CN110850100A

CN110850100A - Detection of anti-Annexin A in serum2Kit for IgG antibodies

Info

Publication number: CN110850100A
Application number: CN201911167249.0A
Authority: CN
Inventors: 叶青; 毛建华; 田丹丹
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2019-11-25
Filing date: 2019-11-25
Publication date: 2020-02-28
Anticipated expiration: 2039-11-25
Also published as: CN110850100B

Abstract

The invention provides a method for detecting anti-Annexin A of serum₂The kit of the invention adopts an anti-Annexin A of a primary nephrotic syndrome related biomarker₂-target antigen Annexin A corresponding to IgG antibody₂The human anti-labeled peptide IgG is used as a standard substance for quantitative detection, and a biotin-labeled detection antibody and an enzyme-labeled streptavidin amplification system are utilized, so that the serum anti-Annexin A is improved₂The accuracy and sensitivity of IgG antibody detection is based on anti-Annexin A₂IgG antibody provides a better detection method for diagnosing and treating the primary nephrotic syndrome.

Description

Detection of anti-Annexin A in serum2Kit for IgG antibodies

Technical Field

The invention belongs to the technical field of biology, and relates to a method for detecting anti-Annexin A of serum₂A kit of IgG antibodies. Is a rapid, simple and high-sensitive qualitative or quantitative analysis of the anti-Annexin A in human serum₂A kit for the detection of IgG levels.

Technical Field

In recent years, the types of kidney diseases of children are more and more, wherein the incidence rate of the primary nephrotic syndrome is the highest, and the physical and psychological health of the children is seriously harmed. The primary nephrotic syndrome is caused by kidney function damage caused by various reasons and simultaneously has symptoms of three highs and one low, namely a group of syndromes of a large amount of proteinuria, high edema, hyperlipidemia and hypoproteinemia. The etiology and pathogenesis of primary nephrotic syndrome are still unclear, and the following factors mainly exist: first, filtration barrier damage, intrarenal deposition of immunoglobulin and/or complement components, local protection from disease damage multiple proteins of large-medium molecular weight are lost in the filtration membrane positive barrier urine, resulting in low selectivity proteinuria. And secondly, the electrostatic barrier is damaged, so that a large amount of anionic charged medium molecular plasma protein is filtered out, and high-selectivity proteinuria is formed. The glomerular filtration barrier comprises two parts of a charge barrier and a mechanical barrier, wherein the charge barrier is positioned on the inner side of endothelial cells of capillaries and consists of a group of biomacromolecules with negative charges, and can prevent molecules with negative charges such as albumin from being filtered; the mechanical barrier is a capillary endothelial cell, a glomerular basement membrane and a fissure between foot processes of epithelial cells from inside to outside in sequence, and the three-layer structure and the fissure on the three-layer structure are the structural basis of the mechanical barrier so as to prevent medium and large molecules from being filtered. Wherein the filtering pore diameter of the glomerular podocyte is 25-40nm, which is the last barrier in the filtering membrane and is the smallest filtering hole in the filtering membrane. Podocytes are the primary cell source for the synthesis of heparan sulfate, which is rich in negatively charged component barriers, and distribute heparan sulfate over the basement membrane (GBM) and both sides thereof. The podocyte itself is also covered with negatively charged sialoglycoproteins, which together maintain the charge barrier function of the filtration membrane. But the special anatomical position of podocytes makes the in vivo research difficult; in addition, since kidney podocytes from normal adult organisms are terminally differentiated cells, primary cells cultured in vitro cannot proliferate. Little work has been done in the past in vitro studies of podocytes. The establishment of conditionally cultured immortalized mouse podocyte lines by transgenic approaches in the mid 90 s has led to a breakthrough in the understanding of the structure of the podocyte and its role and mechanism in glomerular disease.

Disclosure of Invention

The application aims to provide a method for detecting serum anti-Annexin A₂A kit of IgG antibody, which mainly comprises an antigen protein Annexin A₂Solid phase carrier, positive quality control product, standard product, enzyme label or chemiluminescence agent label or biotin labeled antihuman IgG, substrate displayThe kit comprises a color agent, an antigen diluent, a sample diluent buffer solution, an antibody diluent, a washing solution and a stop solution, and a signal detection method comprises a light color development method and a chemiluminescence method.

The antigen protein Annexin A₂Contains the cDNA sequence GenBank (CM-000677.2) SEQ ID:1 as follows: (chromosome15,101bp from base 60347151: -TGATTTTATTTTATTTTATTTCATTTAAATTTAACTTAAATAGCGACACTTGGATAGGGGCA ACCATACTGTACAGCTCAGTCCCAGAGCTTTCTTCCTACA-).

The antigen protein Annexin A₂Immobilized on a solid support, preferred solid supports include: nitrocellulose membrane and enzyme-labeled microporous plate.

The standard substance and the positive quality control substance are recombinant human anti-tag peptide immunoglobulin G or fragments thereof, or anti-Annexin A extracted from patient serum₂The antibody is used as a positive quality control product and a standard product.

The detection kit also comprises a substrate color developing agent, an antigen diluent, a serum/antibody diluent, a washing solution and a stop solution. The color developing agent is TMB, acridine ester, AMPPD and 4-MUP; the antigen diluent is 1 XPBS PH7.4, NaCL163mM, 1% TritonX-100; the sample dilution buffer is 0.01M PBS PH7.4+ 10% newborn bovine serum; the anti-human IgG diluent is 0.01M PBSPH7.4 containing 1M D-glucose and 2% glycerol; the antibody diluent is prepared by adding 1M D-glucose (19.82g) and 2% glycerol (2ml) into 0.01M PBS containing 0.35% Tween2 to 100 ml; the washing solution is as follows: 1 XPBS PH7.4, NaCL163mM, 1% TritonX-100, glycerol 10%; the stop solution is: 2M sulfuric acid.

The antigen protein Annexin A₂Carrying a tag peptide thereon, said tag peptide comprising: a GST tag, a c-Myc tag, a His tag, a Flag tag, or a biotin tag.

According to the invention, the antigen Annexin A₂The relative titer quantification of the corresponding serum autoantibodies was calculated using the specific immunoreactivity between the uniform tag peptide and anti-tag peptide antibodies and regression of a standard curve.

According to the invention, the antigenic protein Annexin A₂Can be expressed in Escherichia coli,In mammalian cells.

According to the invention, the antigenic protein Annexin A₂Purifying with Ni column affinity chromatography, molecular sieve, ion exchange column, and hydrophobic column.

According to the present invention, the signal detection method used includes a photo-coloration method, a chemiluminescence method.

According to the invention, the serum is a mammalian (human) serum.

The invention adopts a gene recombination method to successfully express and purify a recombinant protein Annexin A₂The antigen protein is used as the antigen protein in the kit, and a method of antigen coating solid phase carrier is adopted to develop a set of serum anti-Annexin A suitable for detecting patients with primary nephrotic syndrome₂-a kit of IgG. Is a qualitative or quantitative analysis of anti-Annexin A in human serum₂IgG detection kit.

The antigen protein Annexin A₂The fixing method is a direct coating method: 1. the antigen is combined on the nitrocellulose membrane or the polystyrene microporous plate in a non-covalent bond or physical adsorption mode; 2. the magnetic beads are provided with functional groups capable of being combined with proteins, and the antigens are combined on the magnetic beads in a chemical coupling mode.

According to the invention, a large number of clinical and molecular mechanism researches at the early stage find that serum IgG level of a patient with nephrotic syndrome is higher, and prove that the membrane-associated protein A on podocytes is high₂Is the main target antigen for the autoantibody in the patient with primary nephrotic syndrome. Thus detecting whether anti-Annexin A exists in serum₂IgG and its quantification are advantageous for early diagnosis of nephrotic syndrome, guidance of clinical treatment and prognosis. Specifically, total protein of the podocyte MPC5 is run on two SDS-PAGE gels at the same time, one is stained by Coomassie brilliant blue (A), one is electrophoresed on SDS-PAGE gel, and then transferred to nitrocellulose membrane, and is added with IgG antibody (containing IgG type autoantibody aiming at podocytes through immunofluorescence detection of mouse podocyte) purified from serum of a patient with primary nephrotic syndrome for WB detection. Taking a Coomassie brilliant blue staining strip corresponding to the WB positive strip for mass spectrometry, and identifying the strip as Annexin A₂Protein (C), commercial recombinant Annexin A₂ProteinCan be specifically combined with a composition containing Annexin A₂Serological response of patients with primary nephrotic syndrome by antibodies, commercial Annexin A₂The antibody can also be specifically separated from Annexin A after the SDS-PAGE gel electrophoresis of the total protein of the podocyte MPC5₂Protein banding reaction (D). B (1: 1000-fold dilution of IgG antibody purified from serum of patients with nephrotic syndrome, 2: 1: 2000 dilution of IgG antibody purified from serum of patients with nephrotic syndrome, 3: 1:1000 dilution of IgG antibody purified from serum of healthy person, 4: 1: 2000 dilution of IgG antibody purified from serum of healthy person, 5-6: β -actin.) D (1: Annexin A separated from total protein of podocytes after SDS-PAGE electrophoresis)₂A protein band; 2: recombinant Annexin A₂A protein; positive serum: containing Annexin A₂Serum from patients with primary nephrotic syndrome of antibodies; negative serum: serum of healthy persons. ). E: AnnexinA₂Three-dimensional structure diagram of protein. The results are shown in FIG. 1A, B, C, D, E.

The specific innovation points can be summarized as follows:

(1) the invention adopts recombinant human anti-His-tag immunoglobulin as a standard substance, and can specifically identify the antigen with the His-tag, thereby improving the accuracy and specificity of the detection of the kit.

(2) Optimization of reaction conditions the present invention uses an orthogonal experimental design, based on the antigen AnnexinA₂Orthogonal tables were selected for 4 factors, such as coating concentration (four coating concentrations of 30. mu.g, 50. mu.g, 120. mu.g, and 20. mu.g), reaction time (30min, 60min), and temperature (25 ℃ C., 37 ℃ C.), optimal dilution of enzyme-labeled secondary antibody (five dilutions of 1:50, 1:100, 1:200, 1:500, and 1: 1000), and standard positive serum and standard negative serum were repeatedly measured at 2 levels for each factor. The ratio (P/N) of the highest OD value (P) of the positive sera to the lowest OD value (N) of the negative sera was selected. The average P/N value of repeated measurement is statistically processed to determine the optimal coating condition and the optimal dilution of the secondary antibody to carry out orthogonal optimization, thereby obviously improving the positive detection rate of the standard positive serum. Orthogonal design results show that the optimal coating concentration of the antigen is 120 mug, the optimal reaction time is 30min, and the optimal enzyme-labeled secondary antibody dilution is 1: 200.

(3) the kit of the invention relates to qualitative and quantitative analysis of anti-Annexin A in human serum₂The IgG antibody solid-phase membrane immunoassay method is simple and convenient to operate, the adsorption capacity of an NC membrane is extremely strong and is close to 100%, a trace antigen can be completely adsorbed, and the reagent dosage is reduced by nearly 10 times compared with that of the traditional ELISA; the NC membrane with adsorbed antigen or antibody or existing result can be preserved for a long time (the NC membrane can be preserved for half a year at-20 ℃), does not affect the activity of the NC membrane, and is beneficial to physical examination and screening of healthy people. The biotin avidin system enzyme-linked immunosorbent assay method combines the antigen-antibody specific binding reaction with the biotin avidin amplification system, greatly improves the detection sensitivity, and provides important basis for the diagnosis and treatment of primary nephrotic syndrome, the shortening of hospitalization time and the reduction of disease recurrence.

(4) At present, Annexin A related to kidney disease patients at home and abroad₂anti-Annexin A₂IgG is limited to molecular mechanism research and does not quantitatively detect the level of IgG in the serum of a patient, while the project detects the serum anti-Annexin A of a patient with primary nephrotic syndrome₂The IgG kit fills the blank at home and abroad.

Drawings

FIG. 1 is Membrane-bound protein A on podocytes₂Is the main target antigen for the autoantibody in the patient with primary nephrotic syndrome.

FIG. 2 shows pET-28a (+) -Annexin A₂Recombinant plasmid map.

FIG. 3 is a flow chart of the extraction and quantification of human anti-Annexin A2-IgG antibody.

FIG. 4 is a solid phase membrane immunoassay for anti-Annexin A₂Schematic representation of IgG.

FIG. 5 shows two elution peaks, the first peak being a biotin labeled antibody peak and the second peak being a biotin multimer peak.

FIG. 6 is a kit for detecting anti-Annexin A₂IgG standard curve plotting.

FIG. 7 is the primary nephrotic syndrome patient anti-Annexin A₂IgG positivity rate.

FIG. 8 shows the resistance to Annexin A in patients with various renal diseases₂-detection rate of IgG, wherein PNS: the primary kidney disease syndrome is characterized in that,HSPN: purpuric nephritis, SH: simple hematuria, IgAN: IgA nephropathy, LN: lupus nephritis, NC: a healthy child.

FIG. 9 is the primary nephrotic syndrome patient anti-Annexin A₂IgG positivity vs hormone resistance. Wherein the SRNS: hormone-resistant nephrotic syndrome, SSNS: hormone sensitive nephrotic syndrome.

FIG. 10 is anti-Annexin A_2-Time of admission and urine protein content in patients with IgG-positive primary nephrotic syndrome.

FIG. 11 is anti-AnnexinA in patients with primary nephrotic syndrome after treatment with immunosuppressants₂-IgG, 24 hour urinary protein level, serum albumin level changes; wherein A: 24 hours changes in urine protein levels and serum albumin in patients with primary nephrotic syndrome; b: immunoblotting method for detecting anti-Annexin A in serum of patient with primary nephrotic syndrome₂-levels of IgG.

Detailed Description

The invention is further described below with reference to the following figures and specific examples. The following examples are intended to illustrate the invention only and are not intended to limit the scope of the invention.

The examples illustrate that: the experimental principle is that antigen is adsorbed on a solid phase carrier to serve as coating antigen, then positive quality control products or standard products or serum samples to be detected are added for incubation, then labeled secondary antibodies are added for antigen-antibody reaction, and finally, light signals are detected by using a light color development method, a chemiluminescence method and a fluorescence method to achieve qualitative or quantitative analysis of anti-Annexin A in human serum₂Purpose of IgG antibodies.

1.1 recombinant antigenic protein Annexin A₂Expression and purification: human Annexin A obtained from GenBank (CM000677.2)₂cDNA sequence of gene, designing primer, and amplifying the coding Annexin A by PCR method₂Partial gene sequence and connection with carrier. Then cloning into prokaryotic expression vector pET28a (+) to express Annexin A₂A protein. The antigen protein expressed by the invention contains tag peptide, and can be selected from GST tag, Flag tag, c-Myc tag, His tag and the like.

1.2 solid phase carrier: the solid phase carriers selected by the invention comprise: nitrocellulose membrane, polystyrene micropore plate.

1.3 antigen protein immobilization method: the antigen coating solid phase carrier method of the invention comprises a direct coating method: firstly, combining an antigen on a nitrocellulose membrane or a polystyrene microporous plate in a non-covalent bond or physical adsorption mode; and secondly, the magnetic beads are provided with functional groups capable of being combined with proteins, and the antigens are combined on the magnetic beads in a chemical coupling mode.

1.4 positive quality control substances and standard substances: the positive quality control product and the standard product selected by the invention are recombinant human anti-tag peptide IgG or IgG extracted from patient serum and quantified.

1.5 labeled antibody and substrate chromogenic reagent: the labeled antibody selected by the invention can be Horseradish Peroxidase (HRP) labeled anti-human IgG, acridinium ester labeled anti-human IgG and biotin labeled anti-human IgG; the developer can be tetramethyl benzidine (TMB), 4-MUP, AMPPD.

1.6 Signal detection: detecting optical signals by using a microplate reader, a chemiluminescence analyzer and other methods, and quantitatively analyzing the anti-Annexin A in human serum by drawing a standard curve₂–IgG。

2. The components and preparation of the conventional reagent and solution used in the invention.

2.1. Polystyrene micropore plate, nitrocellulose membrane (NC) and magnetic beads (purchased in the market).

2.2.PBS pH7.4 KCL 2.7mM, NaCL137mM, Na2HPO48.1mM, KH2PO41.5 mM; 32.20 XWash: KCL 54mM, NaCL2.74mM, Na2HPO 4162 mM, KH2PO 430 mM,0.22 μm filter membrane negative pressure filtration.

2.3. Blocking solution 5% BSA solution: 5g of bovine serum albumin was weighed and dissolved in 100mL of 0.01M PBS.

2.4. Antigen dilution: 1x PBS PH7.4, NaCL163mM, 1% TritonX-100.

2.5. Serum/antibody dilutions: 1M D-glucose (19.82g), 2% glycerol (2ml) was added to 0.01M PBS containing 0.35% Tween2 to 100ml, and filtered under reduced pressure through a 0.22 μ M filter.

2.6. Washing liquid: 1 XPBS PH7.4, NaCL163mM, 1% TritonX-100, glycerol 10%.

TMB color developer: 50mM imidazole buffer pH5, 7.5mM PEG3350, 2.94 mM urea hydrogen peroxide, 1.6mM TMMB.

2.8. Stopping liquid: 2M sulfuric acid.

SDS-PAGE (10%) formulation.

a.5% concentrated glue preparation:

b.10% separating glue preparation:

EXAMPLE 1 prokaryotic expression and purification of Annexin A₂Antigen obtained from GenBank (CM-000677.2) and encoding human Annexin A₂The partial cDNA sequence of the gene (chromosome15, 101bpfrombosse 60347151-60347252: -TGATTTTATTTTATTTTATTTCATTTAAATTTAACTTAAATAGCGACACTTGGATAGGGGCAACCATACTGTACAGCTCAGTCCCAGAGCTTTCTTCCTACA-) and primers designed therefrom, the primer sequences are as follows: upstream 5-GAATTCTGATTTTATTTTATTTTA-3' (underlined containsEcoRICleavage site), downstream 5-GGATCCAGTAGGAAGAAAGCT-3' (underlined containsBamHIEnzyme cutting site), connecting with pMD19-T vector, transforming JM109 competent cells, picking single clone colony, carrying out colony PCR and double enzyme cutting preliminary identification, and then sending to company for sequencing. For the successful connection Annexin A₂EcoRI/BamHI double digestion of pMD19-T, recovery of the desired fragment, ligation with pET28a by the same double digestion, ligation of pET28a-Annexin A₂Converting plasmid into BL21 competent cell, selecting monoclonal colony, performing colony PCR and double enzyme digestion preliminary identification, sending the colony to a company for successful sequencing, performing mass bacteria amplification to collect thalli, breaking the bacteria, reserving supernatant, collecting inclusion bodies, and groping for optimal induction time and inducer for protein expressionConcentration, identification of protein expression sites. Purifying the expressed recombinant protein by nickel column affinity chromatography, molecular sieve, hydrophobic column and ion affinity chromatography, and finally identifying the recombinant protein Annexin A by SDS-PAGE₂The molecular weight is quantified, and the recombinant plasmid pET28a-Annexin A₂See fig. 2.

Example 2 anti-Annexin A₂Preparation of-IgG antibody Standard

2.1 anti-Annexin A₂Extraction of IgG antibodies Using preliminary experiments, a higher content of anti-Annexin A was selected₂IgG antibody serum, then diluted 1:200, 100ul added to previously administered Annexin A₂In the coated reaction holes, 6 holes are totally made, and simultaneously 2 holes are made, 100ul of reaction buffer solution is only added to eliminate nonspecific adsorption, the oscillation reaction is carried out for 2 hours at 37 ℃, the washing solution is washed for 3 times, 3 holes are taken to be added with 100ul of 6mol of urea, the oscillation reaction is carried out for 20min at 37 ℃, thus specific IgG is dissociated into the urea solution, the urea solution is respectively extracted and the content of the IgG dissolved in the urea solution is detected, then the 3 holes are continuously washed for 2 times, and the anti-Annexin A is further carried out with the remaining 5 holes₂Detection of IgG antibodies to analyze whether they contain undissociated IgG antibodies and their proportion, see FIG. 3.

2.2 anti-Annexin A₂Quantitative determination of IgG antibody Standard the 3 wells above were extracted containing anti-Annexin A₂Urea solutions of IgG antibodies, respectively, ultrafiltered with 50KD molecular weight ultrafiltration tubes, and the collected ultrafiltrates were finally transferred to 50mmol/l tris-HCl (ph7.8) buffer in a final volume of 120 ul. According to the BCA quantitative detection protein kit method, the anti-Annexin A in the buffer solution is determined by drawing a standard curve through a human IgG standard substance with known concentration₂Content of IgG antibodies, and finally quantifying the quantity of anti-Annexin A using reaction buffer₂IgG antibody was diluted to a series of concentration gradients as standard, see figure 3.

Example 3 detection of anti-Annexin A₂Preparation of solid-phase Membrane immunoassay kit for IgG

3.1, for detecting anti-Annexin A₂Composition of the solid-phase membrane immunoassay kit for IgG:

1. coating Annexin A₂A nitrocellulose membrane of the antigen,

2. Positive quality control (Standard) human anti-His tag immunoglobulin G (purchased from Tribioscience) 3, negative quality control (antibody dilution)

4. Horse radish peroxidase-labeled goat anti-human immunoglobulin G

5. Antigen diluent

6. Cleaning solution

7.TMB color-developing agent

8. And (4) stopping the solution.

3.2, the steps of preparing the antigen coated nitrocellulose membrane and detecting the serum sample are as follows:

3.2.1 coating, sealing: directly spotting 5 μ l of antigen solution diluted with 0.01M PBS PH7.4 on nitrocellulose membrane, drying in 37 deg.C incubator for 30min, placing NC membrane in plate tank, adding 100 μ l of 5% BSA, sealing in 37 deg.C incubator for 10min, discarding the sealing solution, and washing with washing solution for 2 times;

3.2.2 antigen incubation: adding 10 μ l of antibody standard substance or specimen to be detected diluted with diluent into the reaction tank, performing negative control and positive control, mixing, reacting in 37 deg.C wet box for 30min, and setting 3 parallel holes for each sample;

3.2.3 Secondary antibody incubation: discarding the liquid in the tank, washing with washing solution for 3 times × 1min, adding 20 μ l of horse radish peroxidase-labeled goat anti-human IgG diluted with antibody diluent, mixing well, and reacting at room temperature for 30 min;

3.2.4 color development: discarding the liquid in the tank, washing with the washing solution for 3 times × 1min, adding 500 μ l of each of the color developing A/B, reacting at room temperature for 10min, and adding 500 μ l of 2M H₂SO₄Stopping solution, mixing uniformly, removing liquid in the tank after 1min, washing for 3 times, taking out the test strip, drying the test strip by using a blower, carrying out macroscopic qualitative judgment after natural drying, wherein the test strip is positive if obvious brown spots appear, or placing the NC membrane in a Canon 9000f markii developing instrument for scanning, drawing a standard curve by using a software system carried by the developing instrument to quantitatively analyze the anti-Annexin A in the serum of a patient by using the concentration of a reference standard substance as a vertical coordinate and a reading value of a reading instrument, namely a gray value as a horizontal coordinate and adopting a method of carrying out Logistic fitting curve by using double logarithms₂-the level of IgG,see fig. 4.

Example 4 detection of anti-Annexin A₂Preparation of enzyme linked immunosorbent assay kit for biotin avidin system of-IgG

4.1, detection of anti-Annexin A₂-composition of biotin avidin enzyme linked immunosorbent assay kit for IgG:

1. coating Annexin A₂Enzyme label plate for antigen

2. Positive quality control (Standard) human anti-His tag immunoglobulin G (purchased from Tribioscience) 3, negative quality control (antigen diluent)

4. Biotin-labeled goat anti-human immunoglobulin G (NHS-PEG4-Biotin from Thermo Co.)

5. Horse radish peroxidase labeled streptavidin (HRP-SA from Sigma-Aldrich Co.)

6. Antigen diluent,

7. Cleaning solution

8. TMB color-developing agent

9. Stopping liquid

10. And (4) sealing films.

4.2 preparation and purification of Biotin-labeled antibodies the following steps were performed:

4.2.1 antibody Ultrafiltration treatment: before labeling, an ultrafiltration column with the molecular weight cutoff of 50kDa is used for carrying out purification treatment before labeling on the antibody so as to remove sodium azide, glycine, Tris, BSA or other additives with free amino groups possibly contained in a protein sample and prevent interference of a labeling reaction.

The concrete steps

1. Adding 200 mul of labeled reaction solution into the ultrafiltration column, adding 500ug of goat anti-human IgG monoclonal antibody, and mixing uniformly. Centrifuging at 4 deg.C and 6000rpm for 2min, and removing filtrate;

2. add 100. mu.l of labeled reaction solution to the ultrafiltration column and mix well. 4 ℃, Max 14000 Xg for 2 min;

3. repeating the step for 2, 6-7 times;

4. mixing the residual liquid in the ultrafiltration column, and standing at room temperature for 1 min; inverting the ultrafiltering column, placing in a new ultrafiltering tube at 4 deg.C, 1000 Xg for 2min, collecting filtrate, mixing 50 μ l PBS in the ultrafiltering column, and standing for 1 min;

5. the column was inverted and filtered at 4 ℃ and 6000rpm for 2 min. Collecting filtrate, mixing with the filtrate of step 6, standing at 4 deg.C for use, adjusting antibody concentration to 2mg/ml with labeled reaction solution,

6. the amount of biotin required to calculate the labeled antibody was calculated at an antibody concentration of 2 mg/ml: 1mL solution containing 2mg/mL IgG (150,000MW) required 26. mu.l of 10mM NHS-PEG 4-Biotin; adding NHS-PEG4-Biotin solution into the antibody solution after ultrafiltration, and reacting at room temperature for 1h to perform Biotin-labeled antibody reaction.

4.2.2 gel filtration chromatography purification and Collection of Biotin-labeled antibodies

① installing a chromatographic column of 1 × 15cm, adding 1/3 column volume of deionized water, uniformly and slowly filling the gel filler along the chromatographic column for one turn, allowing the filler to naturally settle in the column, simultaneously opening the lower port of the chromatographic column, allowing the deionized water to slowly flow out, wherein the filled gel is uniform and cannot have obvious bubbles or cracks, after the chromatographic column is filled, balancing the filled gel with a chromatographic balance liquid for at least 2h, separating and purifying the sample, ② connecting the chromatographic column, a constant flow pump and a protein detector, starting the protein detector for a stable half hour before chromatography is started, adjusting the sensitivity to 0.1AUFS, before adding the sample, discharging the balance liquid in the chromatographic column until the liquid level in the chromatographic column is flush with the surface of the gel (or only a very thin liquid layer is left), slowly adding 250ul of a biotin-labeled antibody reaction liquid from the upper end of the chromatographic column, (note that the gel is not floated), after adding the sample, opening the lower port of the chromatographic column to slowly discharge the liquid level in the chromatographic column to the gel surface, then adding a little of the biotin-labeled antibody reaction liquid 250ul, after the gel is flushed, adding the elution liquid, controlling the EP 5. after the elution peak is flush with the elution, the elution peak, the EP 5. the elution is added, the EP 5. the EP is added.

The amount of biotin required to label the antibody was calculated according to tables 1-3:

TABLE 1

Antibody concentration	NHS-PEG₄-Biotin: molar ratio of antibody
		When 10-12mg/ml	12
4-7mg/ml	16
		1-3mg/ml	20
0.5mg/ml	50

At different antibody concentrations, NHS-PEG₄-Biotin: molar ratio of antibody (NHS-PEG)₄-Biotin molecular weight: 589).

Table 2: 10mmol/L NHS-PEG₄-Biotin formulation

NHS-PEG₄-Biotin(mg)	PBS(μl)	NHS-PEG₄-Biotin(mg/μl)
			0.56	95.1	0.00589

Table 3: labeling 10mmol/L NHS-PEG required for 0.5mg goat anti-human IgG antibody₄Biotin volume calculation

4.3, the ELISA detection steps of the ELISA plate preparation and the serum sample are as follows:

4.3.1 coating and sealing: using antigen diluent to dilute antigen Annexin A₂Diluted to 120ug/ml, added to a 96-well plate at 100. mu.l per well, and covered with a sealing film overnight at 4 ℃. Taking out the 96-well plate coated with the antigen from a refrigerator at 4 ℃ the next day, pouring out the coating solution, and patting dry; adding blocking solution containing 2% BSA, blocking 150 μ l per well at room temperature for 2h, pouring off the blocking solution, and patting to dry;

4.3.2 adding 100ul of standard substance and test serum diluted by diluent at a ratio of 1:200 to the antigen-coated strip, respectively, carrying out oscillation reaction at 37 ℃ for 30min, and simultaneously carrying out negative and positive control;

4.3.3 washing the coating solution for 3 times (standing for 30s each time), adding 100ul of biotinylated goat anti-human IgG antibody into each hole after drying, and carrying out oscillation reaction at 37 ℃ for 30 min;

4.3.4 washing the washing and painting liquid for 3 times (standing for 30s per time), and adding HRP-SA 37 ℃ to each hole after drying for oscillation reaction for 30 min;

4.3.5 wash-coat liquid wash 3 (each time 30s of stewing), add TMB developer in each hole after clapping dry, vibrate reaction 5 minutes after the room temperature, add the stop solution, through enzyme-linked immunosorbent assay light signal and draw standard curve and come quantitative analysis to wait to examine anti-Annexin A in serum₂IgG antibody content.

Example 5 drawing of Standard Curve recombinant antigen protein Annexin A₂Adding 120 μ g as coating concentration according to the sequence of five reference standard substances with concentration of 3.125ng, 6.25ng, 12.5ng, 25ng and 50ng, repeating twice, simultaneously making positive and negative control, scanning with "Canon 9000f markii" developer, using the reference standard substance concentration as ordinate and reader reading value, i.e. gray value, as abscissa by software system carried by the developer, and adopting double-functionA standard curve was plotted logarithmically by Logistic fitting, see FIG. 6.

Example 6 sensitivity zero concentration reference standard was used as 20 samples, the mean and standard deviation of the gray scale values of 20 zero reference standards were calculated, mean +3s was substituted into the standard curve equation, and the calculated concentration was used as the method for detecting anti-Annexin A₂The minimum detection limit for IgG antibodies is 0.56 ng/ml.

Example 7

Medical reference range establishment based on the detection of anti-Annexin A in the serum of 259 cases of healthy examiners₂IgG antibody concentration, frequency distribution chart, see Table 4, and calculation of anti-Annexin A in normal humans₂IgG antibody 95% medical reference range P95 and Negative Predictive Value (NPV) and determination of anti-Annexin A in a test serum sample₂Positive confirmation of IgG antibody concentration (Cut Off value) in order to establish the regional anti-Annexin A₂IgG antibody 95% medical reference range. 259 examples of serum anti-Annexin A for physical examination₂The IgG concentration distribution is a skewed distribution, and the anti-Annexin A in normal human serum is calculated₂The 95% medical reference range P95 for IgG concentration values is L95+ i95/f95(n × 95% — Σ fL) is 1.35 ng/ml. Kit for detecting anti-annexinA of normal human serum₂95% of the medical reference range for IgG was < 1.40ng/ml, with a negative predictive value of 96.1%. Combining the statistical grouping condition, the method detects the anti-Annexin A of the serum sample₂Positive confirmation of IgG concentration (Cut Off value) 1.40ng/ml, i.e.when the method detects anti-Annexin A₂And when the IgG concentration is more than 1.40ng/ml, judging as a positive detection result. Testing anti-Annexin A in the serum of 259 cases of healthy examiners₂Results for IgG antibody concentrations are given in Table 5.

TABLE 4 anti-AnnexinA of Normal human serum₂Frequency distribution table of IgG detection results (n 259)

TABLE 5259 results of anti-Annexin A2-IgG detection of serum samples of health examiners

Example 8 detection of serum anti-Annexin A₂Clinical application of-IgG kit

8.1 resistance to AnnexinA in various nephropathies₂Detection rate of IgG the kit is used for detecting the anti-Annexin A in the serum of patients diagnosed with various nephropathy in our hospital from 6 months 2018 to 6 months 2019₂IgG levels, including 370 cases of idiopathic nephrotic syndrome, 44 cases of Henoch's disease, 50 cases of simple hematuria, 75 cases of IgA nephropathy, 19 cases of lupus nephritis and 35 healthy children of the same age, and results showing resistance to AnnexinA in patients with idiopathic nephrotic syndrome₂The detection rate of IgG is 17.8%, and the anti-AnnexinA in IgA nephropathy patients₂The detection rate of-IgG was 2.6%, whereas the antibody was not detected in purpuric nephritis, simple proteinuria, lupus nephritis and healthy children, see fig. 7, 8.

8.266 cases of primary nephrotic syndrome patient anti-AnnexinA 2-IgG concentration positive and hormone resistance and frequency recurrence relation are combined with patient clinical treatment condition and whether recurrence exists or not, the invention discovers 66 cases of anti-AnnexinA ₂60 of IgG positive primary nephrotic syndrome patients have hormone resistance, and the resistance rate is 90.1 percent and is obviously higher than that of Annexina₂Hormone resistance (34.9%, 106/304) (χ 2 ═ 34.424, P ═ 0.000) in IgG negative patients, see fig. 9.

8.3 resistance to AnnexinA₂anti-AnnexinA relationship between hospitalization time and urine protein content of primary nephrotic syndrome patient with positive IgG concentration₂IgG positive antigenThe median time of hospitalization of patients with nephrotic syndrome was significantly longer than that of patients with primary nephrotic syndrome who were negative for this antibody (17d vs 12d, Z-2.539, P-0.011), urinary protein (Z-2.341, P-0.029) and urine-IgG/creatinine (Z-2.543, P-0.011) were also significantly increased, with median numbers of 2550.6mg/L vs 1706.0mg/L and 11.75vs 6.5, respectively, see fig. 10A, B, C.

8.4 Observation of anti-AnnexinA in Primary nephrotic syndrome patients after treatment with immunosuppressants₂Results of changes in IgG concentration, 24-hour urinary protein level and serum albumin level show anti-AnnexinA₂A gradual decline in IgG concentration, accompanied by a gradual decrease in urinary protein levels and an increase in serum albumin over 24 hours, see fig. 11A: 24 hours changes in urine protein levels and serum albumin in patients with primary nephrotic syndrome; b: immunoblotting method for detecting anti-annexnA in serum of patient with primary nephrotic syndrome₂-levels of IgG.

Sequence listing

<110> Zhejiang university

<120> kit for detecting anti-Annexin A2-IgG antibody in serum

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>102

<212>DNA

<213> Artificial sequence (Unknow)

<400>1

tgattttatt ttattttatt tcatttaaat ttaacttaaa tagcgacact tggatagggg 60

caaccatact gtacagctca gtcccagagc tttcttccta ca 102

<210>2

<211>24

<212>DNA

<213> Artificial sequence (Unknow)

<400>2

gaattctgat tttattttat ttta 24

<210>3

<211>24

<212>DNA

<213> Artificial sequence (Unknow)

<400>3

ggatcctgta ggaagaaagc tctg 24

Claims

1. Detection of anti-Annexin A in serum₂An IgG antibody kit characterized by comprising the antigen protein annexin₂The kit comprises a solid phase carrier, a positive quality control product, a standard product, enzyme-labeled or chemiluminescent or biotin-labeled antihuman IgG, a substrate color developing agent, an antigen diluent, a sample diluent buffer solution, an antibody diluent, a washing solution and a stop solution.

2. The method for detecting serum anti-Annexin A according to claim 1₂A kit of IgG antibodies, characterized in that said antigenic protein Annexin A₂The sequence of (A) is shown as SEQ ID: 1.

3. The method for detecting serum anti-Annexin A according to claim 1₂The kit of the IgG antibody is characterized in that the standard substance and the positive quality control substance are recombinant human anti-tag peptide immunoglobulin G or fragments thereof, or anti-Annexin A extracted from serum₂The antibody is used as a positive quality control product and a standard product.

4. The method for detecting serum anti-Annexin A according to claim 1₂The kit of the IgG antibody is characterized in that the solid phase carrier is a nitrocellulose membrane, an enzyme labeling micropore plate and a magnetic bead; the color developing agent is TMB, acridine ester, AMPPD and 4-MUP; the antigen diluent is 1 XPBS PH7.4, NaCL163mM, 1% TritonX-100; the sample dilution buffer is 0.01M PBS PH7.4+ 10% newborn bovine serum; the anti-human IgG diluent is 0.01M PBSPH7.4 containing 1M D-glucose and 2% glycerol; the antibody diluent is prepared by adding 1M D-glucose and 2% glycerol into 0.01M PBS containing 0.35% Tween2 to 100 ml; the washing solution is as follows: 1 XPBS PH7.4, NaCL163mM, 1% TritonX-100, Glycine10% of oil; the stop solution is: 2M sulfuric acid.

5. The method for detecting serum anti-Annexin A according to claim 1₂A kit of IgG antibodies, characterized in that said antigenic protein Annexin A₂Carrying a tag peptide thereon, said tag peptide comprising: a GST tag, a c-Myc tag, a His tag, a Flag tag, or a biotin tag.

6. The method for detecting serum anti-Annexin A according to claim 1₂Kit of IgG antibodies, characterized in that said antigenic protein Annexin A₂Immobilized on a solid support.

7. The method for detecting serum anti-Annexin A according to claim 1₂Kit of IgG antibodies, characterized in that said antigenic protein Annexin A₂Purifying with Ni column affinity chromatography, molecular sieve, ion exchange column, and hydrophobic column.

8. The detection kit according to claim 3, wherein the antigen Annexin A in the kit₂The relative titer quantification of the corresponding serum autoantibodies was calculated using the specific immunoreactivity between the uniform tag peptide and anti-tag peptide antibodies and regression of a standard curve.

9. The detection kit according to claim 6, characterized in that the antigenic protein AnnexinA used in the kit₂The immobilization method is a direct coating method, and the antigen protein is directly immobilized on the solid phase carrier through physical adsorption or chemical combination or non-covalent bond combination.