watson and f.h.c.crick disclose a double helix structural model of DNA in Nature and suggest that DNA is a genetic template for life-carrying. In 1983, Seeman constructed nucleic acid nanostructures for the first time by using DNA, which indicated that DNA not only carries important genetic information of life, but also can be used as an element for constructing nanomaterials, so that a new science, DNA nanotechnology, was developed (Seeman, 2010). DNA nano-robots are one of the most rapidly developing directions, and refer to a nano-device (fan spring sea and liu winter, 2011) that utilizes the precise complementary pairing function of DNA, controllably changes the conformation of DNA by changing the base sequence under the drive of a specific form of energy, and performs a certain mechanical motion to realize energy transfer. It is known that DNA contains A, T, C, G four base types, which endows DNA nano robot structure diversity; meanwhile, the DNA base sequence is variable and flexible in design, so that the design has programmability; and the specific base complementary pairing principle of the DNA ensures that the DNA has high motion controllability. The DNA nano robot can capture, store and release target molecules like a real switch, and realizes the function of a 'machine'. At present, DNA nano robots with different structures are constructed successively and play an important role in many fields, such as drug transportation (Bhatia et al, 2011; Douglas et al, 2012; Lee et al, 2012; Amir et al, 2014; Chen et al, 2017; Li et al, 2018), biological imaging (Bhatia et al, 2011; Modi et al, 2013; Jungmann et al, 2014; You et al, 2017) and biological sensing (Torelli et al, 2014, 2018; et al, 2018), and the like, so that the DNA nano robots have a very wide application prospect.
The technical scheme at present is as follows:
at present, the method for constructing the nano robot is mainly to design a plurality of linear DNA sequences and combine the DNA sequences into the DNA nano robot in a self-assembly mode by utilizing the base complementary principle. If the nano robot needs to be characterized, traced or imaged, the DNA framework of the nano robot needs to be marked by a fluorescent group.
In summary, the problems of the prior art are as follows:
(1) the driving element of the DNA nano robot reported in the literature at present, such as DNA, can not be recycled, so that the use efficiency is limited;
(2) the fluorescence signals required for realizing the functions of characterization, tracing, imaging and the like of the DNA nano robot reported in the literature at present need to carry out fluorophore labeling on the DNA skeleton, but the price is high, so that the wide application of the DNA nano robot is limited;
(3) the DNA nano robot reported in the literature at present has single function, and the wide application of the DNA nano robot is limited.
The difficulty in solving the technical problems is as follows:
how to design a novel nano robot, so that the opening operation of the novel nano robot is regulated and controlled by a driving element; how to design a novel fluorescence nano robot, so that the fluorescence signal of the novel fluorescence nano robot is obtained without being marked and modified, and the fluorescence signal is started and enhanced to be regulated and controlled by a driven element; how to design a novel fluorescence nanometer robot so that the novel fluorescence nanometer robot has multiple functions. In conclusion, the innovative design of the construction principle and the functional application of the fluorescence nano robot is a difficult point for solving the technical problems.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides an application of a microRNA (ribonucleic acid) induced open type DNA fluorescent nano robot in tumor cells and a construction method thereof.
The invention is realized in such a way, and provides an application of a microRNA (ribonucleic acid) induced open type DNA fluorescence nano robot in tumor cells, wherein the DNA fluorescence nano robot is applied to tumor cell imaging and inhibition, and the nano robot and the tumor cells are incubated together, so that the tumor cells can show obvious fluorescence; by prolonging the incubation time, tumor cells can be significantly inhibited.
The invention also needs to construct a tumor marker microRNA induced open type DNA fluorescence nano robot, and the construction method comprises the following steps:
selecting a tumor marker microRNA-195 as a target, designing hairpin structure DNAs with three different sequences by software simulation of the selected tumor marker microRNA-195, opening the hairpin structure DNAs in sequence through strand displacement reaction only in the presence of the tumor marker microRNA-195, combining the hairpin structure DNAs to form a stable Y-shaped structure, and replacing the target DNA to recycle the Y-shaped structure.
Further, a miR-195 induced opening type DNA fluorescence nano robot is constructed, and the construction method comprises the following steps:
selecting tumor cells, simulating the selected tumor cells by software, designing hairpin structure DNAs with three different sequences, reasonably designing double-stranded template DNAs for synthesizing metal nanoclusters into the hairpin structure DNAs, forming a stable Y-shaped structure only in the presence of miR-195, and replacing target DNAs for recycling; under the action of a reducing agent, metal ions form metal nano clusters by taking a Y-shaped structure as a template, and show fluorescence; and replacing the target DNA for recycling.
In summary, the advantages and positive effects of the invention are:
(1) the invention uses the DNA fluorescence nano robot for imaging and inhibiting tumor cells for the first time. The multifunctional nano robot is novel in construction, and provides a new idea for diagnosis and treatment integration of tumor cells.
(2) The invention constructs a novel label-free tumor marker-induced-start fluorescence nano robot, improves the working efficiency of the nano robot, realizes the fluorescence label-free, provides a new thought for the construction of the functionalized DNA nano robot and provides a new tool for the fluorescence imaging technology;
(3) the invention designs the miR-195 driving start-up type DNA nano robot for the first time, the DNA nano robot can be driven to start up only in the presence of miR-195, and the Trigger DNA can be recycled.
(4) According to the invention, a metal nano-cluster template is firstly mixed into the design of the nano-robot, the enzyme-free strand displacement reaction is firstly used for mediating and DNA is used as the template to synthesize the copper nano-cluster in situ, the novel DNA fluorescent nano-robot is constructed, and the functions of label-free, enzyme-free, modification-free and fluorescence signal induced cascade enhancement are realized. The method expands the application of the functionalized DNA nano robot and provides a new tool for the fluorescence imaging technology;
(5) the invention develops a novel label-free and decoration-free fluorescent DNA nano robot, realizes the aims of induction starting of a target object, no enzyme mediation and induced cascade enhancement of a fluorescent signal, can provide a new thought for rational design of a functional DNA nano robot, provides a new tool for a fluorescent imaging technology, and has important scientific significance for innovation and development of the DNA nano robot with diagnosis and treatment integrated function.
Drawings
FIG. 1 is a schematic diagram of a construction method of a miR-195 induced turn-on DNA fluorescence nano-robot provided by the embodiment of the invention.
FIG. 2 is a diagram of the fluorescence spectrum identification of the DNA nano-robot according to the embodiment of the present invention.
FIG. 3 is a DNA nano-robot based tumor cell imaging identification chart provided by the embodiment of the invention.
FIG. 4 is a diagram of tumor cell inhibition identification based on DNA fluorescence nano-robot provided by the embodiment of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
The driving element of the DNA nano robot reported in the literature at present, such as DNA, can not be recycled, so that the use efficiency is limited; the fluorescence signal required for realizing the functions of DNA nano robot characterization, tracing, imaging and the like needs to carry out fluorophore labeling on a DNA skeleton, so the price is high, and the wide application of the DNA nano robot is limited. The DNA nano robot has single function, and the wide application of the DNA nano robot is limited.
The invention is further described below with reference to specific assays.
The construction method of the novel fluorescence nano robot provided by the embodiment of the invention is used for constructing the miR-195 induced opening type fluorescence DNA nano robot;
(1) rational design of fluorescent DNA nano-robot:
the tumor marker microRNA-195(miR-195, SEQ ID NO: 1UAGCAGCACAGAAAUAUUGGC) is selected as a target substance, the rational design is carried out, DNAMAN software simulation is utilized, and the construction principle of the DNA nano robot without enzyme, label and modification is shown in figure 1. In the present system, an innovatively designed capture probe complex, comprising a miR-195 complementary sequence (SEQ ID NO: 2TCATACGTTCATACTCGCCAATATTTCTGTGCTGCTA) and a partially complementary inducible sequence (Trigger DNA, SEQ ID NO: 3CACAGAAATATTGATGAACGTATGA), was used as a recognition probe for miR-195. Hairpin A (Hairpin A, SEQ ID NO: 4AATATTGATGAACGTATGAGCGCTCATACGTTTCATACGTTCATCAATATTTC TGTG), Hairpin B (Hairpin B, SEQ ID NO: 5GTATGAGCGCTCATACGTTCATCACAGAAATATTAACGTATGAGCGCTCATA CGTTCAT), Hairpin C (Hairpin C, SEQ ID NO: 6CGTTCATCACAGAAATATTGATGAACGTATGAAATATTTCTGTGATGAAC GTATGAGCG) each comprise a partial sequence of CuNPs template, and the sequence information is shown in Table 1. More importantly, hairpin A, B, C was innovatively designed as a hairpin structure to lock in part of the CuNPs synthetic templates and had a protruding end at the 3' end as a foothold and only when combined with specific sequences could strand displacement be initiated to open the hairpin structure. When only miR-195 exists, the miR-195 specifically binds to a miR-195 complementary sequence to release TriggerDNA, then binds to a foothold of a hairpin A to promote first round strand migration, opens the hairpin A, and the 5' end of the hairpin A is immediately bound to the foothold of the hairpin B to start second round strand migration and open the hairpin B; then, the 5' end of the hairpin B is combined with the foothold of the hairpin C, a third round of chain transfer is started, and the hairpin C is opened; and then, combining the 5 'end of the hairpin C with the 3' end of the hairpin A to form a stable Y-shaped DNA structure ABC, and simultaneously, displacing Trigger DNA to induce a new round of chain migration so as to realize the cyclic utilization of the Trigger DNA. At this time, the "Y-type" DNA formed contains the entire CuNPs template. Finally, by ascorbic acidReduction of sodium (ascorate), Cu2+Is reduced to Cu0And in the latter, formed Y-type DNA is used as a template to generate CuNPs, so that a remarkably enhanced fluorescence signal is generated, and the construction of the miR-195 induced opening type DNA fluorescence nano robot is realized.
Oligonucleotide sequences used in Table1
(2) Fluorescence spectrum analysis of the fluorescence DNA nano robot:
recording the fluorescence intensity of the experimental sample in the range of 300-400nm at room temperature by using a fluorescence spectrophotometer F-7100(Hitachi) to search for the maximum excitation wavelength (lambda ex); the fluorescence intensity of the experimental sample was recorded at room temperature in the range of 500-700nm, and the maximum emission wavelength (. lamda.em) was searched. Each set of samples was assayed in duplicate 3 times.
As a result, as shown in FIG. 2, the maximum excitation wavelength of the constructed DNA nanorobot was 345nm, and the maximum emission wavelength was 605 nm.
(3) Tumor cell imaging based on DNA fluorescence nano-robot:
the successfully constructed DNA fluorescent nano robot and the human ovarian cancer cell A2780 are incubated together, and the fluorescence imaging capability of the nano robot is observed by using a confocal fluorescence microscope.
The result is shown in fig. 3, a2780 shows significant fluorescence enhancement, which indicates that the constructed DNA nano-robot has an imaging function on tumor cells.
(4) Tumor cell inhibition based on DNA fluorescence nano-robot:
the successfully constructed DNA fluorescent nano robot is incubated with the human ovarian cancer cell A2780, and the tumor cell inhibition capacity of the nano robot is observed by using a CCK-8 experiment.
The result is shown in fig. 4, the survival rate of a2780 is remarkably reduced along with the extension of the incubation time, which indicates that the constructed DNA nano-robot has an inhibition function on tumor cells.
The present invention will be further described with reference to effects.
1) The method for preparing the miR-195 induced open type DNA nano robot comprises three hairpin structure DNAs with different sequences, so that the hairpin structure DNAs can be sequentially opened through strand displacement reaction only in the presence of target miR-195, then are combined with each other to form a stable Y-shaped structure, and the target DNAs are displaced for recycling;
2) the method comprises three hairpin structure DNAs with different sequences, and rationally designs double-stranded template DNAs for synthesizing metal nanoclusters into the hairpin structure DNAs, so that the double-stranded template DNAs can form a Y-shaped structure only in the presence of target miR-195, and metal ions form the metal nanoclusters by taking the structure as a template under the action of a reducing agent so as to show fluorescence.
3) A tumor cell imaging and inhibiting method based on a fluorescent DNA nano robot is characterized in that the successfully constructed nano robot is incubated with tumor cells, so that the tumor cells can show obvious fluorescence; the incubation time is prolonged, the tumor cells can be obviously inhibited, and the purpose of integrating tumor diagnosis and treatment is realized.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
Claims (4)
1. An application of a microRNA-induced open-type DNA fluorescence nano-robot in tumor cells is used for inhibiting the tumor cells.
2. The application of the microRNA-induced open-type DNA fluorescence nano-robot in tumor cells according to claim 1, wherein the microRNA-induced open-type DNA fluorescence nano-robot is characterized in that: the DNA fluorescent nano robot is incubated with tumor cells.
3. The method for constructing the fluorescence nano robot according to any one of claims 1 to 2, wherein the fluorescence nano robot is constructed by adopting the following method, which specifically comprises the following steps:
selecting a tumor marker microRNA-195 as a target, designing hairpin structure DNAs with three different sequences by software simulation of the selected tumor marker microRNA-195, opening the hairpin structure DNAs in sequence through strand displacement reaction only in the presence of the tumor marker microRNA-195, combining the hairpin structure DNAs to form a stable Y-shaped structure, and replacing the target DNA to recycle the Y-shaped structure.
4. The method for constructing a fluorescence nano robot according to claim 3, wherein the raw materials for constructing the nano robot comprise hairpin structure DNAs with three different sequences, double-stranded template DNAs for synthesizing metal nanoclusters are physically designed to enter the hairpin structure DNAs, a 'Y-shaped' structure is formed only in the presence of target miR-195, and metal ions form the metal nanoclusters by using the 'Y-shaped' structure as a template under the action of a reducing agent to show fluorescence; and replacing the target DNA to recycle the Y-shaped structure.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911059920.XA CN110853700A (en) | 2019-11-01 | 2019-11-01 | Application of microRNA (ribonucleic acid) induced open type DNA (deoxyribonucleic acid) fluorescence nano robot in tumor and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911059920.XA CN110853700A (en) | 2019-11-01 | 2019-11-01 | Application of microRNA (ribonucleic acid) induced open type DNA (deoxyribonucleic acid) fluorescence nano robot in tumor and construction method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110853700A true CN110853700A (en) | 2020-02-28 |
Family
ID=69599031
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911059920.XA Withdrawn CN110853700A (en) | 2019-11-01 | 2019-11-01 | Application of microRNA (ribonucleic acid) induced open type DNA (deoxyribonucleic acid) fluorescence nano robot in tumor and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110853700A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113637669A (en) * | 2021-08-24 | 2021-11-12 | 青岛大学附属医院 | DNA-AuNPs structural monomer, system and method for photothermal-gene combined treatment of cancer and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105695327A (en) * | 2016-04-06 | 2016-06-22 | 京东方科技集团股份有限公司 | Nano robot |
| CN109338014A (en) * | 2018-10-19 | 2019-02-15 | 深圳市老年医学研究所 | DNA circulation induces open type DNA fluorescence nano robot construction method |
-
2019
- 2019-11-01 CN CN201911059920.XA patent/CN110853700A/en not_active Withdrawn
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105695327A (en) * | 2016-04-06 | 2016-06-22 | 京东方科技集团股份有限公司 | Nano robot |
| CN109338014A (en) * | 2018-10-19 | 2019-02-15 | 深圳市老年医学研究所 | DNA circulation induces open type DNA fluorescence nano robot construction method |
Non-Patent Citations (1)
| Title |
|---|
| 张银龙 等: "用于肿瘤血管栓塞治疗的智能型DNA纳米机器人", 《科学通报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113637669A (en) * | 2021-08-24 | 2021-11-12 | 青岛大学附属医院 | DNA-AuNPs structural monomer, system and method for photothermal-gene combined treatment of cancer and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tørring et al. | DNA origami: a quantum leap for self-assembly of complex structures | |
| Chakraborty et al. | Nucleic acid–based nanodevices in biological imaging | |
| Lin et al. | Submicrometre geometrically encoded fluorescent barcodes self-assembled from DNA | |
| Han et al. | DNA-templated fluorescent silver nanoclusters | |
| CN102844445B (en) | Enhanced multiple FISH | |
| Woehrstein et al. | Sub–100-nm metafluorophores with digitally tunable optical properties self-assembled from DNA | |
| Xu et al. | Recent advances in DNA walker machines and their applications coupled with signal amplification strategies: A critical review | |
| CN109837326B (en) | Biological target molecule detection method based on multivalent capture and output signal amplification | |
| He et al. | A universal platform for building molecular logic circuits based on a reconfigurable three-dimensional DNA nanostructure | |
| Tan et al. | Molecular beacons for bioanalytical applications | |
| Malcos et al. | Engineering tubulin: microtubule functionalization approaches for nanoscale device applications | |
| Tintoré et al. | DNA nanoarchitectures: steps towards biological applications | |
| RU2004133894A (en) | FUNCTIONALIZED NANOPARTICLES AND WAYS OF THEIR APPLICATION | |
| Cheng et al. | Flap endonuclease 1-assisted DNA walkers for sensitively and specifically sensing ctDNAs | |
| Li et al. | A DNAzyme-mediated logic gate for programming molecular capture and release on DNA origami | |
| CN108918509A (en) | A kind of development and its application based on CdSe quantum dot Electrochemiluminescsensor sensor | |
| CN109338014B (en) | DNA circulation induction open type DNA fluorescence nano robot construction method | |
| CN110853700A (en) | Application of microRNA (ribonucleic acid) induced open type DNA (deoxyribonucleic acid) fluorescence nano robot in tumor and construction method thereof | |
| Zheng et al. | Ultrastable bimolecular G-quadruplexes programmed DNA nanoassemblies for reconfigurable biomimetic DNAzymes | |
| Wu et al. | A label-free and enzyme-free system for operating various logic devices using poly (thymine)-templated CuNPs and SYBR Green I as signal transducers | |
| Zhang et al. | Resettable and enzyme-free molecular logic devices for the intelligent amplification detection of multiple miRNAs via catalyzed hairpin assembly | |
| Du et al. | A review on optical imaging of DNA nanostructures and dynamic processes | |
| Valero et al. | Mechanisms, methods of tracking and applications of DNA walkers: a review | |
| CN101573454A (en) | Nucleic acid beacons for fluorescent in-situ hybridisation and chip technology | |
| Wang et al. | Enzyme-free isothermal amplification strategy for the detection of tumor-associated biomarkers: A review |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20200228 |
|
| WW01 | Invention patent application withdrawn after publication |