CN110849863B

CN110849863B - Method for detecting conformational change in binding process of aptamer and ligand small molecule

Info

Publication number: CN110849863B
Application number: CN201910978373.9A
Authority: CN
Inventors: 陆峰; 崔晓林; 柳艳; 袁一凡; 王梁华; 柴逸峰
Original assignee: Second Military Medical University SMMU
Current assignee: Second Military Medical University SMMU
Priority date: 2019-10-15
Filing date: 2019-10-15
Publication date: 2020-11-24
Anticipated expiration: 2039-10-15
Also published as: CN110849863A

Abstract

The invention relates to the technical field of biological medicines, in particular to a method for quickly and effectively detecting conformational change in the process of combining an aptamer and a ligand small molecule, which comprises the following steps: firstly, determining the affinity between the selected aptamer and the small molecule by using a biological membrane interference experiment; then detecting the conformational change before and after the aptamer is combined with the small molecule by using a surface enhanced Raman scattering spectroscopy technology; and finally, intuitively explaining the binding process of the aptamer and the ligand through molecular dynamics simulation. The invention takes theophylline and an aptamer thereof as an example, verifies the reliability of the method for researching the conformation change of the aptamer, provides a new method and a new thought for designing, modifying and screening the aptamer with high affinity and high selectivity, and leads the aptamer to be better applied to the fields of detection, sensing, clinical diagnosis, treatment and the like.

Description

Method for detecting conformational change in binding process of aptamer and ligand small molecule

Technical Field

The invention relates to the technical field of biological medicines, in particular to a method for quickly and effectively detecting conformation change in the process of combining an aptamer and a ligand small molecule.

Background

The aptamer is usually an oligonucleotide sequence screened from a gene library by SELEX (Systematic Evolution of Ligands by expression) technology. It can be conjugated to corresponding target molecules such as: drugs, proteins, nucleic acids or other inorganic, organic molecules, etc. are bound with high affinity and strong specificity. Meanwhile, the aptamer has the advantages of thermal stability, salt tolerance, easiness in synthesis, low cost and the like, so that the aptamer gradually becomes a hotspot of research in the fields of Detection, sensing, clinic and the like (Negri, P.; Chen, G.; Kage, A.; Nitsche, A.; Naumann, D.; Xu, B.; Dluhy, R.A., Direct Optical Detection of visual nucleic acid Binding an-Influenza aptamer. analytical Chemistry 2012,84,5501 5508). Therefore, the research on the conformation change in the process of combining the aptamer and the small molecule has important significance for designing, modifying and screening the aptamer with high affinity and high selectivity.

Many researchers have shown strong interest in aptamer conformation changes, but most studies have used electrochemical methods to verify aptamer binding to ligand molecules, which is time consuming, requires large sample volumes and is complicated to operate. Therefore, it is urgently needed to establish a rapid, simple and nondestructive method for confirming, detecting and mechanistically explaining the change of aptamer conformation.

The BLI (biofilm interference) technology is a non-labeling means based on the principle of light interference, has the advantages of simple operation, nondestructive detection, low sample consumption, capability of providing direct information and interaction condition of analytes in real time and the like, and is widely applied to the research of the interaction of biomolecules (Gao, S.; Hu, B.; Zheng, X.; Cao, Y.; Liu, D.; Sun, M.; Jiano, B.; Wang, L., Gonyauutoxin 1/4 interaction with high-sensitivity and high-sensitivity: From interference selection to biosensor application, biosensors and Bioelectronics 2016,79,938 and 944.). The BLI technique not only allows rapid analysis of the binding of the supplied ligand to the aptamer, but also gives an accurate value of the affinity of the two. However, the conformational change of the aptamer upon binding to the ligand molecule cannot be detected, and therefore, the conformational change of the aptamer needs to be detected by other means.

The SERS (surface-enhanced Raman spectroscopy) technique has attracted much attention because of its advantages of high sensitivity, abundant characteristic information, and fast detection speed. The kit can provide a detailed fingerprint map of a substance to be detected, and is a powerful tool for detecting molecules such as nucleic acid, protein, cells, viruses and medicines (Morla-Folch, J.; Gisbert-Quilis, P.; Masetti, M.; Garcia-Rico, E.; Alvarez-Puebla, R.A.; Guerrii, L., structural SERS Classification of K-Ras Point Mutations for Cancer diagnostics, Angewandte Chemie 2017,129, 2421-. The weak interaction between molecules can be reflected on the SERS spectrum, so that the conformation change of the aptamer and the ligand molecule after combination can be directly judged. Changes in the SERS spectrum may be attributed to changes caused by which base on the aptamer. However, since the change of the SERS spectrum is also an indirect indicator, how the conformation is changed in particular needs to be further explained by other means.

The MD (molecular dynamics) simulation refers to simulating the movement locus of a molecular system over time by using computer software and taking atoms as basic elements and solving the position and speed of each particle in the system at a certain moment under the action of an empirical potential field according to the newton mechanics principle. MD simulations can simulate the conditions controlled in biological experiments, such as temperature, pressure, ion concentration, pH, and solvent type. All these factors can be adjusted and controlled in the MD simulation (conveyer, J.et al. the impact of molecular dynamics on drug design: applications for the characterization of the characteristics of the ligand-macro-modules. drug Discov Today,2015.20(6): p.686-702.). The method can accurately predict the binding mode and binding capacity of the aptamer and the ligand molecule, and the result can be used for guiding experiments, providing thought and theoretical basis and making up the limitation of experimental means such as spectrum and the like.

However, no report is available about a method for rapidly and effectively detecting the conformational change in the process of binding the aptamer and the ligand small molecule by a sequential analysis mode of a biological membrane interference experiment, a surface enhanced raman spectroscopy technology and molecular dynamics simulation.

Disclosure of Invention

The invention aims to provide a method for rapidly and effectively detecting the conformational change in the process of combining an aptamer and a ligand small molecule. The invention takes theophylline micromolecules and aptamers thereof as examples, researches the change of conformations before and after the binding of the aptamers and the theophylline through a step-by-step analysis mode of biomembrane interference experiment, surface enhanced Raman spectroscopy technology and molecular dynamics simulation, provides a new scheme for designing, screening and modifying the aptamers with high affinity and high selectivity, and can be better applied to the fields of detection, sensing, clinical diagnosis, treatment and the like.

In order to achieve the purpose, the technical scheme of the invention is as follows: firstly, the affinity between the selected aptamer and the ligand molecule is measured by utilizing a BLI (biofilm interference) technology, after the two are determined to be capable of being combined, the conformation change before and after the aptamer is combined with the small molecule is detected by utilizing an SERS (surface-enhanced Raman spectroscopy) method, the spectrogram of the aptamer before and after the aptamer is combined with the small molecule is directly collected, and the conformation change of the aptamer and the reason of the change caused by attribution are determined according to the change before and after the SERS spectrogram. Finally, the binding process of the aptamer and the ligand is intuitively explained by using an MD (molecular dynamics) simulation means, and the spatial change condition of the aptamer in the binding process is deeply analyzed, so that the conformational change of the aptamer can be comprehensively and deeply understood, and the reason for causing the conformational change can be explained.

The invention takes theophylline small molecules and aptamers thereof as examples, and verifies the feasibility and superiority of a step-by-step analysis method of biomembrane interference-surface enhanced Raman spectroscopy-molecular dynamics simulation (BLI-SERS-MD, the principle is shown in figure 1) on researching the conformational change of the aptamers in the binding process.

Theophylline is a methylpurine medicine and is clinically used for treating diseases such as asthma, emphysema and bronchitis. Due to the narrow treatment window (20-100 mu M), the blood concentration of the medicine needs to be monitored during clinical treatment. The blood concentration of the aptamer is measured by a conventional aptamer capturing mode, the specificity is good, the selectivity is high, and the interference of caffeine, theobromine and the like is well eliminated. Therefore, the research on the conformational change in the binding process of the aptamer and theophylline has important significance for designing and modifying an aptamer which has higher affinity and better binding specificity with theophylline. The same technique can also be applied to the analysis of the conformational changes of other ligands and their aptamers.

In a first aspect of the present invention, a method for rapidly and effectively detecting a conformational change during the binding of an aptamer and a small ligand molecule is provided, which comprises the following steps:

the method comprises the following steps: measuring the affinity between the selected aptamer and the ligand molecule by using a biofilm interference (BLI) technology;

step two: the method comprises the following steps of weakly combining an aptamer on a surface-enhanced Raman spectroscopy (SERS for short) substrate by utilizing a SERS technology, collecting spectrograms of the aptamer before and after the aptamer is combined with a ligand small molecule, and determining the change of aptamer conformation and the reason of change caused by attribution according to the change of the SERS spectrogram before and after;

step three: the method comprises the steps of simulating a dynamic process of combining a ligand and an aptamer by using a Molecular Dynamics (MD) simulation means, calculating a motion correlation coefficient of the aptamer and a main group on the ligand, analyzing the space change condition of the aptamer in the combining process, and explaining the cause of conformational change.

Further, the first step is:

firstly, a ligand solution and an aptamer solution are respectively prepared by using buffer solution, then after 200 μ L of each prepared aptamer solution, ligand solution and buffer solution are respectively added into each reaction hole (OctetRED 96, ForteBio company), a chip connected with streptomycin is sequentially immersed into each reaction hole according to a set program, and five stages are carried out in total, wherein each stage takes 60s, and the method comprises the following steps: baseline equilibration, aptamer coupling, sensor equilibration, binding and dissociation, and then the aptamer-ligand affinity constants.

Further, in the second step, in the method for preparing the SERS substrate:

firstly, preparing a silver colloid solution by a Lee method, and then concentrating the obtained silver colloid solution by a method of centrifuging and removing supernatant fluid by about 60 times; adding 5 mu L of 1mM KI solution into 10 mu L of the concentrated silver colloid solution; to the solution was added 4. mu.L of 10mM MgSO₄And (3) solution.

Further, the method for preparing the silver colloid solution by the Lee method comprises the following steps: 36mg of silver nitrate powder is dissolved in 200mL of deionized water, heated and stirred continuously until the solution boils slightly, then 4mL of 1% sodium citrate solution is added, the heating and stirring are continued for about 1h, the solution changes from colorless to grayish green, the heating is stopped, the solution is cooled to room temperature and stored in the dark (reference Lee, P.C.; Meisel, D.Adsorption and surface-enhanced Raman of dye on silver and gold gases. the Journal of Physical Chemistry 1982,86, 3391 and 3395.).

Furthermore, in the second step,

after the aptamer is weakly bonded to the surface of the silver colloid, adding a ligand solution in an equal proportion, adding deionized water into the mixed aptamer-ligand solution, diluting to 100 mu L, and transferring to a 96-well plate to collect SERS signals; the final detection concentration of the substance to be detected was 10. mu.M.

Further, in the third step, the method for simulating the dynamic process of the ligand binding to the aptamer comprises:

firstly, establishing initialization of a simulation system; placing the ligand and aptamer system in a water box with a proper size, selecting SPC/E as a water model, and then carrying out ionization treatment on the system; the force field parameter file of the ligand is generated by AmberTools; then, carrying out energy minimization and balance simulation on the system; the energy minimization uses a steepest descent algorithm, and the simulation is carried out for 500steps under the condition of no constraint; the equilibrium simulation is divided into two steps: the temperature of the system is controlled to be increased from 0K to 300K in the first step, 10000steps are simulated in operation under the constraint condition, the temperature of the system is maintained to be 300K in the second step, and 10000steps are simulated in operation under the constraint condition; finally, simulating 95ns (step length is 2fs) by using the balanced system under the NPT ensemble; controlling the pressure to be 1.01atm and the temperature to be 310K; meanwhile, calculating the RMSD value (root-mean-square deviation) of the aptamer-ligand molecule complex system along with the change of time to estimate the change degree of the conformation before and after the combination of the aptamer-ligand molecule complex system and the ligand molecule complex system; the conformational change process is analyzed by intercepting conformational states of several different frames.

Further, in the third step, the method for calculating the motion correlation coefficient between the aptamer and the main group on the ligand comprises:

adopting gromacs to obtain a PDB file of each frame; respectively reading PDB files of each frame and the mass center coordinate of the next frame, and subtracting the mass center coordinate of the previous frame from the mass center coordinate of the next frame of each nucleotide or theophylline to obtain a movement vector of the mass center coordinate of each frame; then, acquiring a micromolecule centroid coordinate movement vector and a correlation coefficient (Pearson product moment correlation coefficient) of each nucleotide centroid coordinate movement vector by using a numpy. And averaging the motion correlation coefficient of each nucleotide and the small molecule in all the adjacent frames to obtain the average motion correlation coefficient.

Further, the ligand is theophylline, and the aptamer is an RNA sequence shown as SEQ ID NO. 1.

Further, the first step is: buffer (Tris-HCl buffer +10mM MgSO)₄pH 7.4) to prepare 10 mu M theophylline solution and 500nM aptamer RNA (5' end is connected with biotin) solution, wherein all RNA solutions are prepared at present and stored in an ice box to prevent degradation; then, after the prepared aptamer solution and 200 μ L of theophylline are respectively added into each reaction hole, the chip connected with streptomycin is sequentially immersed into each reaction hole according to a set program, and five stages are carried out, wherein each stage takes 60s, and the method comprises the following steps: baseline balance, aptamer coupling, sensor balance, binding and dissociation; then the response value of the aptamer-theophylline can be obtained.

The invention selects an RNA sequence with high reported affinity with theophylline as an aptamer (5'-GGCGAUACCAGCCGAAAGGCCCUUGGCAGCGUC-3', SEQ ID NO.1), verifies the affinity of the two by using BLI technology, and obtains a specific affinity value (K)_d＝1.29μM)。

Furthermore, the second step is: first, a silver colloid solution was prepared by Lee method, and the obtained silver colloid solution was concentrated by 60 times by centrifugation and supernatant removal, 5. mu.L of 1mM KI solution was added to 10. mu.L of the concentrated silver colloid solution, and 4. mu.L of 10mM MgSO 2 was added to the solution₄A solution; after the aptamer is weakly combined on the surface of the silver colloid, 100 mu M theophylline solution is added in an equal ratio; adding the mixed aptamer-theophylline solutionAdding deionized water, diluting to 100 mu L, and transferring to a 96-well plate to collect SERS signals; the final detection concentration of the substance to be detected is 10 mu M; SERS detection conditions: all spectra were obtained from a BWS415 Raman spectrometer (B)&W Tek, USA), the excitation wavelength is 785nm, the laser power is 100mW, and the integration time is 10 s.

The invention provides the change of an SERS spectrogram caused by the change of aptamer conformation due to the entry of theophylline after the aptamer is combined with the theophylline. The existence of interaction between the two is directly proved, and the base species causing the conformational change can be assigned through the changed peak displacement in the SERS spectrogram.

Furthermore, the third step is:

(A) dynamic process of combining MD simulation theophylline and aptamer

Firstly, establishing initialization of a simulation system; placing the theophylline and aptamer system in a water box with proper size (the distance from the surface of the compound to the boundary of the water box is

) Selecting SPC/E as a water model, and then carrying out ionization treatment on the system; the force field parameter file of theophylline is generated by AmberTools; then, carrying out energy minimization and balance simulation on the system; the energy minimization uses a steepest descent algorithm, and the simulation is carried out for 500steps under the condition of no constraint; the equilibrium simulation is divided into two steps: the temperature of the system is controlled to be increased from 0K to 300K in the first step, 10000steps are simulated in operation under the constraint condition, the temperature of the system is maintained to be 300K in the second step, and 10000steps are simulated in operation under the constraint condition; finally, simulating 95ns (step length is 2fs) by using the balanced system under the NPT ensemble; controlling the pressure to be 1.01atm and the temperature to be 310K; calculating the RMSD value (root-mean-square deviation) of the aptamer-theophylline molecular complex system along with the change of time to estimate the change degree of the conformation before and after the combination of the aptamer-theophylline molecular complex system and the theophylline molecular complex system; intercepting the conformational states of a plurality of different frames, and analyzing the conformational change process;

(B) calculating the motion correlation coefficient of the aptamer and the main group on theophylline

Adopting gromacs to obtain a PDB file of each frame; respectively reading PDB files of each frame and the mass center coordinate of the next frame, and subtracting the mass center coordinate of the previous frame from the mass center coordinate of the next frame of each nucleotide or theophylline to obtain a movement vector of the mass center coordinate of each frame; then, acquiring a micromolecule centroid coordinate movement vector and a correlation coefficient (Pearson product moment correlation coefficient) of each nucleotide centroid coordinate movement vector by using a numpy. Averaging the motion correlation coefficients of each nucleotide and the small molecules in all adjacent frames to obtain an average motion correlation coefficient; the motion correlation coefficients of 33 bases on the aptamer and N-1, N-3, N-7, N-9, C ═ O-2, C ═ O-6, CH3-1, CH3-3, the pyrimidine ring and the imidazole ring on theophylline are calculated respectively, and the closer the motion correlation coefficient is to 1, the closer the motion correlation coefficient is, the closer the motion correlation between the two is, the certain interaction can exist.

The invention simulates the dynamic process of combining the aptamer and theophylline and deeply explains the change of the aptamer. By performing MD simulation on the aptamer and theophylline, the binding mode and the binding capacity of the theophylline and the aptamer can be obtained, and a series of changes of the aptamer conformation can be visually and dynamically displayed. In combination with the above experimental results, we can have a thorough understanding of the conformational changes of aptamers.

The invention has the advantages that:

1. compared with the traditional method for analyzing the conformational change of the aptamer by only one method, the method for analyzing the conformational change step by step can comprehensively analyze, confirm and explain the mechanism of the conformational change;

2. the three selected BLI-SERS-MD technical means do not need complex operation, the required amount of samples is small, and the cost is low;

3. although the three methods are a gradual and deep process for researching the conformation of the aptamer, the instruments work independently without interference and can be carried out simultaneously, and the time is greatly saved.

Drawings

FIG. 1 is a schematic view of the principle

FIG. 2 shows the binding dissociation curves of aptamer RNA and negative control NC with theophylline, respectively.

FIG. 3.a SERS spectrum of theophylline; b, SERS spectrogram of aptamer RNA; c SERS spectrogram of theophylline-aptamer complex; d difference spectrum (c-b).

FIG. 4.a SERS spectra of negative control NC; b, SERS spectrogram of aptamer RNA; c, SERS spectrogram of theophylline; d SERS spectrogram of NC; SERS spectrogram of the e theophylline-NC mixture; f difference spectrum (e-d).

FIG. 5 shows the process of conformational change of aptamer binding to theophylline.

FIG. 6 is a kinetic correlation coefficient of 33 bases on aptamer RNA with the main atom or group on theophylline.

Detailed Description

The following examples are provided to illustrate specific embodiments of the present invention. The following examples are carried out on the premise of the technical scheme of the present invention, and detailed embodiments are given, but the scope of the present invention is not limited to the following examples, and reagents used are commercially available unless otherwise specified.

Example 1: determination of affinity between small molecules of theophylline and its aptamer RNA by BLI

The affinity between theophylline small molecule and its aptamer is determined by BLI technique, and at the same time, one RNA sequence (NC: UUGUACUACACAAAAGUACUG, SEQ ID NO.2) with 21 bases is randomly selected as negative control to react with theophylline, and its affinity constant K is determined under the same condition as that of aptamer_dThe value is obtained.

First, buffer (Tris-HCl buffer +10mM MgSO)₄pH 7.4) to prepare 10 mu M theophylline solution, 500nM aptamer RNA (5 'end is connected with biotin) solution and 500nM NC (5' end is connected with biotin) solution respectively, wherein all the RNA solutions are prepared at present and stored in an ice box to prevent degradation. Then adding 200 mul of prepared aptamer solution, NC solution, theophylline and buffer solution into each reaction hole respectively, and then sequentially immersing the chip connected with the streptomycin into each reaction hole according to a set program, wherein the total time of five stages is 60s, and the steps comprise: baseline balance, aptamer coupling, sensor balance, binding and dissociation. Then the response of aptamer-theophylline and NC-theophylline can be obtainedThe value should be. The results are shown in FIG. 2. The binding-dissociation curve of the aptamer and the theophylline is a process of rapid rising and rapid falling, because the molecular weight of the theophylline is too small, the affinity with the aptamer is high, and the binding process and the dissociation process can quickly reach equilibrium. The combination-dissociation curve of NC and theophylline is almost a straight line, which indicates that no affinity exists between the randomly selected nucleic acid sequence and theophylline, namely NC does not interact with theophylline. We obtained the affinity constant K of the theophylline-aptamer_d1.29 μ M, while the theophylline-NC affinity constant is almost zero.

Example 2: weak binding of aptamer RNA to SERS substrates

Firstly, a silver colloid solution is prepared by a Lee method (Lee, P.C.; Meisel, D.Adorption and surface-enhanced Raman of dye on silver and gold gases. the Journal of Physical Chemistry 1982,86, 3391-3395.) and the obtained silver colloid solution is concentrated by a method of centrifuging and removing supernatant liquid by about 60 times, thereby enhancing the Raman signal of a substance to be detected. However, while the silver colloid is concentrated, impurities on the surfaces of silver nano particles (AgNPs) are also enriched, and strong Raman signals are shown and even exceed the signals of substances to be detected. Therefore, we added 5 μ L of 1mM KI solution to 10 μ L of the concentrated silver colloid solution for washing the citrate ions on the surface of the silver nanoparticles and making the surface of the silver nanoparticles strongly negatively charged (AgNP-I)^-). However, the aptamer RNA of the substance to be detected also enables the whole molecule to present electronegativity due to the existence of a large number of phosphate groups on the chain skeleton. The strong electrostatic repulsion causes the aptamer RNA to fail to reach the surface of the silver colloid. To eliminate this blockage, we added 4. mu.L of 10mM MgSO to the solution₄And (3) solution. Mg (magnesium)²⁺Not only plays a role of connecting the aptamer and the silver nano-particles, but also promotes the combination of the aptamer and theophylline (AgNP-I)^--Mg²⁺-PO^2-). At the moment, the aptamer RNA and the silver nanoparticles are weakly combined together through electrostatic interaction, so that the aim of shortening the distance between the aptamer RNA and the silver nanoparticles is fulfilled, a higher detection signal is obtained, and the aptamer is prevented from being directly fixed on a silver colloid meter through a linker such as polysaccharide or alkanethiolAnd the surface limits the space extensibility and flexibility of the aptamer.

Example 3: changes in SERS spectra before and after aptamer binding to theophylline

After the aptamers were weakly bound to the surface of the silver colloid, 100 μ M theophylline solution was added at equal ratio. In the presence of Mg²⁺The theophylline and the aptamer are mutually induced and combined, and the theophylline molecule has small mass and volume compared with the aptamer, so that the conformation of the theophylline molecule is unchanged in the combination process of the theophylline molecule and the aptamer, the conformation of the aptamer is continuously changed to adapt to the entry of the theophylline, and finally the stable state is achieved. At this time, the mixed aptamer-theophylline solution is added into deionized water, diluted to 100 μ L, and transferred to a 96-well plate to collect SERS signals. The final detection concentrations of the substances to be detected were all 10. mu.M, and the results are shown in FIG. 3. The characteristic peak of theophylline disappears after the theophylline is combined with the aptamer and is completely covered by the aptamer. The complex pattern was very similar to the aptamer pattern, only at 510,571,686,1295, and 1577cm^-1The peaks at five positions are clearly different and can be considered to be caused by the conformational change of the aptamer.

SERS detection conditions: all spectra were acquired by a BWS415 Raman spectrometer (B & W Tek, USA) instrument with an excitation wavelength of 785nm, laser power of 100mW, and integration time of 10 s.

Example 4: change of SERS spectrogram before and after theophylline and negative control NC reaction

And (3) weakly combining the randomly selected RNA sequence NC to the surface of the silver colloid under the same condition as the aptamer, then fully reacting with theophylline, and finally collecting the SERS spectrum. The results are shown in FIG. 4. As can be seen from fig. 4A, although both aptamers and NCs are nucleic acid sequences, SERS techniques can distinguish well between different RNA sequences. Meanwhile, since there is no affinity between theophylline and NC, theophylline does not interact with the aptamer when added to the aptamer solution, so that the conformation of NC does not change, so that the profile of the theophylline-NC mixture is almost the same as the profile of NC alone (see fig. 3d, 3 e).

SERS detection conditions were the same as in example 3.

Example 5: dynamic process of combining MD simulation theophylline and aptamer

The initialization of the simulation architecture is first established. Placing the theophylline and aptamer system in a water box with proper size (the distance from the surface of the compound to the boundary of the water box is

) And selecting SPC/E as a water model, and then ionizing the system. The force field parameter file for theophylline was generated by AmberTools. The system was then subjected to energy minimization and equilibrium simulations. Energy minimization Using the steepest descent algorithm, simulations were run at 500steps without constraints. The equilibrium simulation is divided into two steps: the temperature of the system is controlled to be increased from 0K to 300K in the first step, 10000steps are simulated in operation under the constraint condition, the temperature of the system is maintained to be 300K in the second step, and 10000steps are simulated in operation under the constraint condition. Finally, the balanced system is used to simulate 95ns (step size is 2fs) under the NPT ensemble. The pressure is controlled at 1.01atm and the temperature is controlled at 310K. Meanwhile, the RMSD (root-mean-square deviation) of the aptamer-theophylline molecular complex system along with the change of time is calculated to estimate the change degree of the conformation before and after the combination of the aptamer-theophylline molecular complex system and the theophylline molecular complex system. We also analyzed the conformational change process by intercepting conformational states at several different frame numbers, and the results are shown in fig. 4. When theophylline is close to the aptamer, the aptamer allows the theophylline to enter by changing the self spatial conformation, the conformation of the aptamer is continuously changed after the theophylline enters and reacts with certain basic groups on the aptamer, and finally the lowest energy state is achieved so as to maintain the stable existence of the complex.

Example 6: calculating the motion correlation coefficient of the aptamer and the main group on theophylline

And obtaining the PDB file of each frame by using gromacs. The centroid coordinates of each nucleotide and theophylline in each frame of the PDB file are written down, saved as — 'frame number' _ c. And respectively reading PDB files of each frame and the next frame of barycentric coordinates, and subtracting the barycentric coordinates of the previous frame from the next frame of barycentric coordinates of each nucleotide or theophylline to obtain the motion vector of the barycentric coordinates of each frame. Then, using numpy.corrcoef () command in python to obtain the correlation coefficient (pearson product moment correlation coefficient) of the small molecule centroid coordinate movement vector and each nucleotide centroid coordinate movement vector, and recording the correlation coefficient as a motion correlation coefficient. And averaging the motion correlation coefficient of each nucleotide and the small molecule in all the adjacent frames to obtain the average motion correlation coefficient. The kinetic correlation coefficients of 33 bases on the aptamer and N-1, N-3, N-7, N-9, C ═ O-2, C ═ O-6, CH3-1, CH3-3, the pyrimidine ring, and the imidazole ring on theophylline were calculated, respectively, to obtain the data of table 1, and the data of table 1 was converted into fig. 5. The closer the motion correlation coefficient is to 1, the closer the motion correlation coefficient is, the interaction may exist.

As can be seen from FIG. 5, the major groups or atoms on theophylline have high kinematic correlation with the bases C9, G11, C20, C21 and G25 on the aptamer, which indicates that when theophylline enters the inside of the aptamer, the bases on the aptamer react with theophylline, so that the conformation of the aptamer is changed to maintain the stability of the theophylline-aptamer complex.

TABLE 1 specific values for the kinematic correlation coefficient of 33 bases on aptamer RNA to the main atom or group on theophylline

While the preferred embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that the invention is not limited thereto, and that various changes and modifications may be made without departing from the spirit of the invention, and the scope of the appended claims is to be accorded the full range of equivalents.

Sequence listing

<110> second military medical university of China people liberation army

<120> a method for rapidly and effectively detecting conformation change in the process of combining aptamer and ligand small molecule

<130> /

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 33

<212> RNA

<213> Artificial sequence (Artificial)

<400> 1

ggcgauacca gccgaaaggc ccuuggcagc guc 33

<210> 2

<211> 21

<212> RNA

<213> Artificial sequence (Artificial)

<400> 2

uuguacuaca caaaaguacu g 21

Claims

1. A method for rapidly and effectively detecting the conformational change in the binding process of an aptamer and a ligand small molecule is characterized by comprising the following steps:

the method comprises the following steps: measuring the affinity between the selected aptamer and the ligand micromolecule by utilizing a biomembrane interference technology, and detecting the aptamer and the ligand micromolecule after determining that the aptamer and the ligand micromolecule can be combined; the ligand is theophylline, and the aptamer is an RNA sequence shown as SEQ ID NO. 1;

step two: weakly combining the aptamer on an SERS substrate by a surface enhanced Raman spectroscopy technology, collecting spectrograms of the aptamer before and after the aptamer is combined with small molecules of the ligand, and determining the change of the conformation of the aptamer and the reason of the change caused by attribution according to the change of the aptamer before and after the SERS spectrogram; the method specifically comprises the following steps: firstly, preparing a silver colloid solution by a Lee method, concentrating the obtained silver colloid solution by a method of centrifuging and removing supernatant, adding a KI solution into the concentrated silver colloid solution, and adding MgSO (MgSO) into the solution₄A solution; weakly binding aptamer toAdding theophylline solution in equal proportion after the surface of the silver colloid; adding deionized water into the mixed aptamer-theophylline solution for dilution, and transferring the diluted aptamer-theophylline solution to a 96-well plate to collect SERS signals;

step three: simulating the dynamic process of combining the ligand and the aptamer by using a molecular dynamics simulation means, calculating the motion correlation coefficient of the aptamer and the main group on the ligand, analyzing the space change condition of the aptamer in the combining process, and explaining the reason causing the conformation change; the third step is as follows:

(A) molecular dynamics simulation of dynamic process of theophylline and aptamer combination

Firstly, establishing initialization of a simulation system; placing the theophylline and aptamer system in a water box with a proper size, wherein the distance from the surface of the compound to the boundary of the water box is 15A, an SPC/E is selected as a water model, and then ionizing the system; the force field parameter file of theophylline is generated by AmberTools; then, carrying out energy minimization and balance simulation on the system; the energy minimization uses a steepest descent algorithm, and the simulation is carried out for 500steps under the condition of no constraint; the equilibrium simulation is divided into two steps: the temperature of the system is controlled to be increased from 0K to 300K in the first step, 10000steps are simulated in operation under the constraint condition, the temperature of the system is maintained to be 300K in the second step, and 10000steps are simulated in operation under the constraint condition; finally, simulating 95ns by using the balanced system under the NPT ensemble, wherein the step length is 2 fs; controlling the pressure to be 1.01atm and the temperature to be 310K; calculating the RMSD value of the aptamer-theophylline molecular complex system along with the change of time to estimate the change degree of the conformation before and after the combination of the aptamer-theophylline molecular complex system and the theophylline molecular complex system; intercepting the conformational states of a plurality of different frames, and analyzing the conformational change process;

Adopting gromacs to obtain a PDB file of each frame; respectively reading PDB files of each frame and the mass center coordinate of the next frame, and subtracting the mass center coordinate of the previous frame from the mass center coordinate of the next frame of each theophylline to obtain a movement vector of the mass center coordinate of each frame; then, acquiring a micromolecule centroid coordinate moving vector and a Pearson product moment correlation coefficient of each nucleotide centroid coordinate moving vector by using a numpy. Averaging the motion correlation coefficients of each nucleotide and the small molecules in all adjacent frames to obtain an average motion correlation coefficient; the motion correlation coefficients of 33 bases on the aptamer and N-1, N-3, N-7, N-9, C = O-2, C = O-6, CH3-1, CH3-3, the pyrimidine ring and the imidazole ring on the theophylline are respectively calculated, and the closer the motion correlation coefficient is to 1, the closer the motion correlation coefficient is, the more closely the motion correlation between the two is, and certain interaction can exist.

2. The method for rapid and efficient detection of conformational changes during aptamer-ligand small molecule binding according to claim 1, wherein the first step is: firstly, respectively preparing a ligand solution and an aptamer solution by using buffer solution, then respectively adding 200 mu L of the prepared aptamer solution, ligand solution and buffer solution into each reaction hole, sequentially immersing a chip connected with streptomycin into each reaction hole according to a set program, and totally going through five stages, wherein each stage takes 60s, and the method comprises the following steps: baseline equilibration, aptamer coupling, sensor equilibration, binding and dissociation, and then the aptamer-ligand affinity constants.

3. The method for rapid and efficient detection of conformational change during the binding of an aptamer and a small molecule ligand according to claim 1, wherein the solution of silver colloid in step two is concentrated by a factor of about 60; the concentration of the KI solution is 1 mM; the MgSO₄The solution concentration was 10 mM.

4. The method for rapidly and effectively detecting the conformational change in the process of binding an aptamer and a ligand small molecule according to claim 1, wherein the method for preparing the silver colloid solution by the Lee method comprises the following steps: dissolving 36mg of silver nitrate powder in 200mL of deionized water, heating and continuously stirring until the solution slightly boils, then adding 4mL of 1% sodium citrate solution, continuously heating and stirring for about 1h, changing the solution from colorless to grey green, stopping heating, cooling to room temperature, and storing in dark place.

5. The rapid prototyping machine of claim 1The method for effectively detecting the conformational change in the process of combining the aptamer and the ligand small molecule is characterized in that the first step is as follows: respectively preparing 10 mu M theophylline solution and 500nM aptamer RNA solution by using buffer solution with pH 7.4, wherein the buffer solution is Tris-HCl buffer +10mM MgSO₄All RNA solutions are prepared at present and stored in an ice box to prevent degradation; then, after the prepared aptamer solution and 200 μ L of theophylline are respectively added into each reaction hole, the chip connected with streptomycin is sequentially immersed into each reaction hole according to a set program, and five stages are carried out, wherein each stage takes 60s, and the method comprises the following steps: baseline balance, aptamer coupling, sensor balance, binding and dissociation; then the response value of the aptamer-theophylline can be obtained.

6. The method for rapidly and effectively detecting the conformational change during the binding process of an aptamer and a ligand small molecule according to claim 1, wherein the SERS detection conditions in the second step are as follows: all spectra were acquired by a BWS415 Raman spectrometer with an excitation wavelength of 785nm, laser power of 100mW, and integration time of 10 s.