CN110846407A

CN110846407A - Probe library, detection method and kit for detecting effectiveness of DNA nucleotide excision repair pathway

Info

Publication number: CN110846407A
Application number: CN201911239846.XA
Authority: CN
Inventors: 刘松柏; 杜佳慧
Original assignee: Suzhou Vocational Health College
Current assignee: Suzhou Vocational Health College
Priority date: 2019-12-06
Filing date: 2019-12-06
Publication date: 2020-02-28
Also published as: CN112375820A

Abstract

The invention provides a probe library, a detection method and a kit for detecting effectiveness of a DNA nucleotide excision repair path, wherein the probe library consists of probes shown in SEQ ID NO. 1-298, and the detection kit prepared from the probe library can be used for detecting genes related to the DNA nucleotide excision repair path. The probe library is used for enriching target DNA fragments to be analyzed, and then sequencing is carried out on the enriched DNA fragments through a sequencing means, so that the effectiveness of gene detection is realized. The gene related to the DNA nucleotide excision repair pathway can be used for predicting the occurrence tendency of tumors, evaluating the malignancy degree and clinical prognosis of the tumors and guiding the screening and research and development of new drugs, so the invention has important guiding significance on the research direction of gene functionality.

Description

Probe library, detection method and kit for detecting effectiveness of DNA nucleotide excision repair pathway

Technical Field

The invention belongs to the technical field of gene detection, and particularly relates to a probe library, a detection method and a kit for detecting effectiveness of a DNA nucleotide excision repair pathway.

Background

The abnormal DNA damage repair pathway is closely related to the occurrence tendency of tumors and neurological diseases and the sensitivity of DNA damage inducing antitumor drugs to cells. The DNA nucleotide excision repair pathway mainly repairs nucleotide damaged by endogenous oxygen free radicals, DNA intrastrand cross-linking damage caused by ultraviolet irradiation, and DNA damage caused by alkylating agent antitumor drugs such as cisplatin, and is one of the most important ways in a DNA repair mechanism. The repair process is divided into two modes of genome-wide nucleotide excision repair (GG-NER) and transcription-accompanied nucleotide excision repair (TC-NER), and the two repair processes are basically the same except that the recognition mode of the damage site is different. In the GG-NER pathway, XPC as a damage sensing element forms a complex with RAD23B and CETN2 protein with the help of UV-DDB complex and continuously searches for a damage site, and RAD23B is separated from the complex when the XPC complex is combined at the DNA damage site. In the TC-NER pathway, recognition of the lesion site is indirectly accomplished by the RNA polymerase Pol II arresting transcription after encountering the lesion site during transcription. During transcription, RNApol II forms a functional complex with UVSSA, USP7 and CSB, and when a damage site is encountered and transcription stops, RNA Pol II forms a complex with CSA-CSB and causes reverse translocation of RNA Pol II, which provides space for repair of DNA damage. After the DNA damage site is recognized, the transcription initiation factor TFIIH complex is recruited to the damage site, and the CAK sub-complex is detached therefrom. The TFIIH complex then uses its helicase activity to unwind the double helix structure near the lesion, the single-stranded DNA binding protein RPA seals the single-stranded non-damaged DNA, and XPF-ERCC1 is recruited to cleave the 5 'end of the lesion site, after which XPG cleaves the 3' end of the lesion site using endonuclease activity, creating a cleavage gap of 22-30 nucleotides. And then, directly loading the PCNA to the XPF-ERCC1 shearing position, and recruiting a DNA synthesis related protein complex to fill and sew up the gap to finish the damage repair process of the DNA.

Synthetic Lethality (Synthetic Lethality) strategy has been widely used in recent years in the study of tumors. The concept of synthetic lethality in tumor studies is: when the function of two important genes that are not in the same repair pathway is suppressed from one of them, the cell is not lethal, but after the function of both genes is suppressed, the cell is dead. In clinic, if one of the mutations exists in the tumor cells, and the gene is normal in normal cells, the other gene can be used as a target point, and the function of the other gene is inhibited, so that the aims of specifically killing the tumor cells and individually treating the tumor cells are fulfilled.

Early researches show that genetic mutation of a germ line and somatic mutation in specific tissues of genes involved in DNA nucleotide excision repair pathways are highly related to tumor generation and treatment effects, and have a causal relationship with the generation of non-tumor diseases such as neurodevelopmental defect and premature senility. Wherein, the mutation of XPA, XPB, XPC, XPG gene and so on is highly related to the ultraviolet radiation sensitivity, the occurrence of skin cancer; the polymorphism of XPA and XPC genes is highly related to the occurrence of lung cancer and bladder cancer; the polymorphism of the XPG gene is highly related to the sensitivity of tumor chemotherapy; in addition, the ERCC1 gene polymorphism is highly correlated with skin cancer and lung cancer. The mutation of the genes causes the change (attenuation or deletion) of the effectiveness of the DNA nucleotide excision repair pathway, and has important significance for the generation, prognosis and treatment strategy formulation of tumors and neurological diseases.

Disclosure of Invention

The invention aims to provide a probe library, a detection method and a kit for detecting effectiveness of a DNA nucleotide excision repair pathway.

In order to achieve the purpose, the invention provides the following technical scheme:

a kit for detecting effectiveness of a DNA nucleotide excision repair pathway comprises a probe library which is composed of probes shown in SEQ ID NO. 1-298 and aims at genes related to the DNA nucleotide excision repair pathway.

Further, the gene related to the DNA nucleotide excision repair pathway includes LIG1, PCNA, old1, old2, old3, old4, RFC1, RFC2, RFC3, RFC4, RFC5, RPA1, RPA2, RPA3, RPA4, CCNH, CDK 4, CETN 4, CUL 44, CUL4, DDB 4, ERCC4, GTF2H4, MMS 4, MNAT 4, POLE, pool 4, xple 4, xa 4, uvoc 4, RPA4, or rbc 4.

Further, probe sequences corresponding to the gene LIG1 are shown in SEQ ID NO. 1-11, probe sequences corresponding to the gene PCNA are shown in SEQ ID NO. 12-15, probe sequences corresponding to the gene POLD1 are shown in SEQ ID NO. 16-28, probe sequences corresponding to the gene POLD2 are shown in SEQ ID NO. 29-33, probe sequences corresponding to the gene POLD3 are shown in SEQ ID NO. 34-37, probe sequences corresponding to the gene POLD4 are shown in SEQ ID NO. 38-40, probe sequences corresponding to the gene RFC1 are shown in SEQ ID NO. 41-50, probe sequences corresponding to the gene RFC2 are shown in SEQ ID NO. 51-54, probe sequences corresponding to the gene RFC3 are shown in SEQ ID NO. 55-58, probe sequences corresponding to the gene RFC4 are shown in SEQ ID NO. 59-62, probe sequences corresponding to the gene RFC5 are shown in SEQ ID NO. 63-65, and probe sequences corresponding to RPA1 are shown in SEQ ID NO. 71-71, the probe sequence corresponding to the gene RPA2 is shown as SEQ ID NO. 72-75, the probe sequence corresponding to the gene RPA3 is shown as SEQ ID NO. 76-78, the probe sequence corresponding to the gene RPA4 is shown as SEQ ID NO. 79-80, the probe sequence corresponding to the gene CCNH is shown as SEQ ID NO. 81-83, the probe sequence corresponding to the gene CDK7 is shown as SEQ ID NO. 84-86, the probe sequence corresponding to the gene CETN2 is shown as SEQ ID NO. 87-90, the probe sequence corresponding to the gene CUL3 is shown as SEQ ID NO. 91-98, the probe sequence corresponding to the gene CUL4A is shown as SEQ ID NO. 99-106, the probe sequence corresponding to the gene CUL5 is shown as SEQ ID NO. 107-114, the probe sequence corresponding to the gene DDB1 is shown as SEQ ID NO. 115-127, the probe sequence corresponding to the gene DDB2 is shown as SEQ ID NO. 128-1, and the probe sequence corresponding to SEQ ID NO.132, the probe sequence corresponding to the gene ERCC2 is shown as SEQ ID NO. 135-144, the probe sequence corresponding to the gene ERCC3 is shown as SEQ ID NO. 145-150, the probe sequence corresponding to the gene ERCC4 is shown as SEQ ID NO. 151-156, the probe sequence corresponding to the gene ERCC5 is shown as SEQ ID NO. 157-165, the probe sequence corresponding to the gene ERCC6 is shown as SEQ ID NO. 166-177, the probe sequence corresponding to the gene ERCC8 is shown as SEQ ID NO. 178-181, the probe sequence corresponding to the gene GTF2H1 is shown as SEQ ID NO. 182-188, the probe sequence corresponding to the gene GTF2H2 is shown as SEQ ID NO. 189-177, the probe sequence corresponding to the gene GTF2H3 is shown as SEQ ID NO. 198-202, the probe sequence corresponding to the gene GTF2H4 is shown as SEQ ID NO.203, the probe sequence corresponding to the gene GTF2H 3876 is shown as SEQ ID NO. 48325, the probe sequence corresponding to SEQ ID NO. 220, the probe sequence corresponding to the gene MNAT1 is shown as SEQ ID NO. 221-223, the probe sequence corresponding to the gene POLE is shown as SEQ ID NO. 224-246, the probe sequence corresponding to the gene POLE2 is shown as SEQ ID NO. 247-250, the probe sequence corresponding to the gene POLE3 is shown as SEQ ID NO. 251-253, the probe sequence corresponding to the gene POLE4 is shown as SEQ ID NO. 254-255, the probe sequence corresponding to the gene RAD23A is shown as SEQ ID NO. 256-258, the probe sequence corresponding to the gene RAD23B is shown as SEQ ID NO. 259-262, the probe sequence corresponding to the gene RBX1 is shown as SEQ ID NO.263, the probe sequence corresponding to the gene TCEA1 is shown as SEQ ID NO. 264-266-258, the probe sequence corresponding to the gene ELOC is shown as SEQ ID NO.267, and the probe sequence corresponding to the ELOB is shown as SEQ ID NO. 271; the probe sequence corresponding to the gene UVSSA is shown as SEQID NO. 272-277; the probe sequence corresponding to the gene XAB2 is shown as SEQ ID NO. 278-286; the probe sequence corresponding to the gene XPA is shown as SEQ ID NO. 287-289; the probe sequence corresponding to the gene XPC is shown in SEQ ID NO. 290-298.

A method of detecting a gene associated with a DNA nucleotide excision repair pathway comprising the steps of:

(1) obtaining a DNA sample library of a subject;

(2) hybridizing all probes shown as SEQ ID NO. 1-298 in the kit of claim 1 with the DNA sample library;

(3) and (3) separating the hybridization product in the step (2), releasing the gene segment hybridized with the probe in the kit, and sequencing the separated gene segment by adopting a sequencing technology so as to detect the mutation condition of the gene.

Further, the DNA sample library in the step (1) is composed of double-stranded DNA fragments;

the step (1) comprises the following steps: extracting whole genome DNA, and then fragmenting the whole genome DNA; or mRNA is extracted, fragmented, and then double-stranded cDNA is synthesized using the fragmented mRNA as a template.

Further, the probe in the step (2) is selectively labeled.

Further, the probe in the step (2) is labeled with biotin.

Has the advantages that: the invention develops a probe library, a detection method and a kit for detecting the effectiveness of a DNA nucleotide excision repair pathway, which mainly have the following meanings:

1. by analyzing the variation condition of the DNA nucleotide excision repair pathway participating in the gene, the effectiveness (attenuation or deletion) of the DNA nucleotide excision repair pathway in human tissues or cells is evaluated, the occurrence tendency of tumors and neurological diseases is predicted, and patients are guided to take corresponding preventive measures.

2. The effectiveness (attenuation or deletion) of the DNA nucleotide excision repair channel in the cells of the tumor patients is evaluated by analyzing the variation condition of the DNA nucleotide excision repair channel participating in the gene, and the method has important guiding significance for the evaluation of the malignancy degree and the clinical prognosis of the tumor.

3. The effectiveness (attenuation or deletion) of the DNA nucleotide excision repair pathway in cells of tumor patients is evaluated by analyzing the variation condition of the DNA nucleotide excision repair pathway participating in genes, and the method has important guiding significance for the selection of radiation and chemotherapy drugs and the formulation of treatment strategies (such as synthetic lethal schemes and the like).

4. The effectiveness (weakening or deletion) of the DNA nucleotide excision repair channel in the cells of the tumor patients is evaluated by analyzing the variation condition of the DNA nucleotide excision repair channel participating in the gene, and the method has important guiding significance for the selection of new therapeutic targets, the research and development of targeted drugs and the like.

Drawings

FIG. 1 is a flow chart of the detection method of the present invention.

Detailed Description

The present invention is further described below with reference to specific examples, which are only exemplary and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

The invention provides a method for repairing a gene related to a pathway by DNA base excision, which mainly comprises the following steps:

(1) obtaining a DNA sample library of a subject; extracting whole genome DNA, and then fragmenting the whole genome DNA; or extracting mRNA, fragmenting the mRNA, and synthesizing double-stranded cDNA by using the fragmented mRNA as a template;

(2) designing a DNA probe hybridized with the gene aiming at the gene segment to be detected, and screening a plurality of probes from the DNA probe library as a DNA probe library;

(3) hybridizing the DNA probe library with the DNA sample library, and enriching the DNA sample library to obtain a DNA fragment of the gene to be detected;

(4) and (4) separating the hybridization product in the step (3), releasing the gene segment hybridized with the probe in the kit, and sequencing the separated gene segment by adopting a sequencing technology so as to detect the mutation condition of the gene.

In the implementation process, each probe in the DNA probe library may be labeled with biotin, and then the magnetic beads labeled with streptavidin are used to adsorb the hybridization product after hybridization, releasing the enriched gene fragment to be detected from the magnetic beads, and then sequencing the gene fragment.

The specific experimental process is as follows:

first, prepare cDNA/DNA sample library

1. Preparation of DNA sample library

1.1 DNA extraction

Human genome DNA is extracted by a commercial DNA extraction kit, and the quality and the concentration of a DNA template are detected by a spectrophotometry and a gel electrophoresis system for the extracted DNA. The absorbance of the DNA template at 260nm is more than 0.05, and the ratio of the absorbance A260/A280 is between 1.8 and 2, which is qualified.

1.2 DNA fragmentation

Mu.g of qualified genomic DNA was diluted to 100. mu.L with TE buffer. And (3) fragmenting the DNA by using a tissue homogenizer, wherein the fragment length is 150-200 bases.

The DNA was purified using a commercial purification kit.

1.3 quality testing of DNA sample libraries

And (5) carrying out qualitative and quantitative analysis on the DNA by using a biological analyzer, and determining that the length peak value of the DNA fragment is reasonable.

2. Preparation of cDNA sample library

2.1 mRNA extraction

Human mRNA is extracted by adopting a commercial mRNA extraction kit, and the quality and the concentration of the extracted mRNA are detected by using a spectrophotometry and a gel electrophoresis system. The absorbance A260/A280 ratio is between 1.8 and 2.

2.2 fragmentation of mRNA

Fragmenting mRNA by using a commercial kit; the mRNA was purified by column chromatography using a commercial kit.

2.3 Synthesis of first and second Strand cDNA of mRNA Using a commercial reagent cDNA Synthesis kit

The cDNA was purified by column chromatography using a commercial kit.

3. cDNA/DNA end repair

The DNA fragment is end-repaired using Klenow fragment, T4 DNA polymerase and T4 polynucleotide kinase, since Klenow fragment has 5 '-3' polymerase activity and 3 '-5' polymerase activity, but lacks 5 '-3' exonuclease activity. Therefore, the DNA fragment can be conveniently and accurately subjected to end repair. And (4) carrying out column purification on the repaired DNA fragment.

The cDNA/DNA was filled in at the 5 'protruding sticky ends and blunt-ended at the 3' protruding sticky ends using T4 polymerase and Klenow E.coli polymerase fragments to generate blunt ends for subsequent blunt end ligation. The reaction was carried out in a PCR amplification apparatus at 20 ℃ for 30 min.

TABLE 1

4. Adding base A to the 3' end of cDNA/DNA sample

A DNA fragment having a cohesive end A was obtained by adding a base A to the 3' -end of the end-repaired DNA fragment using Klenow having 3' -5 ' exonuclease activity, and the reaction was carried out in a PCR amplification apparatus at 37 ℃ for 30 min. The treated DNA fragment was subjected to column purification.

TABLE 2

5. Adding linkers at both ends of cDNA/DNA

TABLE 3

6. Isolating cDNA fragments of appropriate length

The DNA fragments were separated using an electrophoresis gel, and 150-and 250-base cDNA fragments were excised on the gel in accordance with the DNA molecular weight.

Gel samples containing the cDNA library were column purified using a commercial kit.

7. Quality detection of cDNA fragment sample library

And (3) carrying out qualitative and quantitative analysis on the cDNA by using a bioanalyzer, and confirming that the length peak value of the separated cDNA fragment is reasonable.

PCR conditions were as follows: placing in a PCR amplification apparatus, pre-denaturing at 95 deg.C for 10 s, denaturing at 95 deg.C for 30 s, annealing at 65 deg.C for 30 s, extending at 72 deg.C for 1min, co-circulating 20 times (cDNA sample bank) or 5-8 times (DNA sample bank), and finally extending at 72 deg.C for 5 min.

And (3) purifying the PCR amplification product by a column by using a commercial kit.

8. Amplification of DNA templates

And (3) carrying out polymerase chain reaction on the treated DNA sample by using a PCR amplification instrument to increase the content of the DNA so as to meet the requirement of hybridization with the probe.

TABLE 4

9. Quality detection of amplified cDNA/DNA sample library

And (3) carrying out cDNA/DNA qualitative and quantitative analysis by using a bioanalyzer, and confirming that the length peak value of the purified fragment is reasonable and about 200 bp.

Second, design principle of probe

According to a human reference genome HG19, the gene related to the DNA base excision repair pathway and all coding sequences thereof are obtained by combining Ensembl, CCDS, Gencode, VEGA, SNP and CytoBand databases.

The design of the probe has several major considerations:

(1) specificity of

Stringent specificity parameters may be effective in reducing probe binding in non-target regions, but also limit regions of a part of exons that have a lower degree of reproducibility, resulting in reduced coverage of the probe design. Too loose specificity parameters will directly reduce the amount of data on the target area, resulting in reduced capture efficiency and increased sequencing costs. Therefore, a reasonable specificity parameter is key to balancing coverage and capture efficiency. We consider a probe with a sequence similarity across the genome of no more than 3 as the optimal threshold for specificity parameters.

(2) Stability of binding

The indicators of the binding ability of the probe to the template are the minimum free energy (. DELTA.G) and the melting temperature (Tm), and since these two parameters are somewhat complicated to calculate, the binding ability of the probe to the template is generally indirectly expressed by a more direct and simple GC content. In general, the greater the GC content, the greater the binding stability. In fact, the closer the GC content is to 50% of the probe, the better the capture effect. The higher the GC content, the better the binding ability of the probe to the target DNA fragment is, however, the better the binding ability to the target DNA fragment is to its original complementary fragment (consistent length on the one hand, no mutation mismatch on the other hand), and therefore, the higher the concentration of the probe is needed to promote it to take some advantage in competition for binding to the DNA complementary fragment.

We will prefer to design probes with GC contents close to 50%, and for unavoidable GC extremes we will add modified bases to the probes and thus alter the GC extremes.

(3) Concentration of Probe

As can be seen from the above binding stability, the capture effect of the probes with different binding capacities is greatly different. Too high and too low binding capacity are detrimental to capture, and therefore, different concentrations of probes for different GC contents need to be set in order to maximize uniformity of capture efficiency. Through summarizing historical capture data, different probe concentration parameters are set for probes with different GC contents, the concentration base number of the probe with the GC content of 40-60% is set to be 1, then the concentration base numbers of the probes with the GC contents of 30-40% and 60-70% are 1 x 22, and the concentration base numbers of the probes with the GC contents of 20-30% and 70-80% are 1 x 24.

(4) Position of the probe

1. The optimal probe placement position is 100% coincident with the target region, but due to the effects of randomly interrupted libraries, sequence repeatability, GC content, mutation types, etc., the actual probe design strategy is as follows:

2. since libraries are typically generated by random disruption, to maximize capture of target libraries, probes are typically designed in a tiling fashion;

3. if the target area has a repeated sequence area, the probe design can be extended to two sides to search areas with better specificity under the condition of ensuring the coverage of the target area during design;

4. if the target area is an extreme GC area, in the design process, under the condition of ensuring the coverage of the target area, a probe is designed by extending and searching areas with more proper GC content to two sides;

different design considerations are also required for different mutation types:

1. for insertions or deletions exceeding 60bp, probes need to be designed on both sides of a mutation breakpoint besides the probes need to be covered, and the closer to the breakpoint, the better;

2. for CNV regions exceeding 10 kbp, the optimal probe design strategy is to place sparse probes at intervals, so that on one hand, CNV can be detected, and on the other hand, the sequencing cost can be reduced;

3. for intron regions where fusion occurs, if the fusion site is not defined, then full coverage of the entire intron is required; if the fusion site is defined, probes need to be designed on both sides of the fusion site.

4. For short-chain repeat regions such as MSI and STR, probes need to be designed to extend 60bp on both sides in addition to the probes covering them.

Hybridization of DNA capture probes

1. Hybridization of DNA sample libraries with biotinylated DNA Probe libraries

The cDNA/DNA sample pool was mixed with hybridization buffer at 95 ℃ for 5 minutes, and then maintained at 65 ℃. The reaction was performed in a PCR amplificator.

The mixture was then mixed with a pool of probes at 65 ℃ for 5 minutes. The hybridization reaction was placed in a PCR amplification apparatus and incubated at 65 ℃ for 24 hours.

Fourthly, obtaining the hybridized gene segment

1. Preparation of streptavidin magnetic beads

The separation of the hybridization products was performed using Dynabeads streptavidin magnetic beads. The beads were placed on a homogenizer and mixed, requiring 50. mu.L of beads per sample.

And (3) washing magnetic beads: mixing 50 μ L of magnetic beads and 200 μ L of binding buffer solution, separating and purifying the magnetic beads and the buffer solution by an external magnetic field, discarding the buffer solution, and repeating the steps for three times.

2. Isolation of the hybridization product

The hybridization product was mixed well with streptavidin magnetic beads and shaken for 30 minutes at room temperature. Separating and purifying the magnetic beads by an external magnetic field.

To the beads, 500. mu.L of washing buffer was added, incubated at 65 ℃ for 10 minutes, and the beads were isolated and purified by an external magnetic field. The above steps were repeated three times.

3. cDNA/DNA enrichment sample Release

Mixing the magnetic beads with 50 mu L of elution buffer solution, incubating for 10 minutes at room temperature, separating and discarding the magnetic beads through an external magnetic field, and collecting supernatant, wherein the supernatant is the enriched gene segments related to the DNA base excision repair pathway.

Fifth, PCR amplification and purification

The enriched gene fragments were further amplified in preparation for loading into a sequencing instrument.

TABLE 5

Reactive materials	Volume (μ L)
		Post-adapter cDNA/DNA sample library	20
10 XDNA polymerase buffer	5
		DNA polymerase	1
Joint positive primer	1
		Linker reverse primer	1
Ultrapure water	The total volume is compensated to 50 mu L

Sixthly, detecting gene mutation by adopting next generation sequencing technology

The next generation of commercial sequencing instruments were used for sequencing and the sequencing results were analyzed using the existing sequencing software analysis package.

Example 1 detection of mutations in XPA, ERCC1, POLD1, PCNA, ERCC2 genes

Firstly, constructing a sample library

1. Extraction of DNA

The sample DNA was extracted using a commercial kit according to the conventional DNA extraction method for tissue samples.

2. DNA fragmentation

The DNA sample was fragmented using a DNA fragmenter to a fragment length of 150-200 bp.

3. DNA sample pool quality detection

4. DNA end repair

The DNA was filled in at the 5 'protruding sticky ends and blunt-ended at the 3' protruding sticky ends using T4 polymerase and Klenow E.coli polymerase fragments to generate blunt ends for subsequent blunt end ligation. The reaction system is shown in Table 1, and the reaction is carried out in a PCR amplification instrument at 20 ℃ for 30 min.

5. Adding base A to the 3' end of the DNA sample

The reaction was carried out in a PCR amplification apparatus at 37 ℃ for 30 minutes, and the reaction system is shown in Table 2.

6. Adding linkers at both ends of DNA

The reaction system is shown in Table 3.

7. DNA fragment sample library obtained by amplification

The Polymerase Chain Reaction (PCR) was carried out in a PCR amplification apparatus, and the reaction system is shown in Table 4.

8. Quality detection of amplified DNA sample libraries

And (3) carrying out qualitative and quantitative analysis on the DNA by using a biological analyzer, and confirming that the length peak value of the purified fragment is reasonable and about 200 bp.

If the concentration of the obtained DNA sample library is low, the sample is dried at low temperature (below 45 ℃) by a vacuum concentrator and then dissolved with nuclease-free water to reach the required concentration.

Secondly, preparing a DNA probe library of XPA, ERCC1, POLD1, PCNA and ERCC2 genes

According to the above-mentioned method and idea of designing a probe, a probe having Biotin (Biotin) at the 5' end was designed and synthesized for the test.

Thirdly, hybridizing the DNA sample library with a biotinylated DNA probe library

The DNA pool was mixed with a hybridization buffer (10 mM Tris-HCl, 2% bovine serum albumin, pH 8.0) (after mixing, the concentration of the DNA pool did not exceed 50 ng/. mu.L at most) under reaction conditions of 95 ℃ for 5 minutes, and then maintained at 65 ℃. The reaction was performed in a PCR amplificator.

Then, with a DNA sample library: the probe pool was added to the above mixture at a molar ratio of 1:100 under reaction conditions of 65 ℃ for 5 minutes. The hybridization reaction was placed in a PCR amplification apparatus and incubated at 65 ℃ for 24 hours.

Fourthly, obtaining the hybrid enriched XPA, ERCC1, POLD1, PCNA and ERCC2 gene segments

1. Preparation of streptavidin magnetic beads

Dynabeads streptavidin magnetic beads are placed on a mixing instrument to be mixed uniformly, 50 mu L of magnetic beads and 200 mu L of binding buffer (10 mM Tris-HCl, 2% bovine serum albumin, pH8.0) are mixed uniformly on the mixing instrument, the magnetic beads and the buffer are separated and purified by using an external magnetic field, the buffer is discarded, and the steps are repeated three times, and 200 mu L of binding buffer is added each time.

2. Isolation of the hybridization product

The hybridization reaction mixture in step three was mixed with the treated streptavidin magnetic beads of step four and shaken for 30 minutes at room temperature. The magnetic beads were separated and purified from the buffer using an external magnetic field, and then 500. mu.l of a washing buffer (phosphate buffer, 0.1% Tween-20, 0.1% SDS, pH 7.4) was added to the magnetic beads, incubated at 65 ℃ for 10 minutes, and mixed uniformly every 5 minutes. And separating and purifying the magnetic beads and the buffer solution by using an external magnetic field, and repeating the steps for three times.

3. Release of enriched DNA samples

The beads were mixed with 50. mu.l of elution buffer (10 mM sodium hydroxide solution), incubated at room temperature for 10 minutes, and mixed uniformly every 5 minutes. And separating and purifying the magnetic beads and the buffer solution by using an external magnetic field, reserving supernatant, and discarding the magnetic beads, wherein the supernatant contains the enriched XPA, ERCC1, POLD1, PCNA and ERCC2 gene fragment DNA sample library.

Fifth, PCR amplification and purification

The enriched DNA sample library was further amplified in preparation for loading into a sequencing instrument, and the reaction system is shown in table 5.

Sixthly, verification of detection sensitivity

Mutant and wild type plasmids are constructed aiming at XPA (c.683G > A), ERCC1 (c.796G > C), POLD1 (c.356G > A), PCNA (c.683G > T) and ERCC2 (c.2251A > T) mutations in a channel, samples with different abundances are mixed according to the copy number proportion of the mutant in the wild type, the sensitivity is examined by adopting the probe library for capturing and sequencing, and each sample is repeatedly tested for 3 times, and the results are as follows:

TABLE 6

Gene to be tested	5% plasmid	1% plasmid	0.5% plasmid
				XPA	5.23%	1.11%	0.65%
ERCC1	5.12%	0.98%	0.58%
				POLD1	4.89%	0.96%	0.49%
PCNA	4.92%	1.07%	0.55%
				ERCC2	5.22%	1.20%	0.44%

As can be seen from the table, the detection probe library and the detection method provided by the invention have better detection sensitivity for low-abundance samples, and can reach the detection sensitivity level of about 0.5%.

The optimized probe pool was used to detect 51 pathway-associated genes in 10 tumor samples of lung cancer patients, 7 of which were missense mutated in exon regions in at least 1 pathway-associated gene (70%), and 3 of which were missense mutated in exon regions in more than 5 pathway-associated genes (30%).

Sequence listing

<110> Suzhou academy of health and occupational technology

<120> probe library, detection method and kit for detecting effectiveness of DNA nucleotide excision repair pathway

<141>2019-12-04

<160>298

<170>SIPOSequenceListing 1.0

<210>1

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>1

cgaataaacc gagggaagcg aagggagatg cccttgtcac tatccacctg cggaagcggg 60

atggagactc ctgcggtcca gccccagcga ccccctgctc 100

<210>2

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>2

cgatcaccac caggtccagg gtgtcaccca cgccatcaag gtagtccttc ttcagctggg 60

agaaggggag gcaagagatg agaaggggga gcgcccaagg 100

<210>3

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>3

ggaaaggggc tcacgtacca gggactgcag ggccggcagg gagaagagag atgagacatc 60

tttgtgagaa taaagacaat aagccctaaa tgtgaggcga 100

<210>4

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>4

cttccagggc gtggatctgt cacgatggga gaagggaggg gaaatcagct gagtcccctc 60

atgtggcctc agctttctct tctgacccca cctgcactgg 100

<210>5

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>5

cgggaacctc gctggggtgg cgggtgagaa caagataggg gaagcctttc tagaactcac 60

acagtttgga aagagagctc ggcctgctcc cagaagcctg 100

<210>6

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>6

gtccgctcag ggacctgggg agagagcagg ccagggaagg gggcttgtct gcacctcccc 60

aatcttgcct cctcccttct ctgatctcct cgaccttgat 100

<210>7

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>7

ctgaggtaga ggacagggag gaggtctgga ggcgacaggg ccaccacgga gcgcagcaag 60

ttgctcagcg tctccaccat ccggagcctg gaggagggga 100

<210>8

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>8

tccctccttt cctggagccc ctggctcctc ttccttcact tcttttttga ctgctggctt 60

ccggggggct aggaatgaag acagaaaaca gtgggtcttt 100

<210>9

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>9

ctttctttcg gggtctcctc ttctgacgat agacagaacg gtcagatggc aaaaaaatcc 60

cattgaacct acaagggcat tttgactctg gagacagtct 100

<210>10

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>10

gtccagggca ggcttctgga agaggaaaga acagttctag agtgagcggg ggaaggaggg 60

actccatttt ccaaaagttg agagtagagg ggactgaaac 100

<210>11

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>11

gtggaaaaat gacctagagg agcataaaag ggggtaaaaa aaggagaata acagcaccaa 60

taccctgcct atctatgctg tatcctataa cttccttttt 100

<210>12

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>12

ctcagtgcaa aagttagttg aactggttca ttcatctcta tggtaaccta caaaacaaaa 60

gattcatcat tgaaaaacat caagaaagtt gcaatctatt 100

<210>13

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>13

atagtctgaa actttctcct ggtctaccaa aagaaagcag atgcttttga gaaatactga 60

cacagagttt tgattttctg tagcttcgtg actcggtaaa 100

<210>14

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>14

gtgtaatgat atcttcattg ccggcgcatt ttagtatttt ggacatacta gaagacagga 60

gacacatgct ttaaaatcaa cgccgtctgc tgaagggctg 100

<210>15

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>15

ggcctcgttg atgaggtcct tgagtgcctc caacaccttc ttgaggatgg agccctggac 60

caggcgcgcc tcgaacatgg tggcggagtg gcaacaacgc 100

<210>16

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>16

gcccctcatc ttccaacagt tggagattga ccattatgtg ggtgagttta ggggttatgg 60

gtgagtgctg gggccctgcg ctcctggggc agaggccggg 100

<210>17

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>17

gagtgagtgc tcccccagga tcagcgggtt ggagggtccc ctcgggaggc cattggctgg 60

tcccagcttc ttccatccac aggcatgttt gggtaccacg 100

<210>18

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>18

cggacatcgt cggctgcaac tggctggagc tcccagctgg gaaatacgcc ctgaggctga 60

aggagaaggt gcagggcttc ccagggcagg gctgggtggg 100

<210>19

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>19

cgcctggcgc tcaccctgcg gccctgtgcc cccatcctgg gtgccaaggt gcagagctac 60

gagaaggagg aggacctgct gcaggtagct ctcgctccac 100

<210>20

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>20

cgcgtgcaga tggacatgct gcaggtatgg gcgggaggtg gggtgtgtcc ctgtccttgg 60

aaggccactg cccaggcccg cagcccacca gcccacccac 100

<210>21

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>21

cgagggtcac tggcgtgccc ctcagctacc tgctcagtcg tggccagcag gtcaaggtcg 60

tatcccagct gttgcggcag gtcagtagcc gagacttgtc 100

<210>22

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>22

acctgtgtta caccacgctc cttcggcccg ggactgcaca gaaactgggg tatagtgccc 60

aattcagcat gtgtcccccg aggcccatct gggccttccc 100

<210>23

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>23

ggcgcccagg tgggcaagtt gccgtgcctg gagatctcac aggtgggcac tcgggcccct 60

ggaaggcaac tgggggcagg tgggccccct gtgtaggaga 100

<210>24

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>24

cggactgggt gtcaggtcac ttcccgtcgc ccatccggct ggagtttgag aaggtgcgtg 60

gctgggtcag gggctctgca tttaggtgcc ctcatcaggg 100

<210>25

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>25

atcaccaagg agctgacccg cgcggcctcc gactatgccg gcaagcaggc ccacgtggag 60

ctggccgaga ggtcctgcgc ggggcgggtg gcctggccag 100

<210>26

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>26

tgccgaggct gtgctactgc gtacgggggc accaggggac tgggggcacc ctgggggggc 60

agaggagatc accggcccac cacctgcctc ctctcctgca 100

<210>27

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>27

gaaggaggtg agagggccgg gaggtgagga ggggccaggt ggggaggcgg gggcgccctg 60

ctcagccgct gccgtcccca ggtatcccat ctgaatgccc 100

<210>28

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>28

cctggacctg aggcctggtg accttgcaag catcccatgg ggcgggggcg ggaccaggga 60

gaattaataa agttctggac ttttgctata tggtgctttg 100

<210>29

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>29

ttgtagaagg ggtaacaacc tggaggagaa ggggcagctc tgaggagggt tccgcctcag 60

cactagcact ctgcacagga tgtggggctg cagcccctcc 100

<210>30

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>30

ttggtgggat caaactcgcc tggcatcacg tccacgggca ctgaggcctg gaaggcacag 60

ggcagggaga gctcacaggg ccccgaagga gccccctaca 100

<210>31

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>31

gacaccagta gcacaaacct gcgggagaag gtggggtcct ccagggtgcc gagaagggag 60

gcagcccctc ctaggtgcaa ctcaaagatt ccactgacca 100

<210>32

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>32

ctgggtgtat gtatttactc cgaggaggct gggggagcag gttgtgctgg aatgcagaga 60

caggaggtat aatcttgggg ccagagccca ccaaagctct 100

<210>33

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>33

tgtgggccct ctgggcagcc tgctcagaaa acatggccac actcctgact tgcttggtcc 60

acacagcttc gcccaggcca aggaggttca ctgcgaaaac 100

<210>34

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>34

cttgcagaac tgcagcaagt aagcgtctta atgttccttg tgggcttctt tacgaattga 60

ttttgtaaga tgtttacaca gtggctgcct cttaagagtg 100

<210>35

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>35

atccagcaaa aaagcagagc ctgttaaggt gctgcagaag gaaaaaaaaa ggtaggaaaa 60

ttttgttgct tattggggaa gagtctttac tgggggtgag 100

<210>36

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>36

ccgtctccac ctcttgaacc agtgccaaag actgagcctg aacctccttc tgtcaaggta 60

aaattatact gggattcttg catgtccatg catcctttgt 100

<210>37

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>37

tgggcaaagc caacagacag gtgtccatta ctggcttctt ccagaggaaa taaactgcca 60

tctctggtag atcagagact tggagtggtc aagggagaag 100

<210>38

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>38

accagcgctg cagccgtgtg atccctgcca gggtgggaag aagactctgg agacttgtgg 60

ggggtggggt agagtctgag ctggagaatg tgtgtgttgg 100

<210>39

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>39

tggggctcct cccctgcaat gacagctgct cttcagtacg aggttggctt cagtctcctg 60

cccctcacct cccagccttc ctcaccaccg ctttgcctct 100

<210>40

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>40

tccctcctct tcacaaccgg gtaggaatca gtgatgagcc gcttccggcc catggcggcc 60

acccaggcag gcagagaagg aggcaactgc ggggaagagg 100

<210>41

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>41

ctgtgtctag atgcctttat agcttgaagt gagtatggag taaggtgggc ttccttattg 60

taagctcttg tgaaggctgc tttcacctat atgaaaggag 100

<210>42

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>42

aaactgggtc atgtaccccc tcatcaactc tccaggaaga acactggcat aaatggcctg 60

aaaaaaaatc aattgcagtc cagaatttat gttccgtaca 100

<210>43

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>43

atctgacttg tccacaagtg acatgtgagc agtctcctct ccagctgcaa acactttccg 60

ggcaacatca aatgggccct gaaaaaagag agggacacac 100

<210>44

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>44

cttctttaaa tgcaatagac atcatagcac cctgaaattg acaagggagg agtcctcaat 60

gatttttaac tcatataatc aggtatttta aaaatattta 100

<210>45

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>45

agaggctgct ccatctgacc caggttgagg agcaatggga tgagacaaaa acaaaataac 60

aattgctcaa aaactgctgc tctgtagaaa attatgtaac 100

<210>46

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>46

acgctgcttt aaaactagag ccatcatctt tgccggaaaa tttaccaaac tttgctgcta 60

ggaaaaaaga agttccagag tgtcaaccta tatcacctaa 100

<210>47

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>47

atcagattca acaggccatc ttcatcaata atttttgtcc ccaaggctgc ggcctgttga 60

ttaaaaatgt aaaccatcaa aactgcatcc tgcatcctac 100

<210>48

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>48

cagaatcttc aggacttaca gactttggga acagggaaag gaaaatgaac aaagtcatac 60

agaattcatg caaaatttaa aatacatatc tagaaataaa 100

<210>49

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>49

gtcctttcga gcctaaacaa attttaaaag tgtcaaatgt gacaaataat agaaaaacta 60

ttaccataaa atctgttgtt aaaatccatc aaaattttaa 100

<210>50

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>50

ccaggtttag aagatactgg cagtttttct ggtggctttt tggcattttt tacctgcaac 60

gtctcctctg actctgaatc tgtatgtgag agaaaaataa 100

<210>51

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>51

tcttctggtg agtagcccag atgccacaag tgagcaagaa tctagacaaa ggagacagaa 60

aaggctgctt accactttaa actgtaagaa gacatgtgat 100

<210>52

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>52

ggtcagcttt gtgtaccgga ggactgcaca gcgggactga atgggctctg aacagagacg 60

ggacagtagt gaggcttccc tgcagaggcc ggcatcatcc 100

<210>53

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>53

cctcacaacg tcaatgcccc tgaaagaatg acaggttttt actggcacct tctgagacca 60

attcagttgc cttcacaagg acttttaaac aatcggtata 100

<210>54

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>54

tgttgggcac atttccttcc cttgcaaaga cctacggcga aaatgatcat taaaaccggt 60

taaaacttgc ttctggatga ctacataaaa aagatagaaa 100

<210>55

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>55

aactttatgg tgttggagtg gaaaaattga gaattgaaca tcagaccatc acagtaagca 60

tttcactttg aggccctgaa agtaatttat agcggggact 100

<210>56

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>56

tctacatcta aagtgatccc acctattcgt agtaggtgct tggcggttcg tgtgcctgct 60

cccagcattg aagatgtagg tcaagttaca cttttctgaa 100

<210>57

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>57

tatctgaggg agactgcaaa tgctattgtc agtcagcaaa ctccacaaag gtaccagtat 60

aaaatgatga cagtaaagct ttcattatca ggatatcata 100

<210>58

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>58

acttggaagc gtttgtggcc aaattcatgg cactttataa gaagttcatg gaggatggat 60

tggaaggcat gatgttctga cttctgtcag ttattcttgc 100

<210>59

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>59

aatcctataa taaaaaaaac ttttggtatg atgacttaat attcctttcc ccaaagttag 60

taagctgact ttaccttgac cacagcttct agtttgtcaa 100

<210>60

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>60

gcttttctta agtctccttc tgacacttta acaagataag ctattccctg aagagaaaag 60

agttgttttt aacctatgat ggccaattaa ggatttataa100

<210>61

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>61

tcatagaatc tgcttcatcc agaatcacaa tcttaaaagg cggacacggc ttcccactga 60

ttcagagaaa cacataagag ttgaacatta atatgtatat 100

<210>62

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>62

ttaagaaatg cttgcatggt acttcaccct ggtcaggtgc aagacagaaa aaaaaagctt 60

ttattgaaac ttttattgcg aatcagcacc ataggaaagc 100

<210>63

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>63

tcctgaactc atggttcccc gcctggaaca tgtcgtggaa gaagagaagt gagtattttg 60

cgggcctttg gggatggagt gtagtagaaa caggcttgtg 100

<210>64

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>64

aacatcctgg actggatgtt gaatcaagat ttcaccacag cctacagaag tatcctttct 60

catgacctcc tggccaccga gacctgaagg tggccccagg 100

<210>65

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>65

cattgctgca tttcaagtca ccagagacct gattgttgca gaggcctaga tgctctgagg 60

gccattcaca attctcaggg ctcagcagtg atgggagaac 100

<210>66

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>66

aagcagttgg agtgaagatt ggcaatccag tgccctataa tgaaggtaaa atgctttggc 60

gtaggttgta gcactcaaat gaatacctct ttatatattc 100

<210>67

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>67

cactccttac cagtccaagt gagttgttgc atagagtaag ttcagagtgt acttatgaaa 60

tcggagaagc tattatggac tcttgagtta tttatgcgtg 100

<210>68

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>68

tcacggggat tgatgacctc gagaacaagt cgaaagactc acttgtaggt aagctcgtgt 60

atgagaagga agagcaggga tgactagctt tctttgcagt 100

<210>69

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>69

gagcctctcc gtgctgtctt caagcactat cattgcgaat cctgacatcc cagaggccta 60

taagcttcgt ggatggtagg ttttgtgggg ctaaacaaag 100

<210>70

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>70

agaaagtgat tgatcaacag aatggattgt accgctgtga gaagtgcgac accgaatttc 60

ccaatttcaa gtaccgcatg atcctgtcag taagtagcct 100

<210>71

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>71

gatctttcat attcagagtc agggtcaaag tggagaccta caacgtaagt aagggcctgg 60

gcagcagggt tggtggtggg gaggtgctgt ttgtcaccta 100

<210>72

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>72

aaagttcaac ccttcaggtc ttggacaagc cttaatcaaa ttcaacacct gaagattcaa 60

atcagaaaga ttttagcaat tattttggat cagcctcccc 100

<210>73

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>73

taggtgctct ccctgctgag ggctgaatta agaaataagt tagcaatatt agaaaatcca 60

tcaagttaaa cagtctttac tacttaaaat agctcgttaa 100

<210>74

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>74

cacaatgtgc tgggctcggg ctctctgaaa agaaaaaaca tgcaaaattc aattaagaaa 60

gtaataacta ccactcattc aacacctgcc atgtgccaag 100

<210>75

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>75

cctgttttga acaacaggat tagtgcctgt gccacgtccc acgcctccga gaaacccgca 60

ggctcccgga ggcttcgccc cttcaaacac tgcccgagtc 100

<210>76

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>76

gatctgaaag aaacatttaa gcaaacattt aatctacaat ggaaagttgt aacatcaatt 60

attatctaag atatttttac ctatttcctt tttctcaccc 100

<210>77

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>77

ccttggcggt tactcttcca accacttcca caattccaga gatttcttca tcaagctaag 60

acacagaaca agacatcgat ttggtgatat cacattttca 100

<210>78

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>78

agcatgccgg cgttgatgcg cgacctgggc aagtccatca tgtccaccat gattatggtc 60

caagactgcg gctggcggga aacccacgga cgactgaaac 100

<210>79

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>79

tgtttgaccc tgtgttcaag gttaggggaa ttatagtttc ccaggtctcc atcgtggggg 60

taatcagagg ggcagagaag gcttcaaatc acatttgtta 100

<210>80

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>80

gggctcagct ctgcgacctt agcgtcaagg ccatcaagga agcgattgat tatctgaccg 60

ttgagggcca catctatccc actgtggatc gggagcattt 100

<210>81

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>81

acttctttac taagtttctc atgcctatgt ggatacaaaa aaagaattta aactgaataa 60

gcaaacctcc ttctcatagt aagggagctg gttacttttc 100

<210>82

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>82

tgaggactag atacattgaa ttcatctact ttgcaggcca aaaatgcaca agtgagccta 60

gaggaaaaaa taaggaggca ggaggcaggg ggtgggtggg 100

<210>83

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>83

tgtggtacat tatggaatcg tgaccaggtc cagagggtct gcagacgaga acccaaacgc 60

atcagcgtcc tggcgtaaaa cacccgtacc cccaccgaag 100

<210>84

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>84

gttgtaacca ggtaagaatc tcttaaagct acatgtgcag gagtttgatc agaaatgagc 60

atcaactggc ttctctgaac tatcttggca gagttaagga 100

<210>85

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>85

gaatatttga aactttgggc acaccaactg aggaacagtg gccggtaagc ctttatgcat 60

tttctttgaa atgtaattag gactctgtaa agttcttaaa 100

<210>86

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>86

gaaaagaaca gaggccttag aacaaggtaa gattcccact tttaaaagaa attaaatgaa 60

tttagaaaac tccaaatagc tcgtgtatgg ctagcgactg 100

<210>87

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>87

gatcagcttc atcaatcatt tcctatatga cagtaaagat tcaggttaat ttataaacta 60

atgccaaaag gtgactaagt aatagacttt ttttttttta 100

<210>88

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>88

tcatcaaaga gcttgaaagc tttcaggatt tcttctttag tatctttctc agacttaaca 60

agtagaacat aaaacacatg agtaggggga caccacggtt 100

<210>89

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>89

gggccctcat tgccacctat aaagaaaaca ggatcgtctc aataagcaca tctaaagtag 60

caggagcaaa aataacagtg ttgagagcat taagccagca 100

<210>90

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>90

tcttcagtaa gctcaggctt agggctcatt ctttttcgct gagaacttga tgccatgttt 60

gccttcttaa agttggaggc ctttatatgt tatgcaatac 100

<210>91

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>91

tctatctcat gttttctgtc gtcgtctact ttctgccttg tttctttcct ctctgggtcg 60

gattcacctt gtttggcagc aactaaaata gaaataaaga 100

<210>92

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>92

gcaatatgtg cttccgtgta ttagagccag ttacttgtgc acctccaaca ccaacttcag 60

atccatcttc ctgtttcatt tttaaaaaaa tataaacaaa 100

<210>93

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>93

ccacctaaag atacctatgt aaaacagaaa gagatattcc cctcaaaatt aactaggatt 60

tgctttctgt tctgtttaga cattgtgtta gatttaccaa 100

<210>94

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>94

taacgttcaa atacatcttt ttcttgcata aacctaaaaa ggaccattgc tttatccaat 60

attgtttcta cttcttgttc tgttagctgc aaaattaaga 100

<210>95

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>95

acattgtttt caaaccattt ggcacacgac taaataactt gtacatgcaa ccaaggtcta 60

caaatcagaa aacacaaatt ggctacatta aagattaaag 100

<210>96

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>96

tccttcgaga cctaaaatca ttaacatctg gcaagcattt cttattgcgc ctctgtcgaa 60

aaaagttatt atcacttgat aattaaatta catttaaaaa 100

<210>97

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>97

gatttagcgt ttgaagaaag ttgttattca atgaatttag tacatcttct cgcacctagt 60

aacagaagag ttcattagtt tgcacacaca catccacaca 100

<210>98

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>98

ttcttaacat ctactacata caaaggacaa gaagtcttta gtcctctgtg aataattttc 60

tacaagaaaa aatttagaac agggtgggtg ggggaaaggg 100

<210>99

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>99

aggtgaggcg gcggccgggg ctggggacgc cgctcctgcc ccgcgtgacg cagacgcggc 60

cgggcggccg ctccgggtgc ctcgcaggct ctcgccgggg 100

<210>100

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>100

cggagcctgt tgcggagcct cctgggcatg ctgtctgacc tgcaggtgag tgctgcctgt 60

gcggaagata cctgggtacc tgcccagcta cttgcaccag 100

<210>101

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>101

agagggagac agagtaatca cttacttgga ccacagcaca cagtaagtac cgtttgctcg 60

ctgagcgttc gtatcttcac catggctgga aggttctcct 100

<210>102

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>102

aggagtcctt tgagacgttc atcaacaaga gacccaacaa gcctgcagaa ctgatcggta 60

gaaaaatatt tgtttttttt gtttgtttgt ttttgagaca 100

<210>103

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>103

ggtaagtatg tggggcctgg gctcctcccc tgtaactgag ggttgctgcc ccgtgtgtta 60

ccccgatctc actccctcct ttgctgtgtc cagagtgcgg 100

<210>104

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>104

ggaagtgcac ttaaccccag aagtaagtgt gcagaaagca tgctgtccgc tcccgctgtc 60

atgcccttac caggcacaga tatgttgcct tcaagaattg 100

<210>105

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>105

taaaaatggc cacggggata ggtacgaaaa ctgcagagtg catagctcca tgagttgttc 60

ttaaagcatg tatttgtttt aagataagac atagacttgg 100

<210>106

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>106

taatgaagat gagaaagact cttggtcata atcttctagt ttctgaatta tataatcagc 60

tgaaatttcc agtaaaggta aatgtaacat tagcataatt 100

<210>107

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>107

attaagcaag cacaggcagt aagttctaca tgcttatttt agacttgttt taaaactact 60

cagataatat catattttat tattttgaaa gtagaacttc 100

<210>108

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>108

agattgggag aagcttttga ttctcagctg gttattggag taagagaatc ctatggtatg 60

ttctgaactt ttatgatcat aatttctgtt tcatggaaat 100

<210>109

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>109

attaaaagaa gaagaaaaac gagcactacg ttatttagaa acaagacgag aatgtaactc 60

cgttgaagca gtaagtaatt ttgtaattgt acattttatg 100

<210>110

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>110

ctgaaactat tactactgta agtttttttt caatggcaat gatagatata tatcaaggct 60

attttttaaa tgtaggatta ttgaaaatag tgagcggtta 100

<210>111

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>111

gcaaagctta aagaagtggt acatgaattt tttgtatttc aacttttaaa attaccttac 60

tttgaatttg tgttttgctt ataggacttt ctgtgatagt 100

<210>112

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>112

gtatctgaag atttgaacca agcttttaag gaaatgcaca aaaataataa attggcatta 60

ccaggtatta ttttataatt acatgtatat attttttaaa 100

<210>113

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>113

aaaatcagct ttgaaaatct taagcttgca actgaactcc ctgatgctga acttaggagg 60

actttatggg ttggtttatg tttttttgtt tttaagactg 100

<210>114

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>114

agaagagaat gaaggaatag ttcaactacg aatactaaga acccaggttt gtaatgttga 60

cagaatgtct gaagtttaaa aaaactttag tttttttttt 100

<210>115

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>115

ctgtggctgg ttctgtcttc cgctcggtgt gaaaggatct ccaggtggat gggtgagtta 60

aggaacacgt gcttatcagg aaacaccctc ctcagtcatc 100

<210>116

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>116

cgtggcaaaa gacattgaca aactcgccca ggtggaaaag accaacctcc tggaggtgct 60

gccgctcctc gtcagtggtg gcagcgctga aaggcggtaa100

<210>117

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>117

gtcttcaggt agagggccat gatgttgttg tagtggttgc actcagtgcg cagctccttc 60

tctgttgtcc actcatagag ccgcacctgg gaagggcatt 100

<210>118

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>118

gtaagtgttg gggtctttgc ccagcttgca ggaaaccaga ctgagggcat attcattctg 60

cagaaactgg tgggcatgaa gcactagaga gtagagagat 100

<210>119

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>119

actgggacac ttcctggtag cagatcttcc tgcagaacaa gtacagaaca acagtgtcac 60

ttagaaagtc agaagcaccc tacaccaacc cccacttccc 100

<210>120

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>120

aagacgttgg tggtagaaagagaacgaaaa gtcctcaata cggtgggctg ggtgcccaaa 60

gtcaccttct tacggtcgct caacagacct acagagagaa 100

<210>121

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>121

tgtgtggctg aacaaagaag aatatggcag aggaaggaat ccaaggctca aagaagtcct 60

agagaaaaga ggaggaaagc gagcagacag aaaaacacac 100

<210>122

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>122

aactctgcag cagaatggag ggcctgggtc agcctgggac cagcttcccc acctcacaac 60

cttctcacca gcacctacag ctggcactag acccatcctt 100

<210>123

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>123

tccggatgat ccgcaaagaa ccttccttga aagccccaga gcaagtgacc agctgcaagc 60

agagaaaacg tttctaaaga accccctcaa gatactgggc 100

<210>124

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>124

aggtctggaa gaaagtcagc aacgtgaaag aaatgagaat ggaccctacg tgggatccag 60

atactaccca catctcagac atctgctgag aaaactccca 100

<210>125

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>125

agggctctgg gactgcagga aagacagcaa aattagaatg ctcagcactc tgggtctgcc 60

aaaccaggac tggcaaaagt acaggtctag ttagccccaa 100

<210>126

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>126

gtcaatgatg ccaataatgc cggtctctga ggggcggcca atgcggtcct gagaaacaaa 60

atcgggatta gggaagaacc tcaacatcca cagagcaaca 100

<210>127

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>127

cggtgaccac atagatctct aatctcgtgt ttttggcaat caacaggttt aagtcttcgg 60

ccgaagtaaa gtgtcctgaa agaacagacc ctctaacttt 100

<210>128

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>128

cctggccatc tgtccagcag gtaaggcatt ttttgcctca agtcctcaag ggtttacacg 60

tgcattttta ctattgcatg ctcccaaatt agatgatggc 100

<210>129

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>129

gctgcaagac tttaaaggca acattctacg agtttttgcc agctcagaca ccatcaagtg 60

agtagtttaa ctagcagggg aaagggcttc taagcttagg 100

<210>130

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>130

ggaaagccag cttcctctac tcgctgccgc acaggcatcc tgtcaacgca ggtgtgatat 60

cccagacctc atctctcctg cagaccctgc ctgtctgacc 100

<210>131

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>131

tgaggacgat cgacgtgttc gatggaaact cagggaagat gatgtgtcag ctctatgacc 60

cagaatcttc tggcatcagt tcggtgaggc ttgggtcctc 100

<210>132

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>132

cgcccagctt cctcggggct gggataacag gatacagggc agccgggagg tgaggtatca 60

gattatagat ttgcttcatt atggtcagtc ataagaattg 100

<210>133

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>133

ttcagtacgg gattgcccct ctggggaggg acgaagggca gaagccatca atagggatga 60

cccttgataa ccacagggcc ctcctccacc tcttcttgca 100

<210>134

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>134

gctggcggcc ctgagggctg gggcaccccc tctttgtcct tcccagggtc catctggagc 60

ctgaaaggga aggtgccagg agcgagtgag ccactggcgt 100

<210>135

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>135

aggtgctcct ggatccagcg gggcagcttc ccccgcttgt ccccacgggc aaaccgctgt 60

gggcagaagc gcaggccagg gacagaaggt cattcgggga 100

<210>136

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>136

ctctgtgtgt agacgtaggg gacgccaaac atgatgacgg cccgcccgta gtggtgcact 60

ggtgggcaga ggagaggggg cgaggggggt tacaagtgtg 100

<210>137

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>137

ctcaataaag agcagcttgt tcctctggat gttctcaagg atcccctggg gaaggaccca 60

gggaggtcag ggtgggttca gggcacagcc atcctggtta 100

<210>138

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>138

gatgtccagc ggggacagtg tctgtggcgg gacagtggga gggatctcag caggactggg 60

cagggaccag gaggcccatg gagggaggtc agggactagg 100

<210>139

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>139

ttggcaatgg tcggggttct gtcgtcaaag ggctcgatga tgatggtgaa gcctgcagag 60

ggcaggcaag gaggggtgag attaccccac tacagccaca 100

<210>140

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>140

tggagccagg cactgcctct gcgaggagac gctatcagcg gcgacgggga ggcgggaaag 60

ggactggggg gcagcggggg gtcggggctc accctgcagc 100

<210>141

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>141

agacgttgtc tggagaaggg ggagagagcc ggctcaggca ggcctgcagg ggcctcactc 60

agaggggctg gcatcccttt ggcccctggc gcccccctca 100

<210>142

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>142

caaattcctg ggacaagagt gccaggggtc agggaggctg cctgccccag gctacctgtc 60

ctgcctccct ccctcagccc tgccctccag taacctcata 100

<210>143

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>143

ttctcataga agttgagcaa ctttcgaagc tcttcaatca cctactccaa agttgggggg 60

cagggggagc ttgtgctcat tggaggcaca aacccctgcc 100

<210>144

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>144

actgtcttcc cggtgcctga gggcatctcc aggactccat gaccctgcat gttggggacc 60

agaggggcaa cacacagggt ctcagaacct tgggcacaca 100

<210>145

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>145

tgtaagagct gctgttgctc ttcttttgtc gaaaacgcca agtcttcctc ctccatgcca 60

gcgagtttcg tgatcacctg caaagcccaa gccagcagac 100

<210>146

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>146

gatgagatct gaatgaggac atttgcttcc ggcagatcaa acgaagtgtc acctacctac 60

agaaacaagt tggaaggttt ttatatatga ggaaaaaaaa 100

<210>147

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>147

gttttgattg ccacatattc ccggtaaaat tcaggagaca tagggcacca gacctgtaat 60

acagtaagaa ccaggggtca ttttacaagt ttaaacacca 100

<210>148

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>148

cagatctggc tgtcgtcaat ggtggaccac atcttgaact gggctttcca ctgctccaca 60

gaaacagctg agttgcccag caccagacag cgttttctga 100

<210>149

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>149

cactgctttc agcagtctta gaaatctgtg agagaggtag gtgctgaacg tgcacacaac 60

atttaattct gctgttatca agcaatgggt gaagttgtaa 100

<210>150

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>150

actggctctg caatagccac caagaagtct tgggcatatt tgtaaactgg agagaaggct 60

tccaagaaga tatggccatc gggagcctga gagataccaa 100

<210>151

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>151

ttgacttctt gactgataga ataccttcag atttaattac tggtaagaat ttgaaatctt 60

attattagta tgtaaatttg tacttttttt tttttaagta 100

<210>152

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>152

atgtctaaag gaactaaaat gccataaccc atcgcttgaa gtggaagatt tatctttaga 60

aaatgctatt ggaaaacctt ttgacaaggt actctttttc 100

<210>153

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>153

gaaaaaatat ctgaaaaaat ggaaattaaa gaaggggaag gtatcttgtg gggttaagtc 60

tttaaatgtg ttttttattt cggtatttgg tatggaaatt 100

<210>154

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>154

tcacaaaaga cctaaagacc cccaaaacaa agaacgggct tctaccaaag aaagaaccct 60

caaaaagaaa aaacggaagt tgaccttaac tcaaatggta 100

<210>155

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>155

tctcactgct ttgcggaaag aaaaggaagc ttttgaaaaa ctcataaggt aatacataga 60

aaatcagtat gaaagcccca actacattgg aaacctctgg 100

<210>156

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>156

ggctctttaa ataacggccg cctctacagc cagtgcatct ccatgtcccg ctactacaag 60

cgtcccgtgc ttctgattga gtttgaccct agcaagcctt 100

<210>157

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>157

ttcgtcctat ttttgtgttt gatggggatg ctccactatt gaagaaacag actttggtaa 60

gtgtcgtata gtttttagta agtgtcaaat aatttttttc 100

<210>158

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>158

gacctctatg ttttgcctcc tttacaagag gaagaaaaac acaggtaaat gtttaactat 60

ttaagaatat tattttagtc attgctacat tcagacacat 100

<210>159

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>159

ctgatatgaa agagttcacc aagcgcagaa gaacattatt tgaagcaatg ccagaggtga 60

aatatgcaac agtacattca tgcttagaat taagaacttc 100

<210>160

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>160

agctcagaag aggagctgga gagtgaaaat cgaaggcagg cccgtgggag gaacgcacct 60

gctgctgtag acgaaggctc catatcaccc cggactcttt 100

<210>161

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>161

ttaatttcca ttccaaaggc cgtggaacca atggaaattg actcggaaga aagtgaatct 60

gatggtacgt gtctgtgctt ttgtagaaat ctggaacggt 100

<210>162

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>162

ggatcgctgc tactgtcacc ggacagatgt tcctggaaag ccaggtgggt gcaggcagct 60

tgggtttcct ttaccacctt cttcagaccc ctgggggaat 100

<210>163

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>163

cctggaacct ctcctaaaat tctcgtaagg tcttttattt ctttaatttg gataattgtg 60

taaataccca aataagcaaa tagaactatt atttacagca 100

<210>164

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>164

tgaatctctg tttcctgtat taaagcaact cgatgcccag caggtaatca tggtggaccc 60

ttctcctaag ttcaggatga agggtaggct gtggttgaca 100

<210>165

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>165

aggggaagaa aaaggaaaac ctaattaaaa aatatgtatc ctctataatt agttatgaca 60

gccatttgta atgaatttgt cgcaaagacg taataaaatt 100

<210>166

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>166

tctgcctcca ccagtacata atctgggctg gctccatcca tgatggcatc gtgcttcatg 60

acactgtgca cgccaactag caagaaaaga aatagcaaag 100

<210>167

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>167

ttgggtgtct gaacatctga tccagttcct gtaaagagga aaaacaccac taatactata 60

ttgtatcatc ttgtgcaatt gattacttta aattaaatga 100

<210>168

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>168

ttcttcaatg gtgcccgcag tcaggagcct gtacacagtc acttgcttct tctggcctat 60

tctccatgct cgctcccggg cctgcaacag agagagagag 100

<210>169

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>169

atcttgagat aggtatactt ttgggctcta aggaatactt caagtatgtc cagcatctgt 60

ttggaggtgg gggataggag tttgcaaagc aaatacacat 100

<210>170

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>170

atcaacgaaa ttttggtaga ctttatgctg ctcatctgta agacggcaaa ataagaccta 60

cggacgggaa aaacaaggaa actataattt caaaaaaaaa 100

<210>171

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>171

gggaagatga agtcaaagag cgaccacagc tctcggaggt tattttgcat cggtgagcca 60

gacagaatga tccgatgagg ggtgcgaaac tatttgagga 100

<210>172

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>172

atgcatcact gttgttggac agacaattac agttggaccc aacccctcaa acctgcatcc 60

aaacgtccaa gaagaaaaca accatgaaag agcatataca 100

<210>173

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>173

gtcaaattca gcatcacttt cctcagaatc gtcctccagc ttcagacgtt tctctttgtc 60

ctgcagtctc agtttattcc atctcctacc atgaaaataa 100

<210>174

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>174

cctgatgtcc cattgaactg agcttatcaa gaagtgcaat actggtgaaa aagttattga 60

atacaaaatg gtattgtcca gggtgtgcct ctgtaagtgc 100

<210>175

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>175

cctcatcaga aacaggtgct gtagcatttt caggtggttg tatcactata gcacttgctt 60

ctatgctgtc atctgtctct aaaaggtcag ttatttcatg 100

<210>176

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>176

accaaaaggt gtcatctggc cagtgcggat gagctcttcc caggcagtct cctggacagg 60

catgagcatg ctgccaagac tggatggccc cggctctgaa 100

<210>177

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>177

gtcgtacatg acctgaaaaa taagataaat tgtctatttt gcactctgat aacattttta 60

tagcataata taaagagaaa aatgctaaaa acatgtccct 100

<210>178

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>178

aaaacaaatt ctgaactgca gccacaggag acagtgaatt tcaatccttt tttactgtta 60

ttacaaactt ttccatagtt cacctgtagg attaaaataa 100

<210>179

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>179

aaacatcctg atgctcttct cacatcccat aattttactc tactgtcagc actgagaaga 60

aataaatgtt acattgacat atgtagctag gacaatgact 100

<210>180

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>180

caaacagtgc ttggtggaga ctggagacat atgatgacta taaactgttt cctcaaaatt 60

aaatacatct gcagtctggt aatcaaaaga catttaaaaa 100

<210>181

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>181

tgaaccacct gataacatgc tgataataaa aaagttcaca ttaatttatc attttattta 60

ttatttagtc catttattta tgattgcaaa tttctaaaaa 100

<210>182

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>182

caaattcaag aggaaagcaa ataaagaact ggaagagaag aacaggtggg aggaaaagaa 60

tagccttttg aaagagatac tgggttctct atagtctcct 100

<210>183

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>183

aacttctgat atcattgagt ccatatttag gacctatcca gcaggtaaga agaatcagtt 60

ctttcagatg gttaaaatat atggatatat tctatagtat100

<210>184

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>184

actactagat ttaacagctt tggaagataa accattagat gaggtaagaa gcaataaaag 60

aagttttgag agaaaagagt cttttcctag tcttcaacat 100

<210>185

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>185

gccagcagtc aaaagggtat gggcaaaaaa atatgaacca tttggggctc aagtttctcc 60

aaatacttta tgtgactgca agtactgtat acgcttattt 100

<210>186

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>186

tattagacaa gaaatggaag cttatacacc caagttaact caggtaggtg acttctactg 60

tttgaaggcc agaattccca tagttccttc ctcagtttat 100

<210>187

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>187

tggtcctgct ttcctgttaa tacgccattcctagaagaaa aggttagaac cagttctgaa 60

gacagccaga taattgtggt agtgacttac aagaagtttt 100

<210>188

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>188

agctccacac atggcagtca cggcgtctga tgaagaaaac gtgaggtggc catgatgctt 60

acaggttttg tgagattgag agaactatga cctgcagcaa 100

<210>189

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>189

catggctatg cagactctaa agttagtatt atacattatg tataattgaa ttagaagttt 60

tttaaatgag ttaagttgaa gtgatgtgtt aatatggggc 100

<210>190

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>190

gcagctaaaa ttagagtatc tgttactgga ttgtctgcag aagttcgcgt ttgcactgta 60

cttgctcgtg aaactggtgg tatatatata atttatttaa 100

<210>191

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>191

tgttgaatgt aaaatctgtg gtaagaaaac aactattcat tattcagtaa atcttgaatg 60

acttcttaat ctgtattgct gctaaaatta atgtaaatgt 100

<210>192

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>192

tccagctcct tcaggtgttt gattccagca tgtagtatac attgtatgtg ttaaaaagaa 60

atttgcaact gtgaataaaa ggacttcttt agaagaagct 100

<210>193

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>193

cccctgacat ccataacaaa atctgaaaaa aaagtttaac aatgtttttt cttagaattt 60

actcattaaa atagttcaac aaaatctcac taactagaat 100

<210>194

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>194

taatgtaagc cctggctcag tattgccatc caaatgcctg tagggggaaa aagggtaata 60

tataatgatc tgaaaagtta gagcgggaaa gcatgctatc 100

<210>195

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>195

tacttctcga cttgtatgtc caggcatgtg tcttaaaaga aagataaaat acactccaat 60

taggtacaac aaattatact accaaaaaat ttacccagaa 100

<210>196

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>196

tacaaagtat tccaacaact gtttaaacaa aaaaagacat actagataaa ggcaaaataa 60

caatcataaa gaacacgtcc aactgatgtt tgtgaaacct 100

<210>197

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>197

ttaagtgatc cagattcatc ttctttaaga atctccctat aagtcataat tatttgtttg 60

aaaagacaag ctaaaatgat tactagccca aatgaaatga 100

<210>198

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>198

attcatgaat cgttccaaca aacttgctgt gatagcaagt cacattcaag aaaggtatga 60

ccattgtgattgcttttgct cttcagtgct taatattcat 100

<210>199

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>199

ctcagcaaat gaagttattg ttgaagagat taaagatcta atgaccaaaa gtaacaactt 60

ttaaacattg ttattttgca aatagtgttg attttggagg 100

<210>200

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>200

agggctgctt gcttctgtca tcgaaatctc attgaaattg gttatgtctg ttctgtgtgt 60

ttgtcaagta agttaatgta cctagttttt cttttttttc 100

<210>201

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>201

cgagtaagta tctttgagat tgtgtgggtg gctaatactt cacagctcta gaacattaaa 60

aaatgttttc ctctctgtaa tttcaggaca gcctttaaaa 100

<210>202

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>202

atttctctgc ctccagtgct gaaagccaag aaaaagaaac tgaaagtgtc tgcctgagga 60

taaaatattt tccccatctt ttagagctgt taatagaaat 100

<210>203

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>203

cagcctttgc cacaggctgc tgtagctctg tgggtaaaga aggaattcag caagtaagtc 60

tcagccagat acaaatttct caacagctac atttcccaaa 100

<210>204

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>204

tgacaagtac gccgaggagc gatgggaggt aagcacttgg gagtgtgtgt gtctctgctt 60

gtgcttctac ttcccatggc ccttggggca tggtctccct 100

<210>205

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>205

ttgcagtatt tgcagacagc ccaggtgagg aggcagggcc acttaaccag catgctctgc 60

tcctctcagg tctcactgag agactcctgc ctacagactg 100

<210>206

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>206

gactgtatgc ctacacgggt gaggcgggac agagggcccc tggaagagga ggttgggggt 60

gagggaatgc cagtttatgt tcgtgtttac ctggcagtct 100

<210>207

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>207

aactcggcca agcggctcat ggtggtgacc ccggccgggc acagcgacgt caagcgcttt 60

tggaagcggc agaaacatag ctcctgagag cgcgggactt 100

<210>208

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>208

gaattaatgg accaaaatgc tttttccctt acccagaaat gaaaatactc aatatggacc 60

atttaggaat tataagcagc aactgtgaaa gacttgccac 100

<210>209

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>209

ttgtcatcca ggggtttggc taaggcccga atcacctgtg gtttgtacgg cagcagctgt 60

ggagtcagag gatataatca accttgctca tccaaggcaa 100

<210>210

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>210

gagctgcacc acacagtcag ggcaggacag ggcctccagc agcaaggaaa gaagctaagg 60

ggcaatgggc aaggtagggg atggccacat catgaagatc 100

<210>211

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>211

agacatgagc agagagaagc catcagctgc tgctggacct aattctgggt cactcaggag 60

gcccatgagc tggagaaaaa agagcctttg aggtacatca 100

<210>212

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>212

ctgagggatt tccacctaca gaaaacctgg ccatgtaatg gacccagaga acacttgaac 60

tccaagagaa ccagtacata gtggcagcag ggaccgggac 100

<210>213

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>213

ccatccaaga agaggggcac aatgtgtgtc acactctggg cagctaacct gggggcagag60

tactaggtat gaccaaggag ctaggattct aaagcagccc 100

<210>214

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>214

ctctgacaga cagcaataac gtcactggat tgtgcaacca tattccctgt tgatgagaaa 60

gtgttctctg taaggtttgc ttaaaagcac tttcaggtgt 100

<210>215

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>215

ggtagagagc agccagggtt cctgatgctt ccagtgctgc caccctgctg gaggcgcaga 60

gcagataagc attggctgag cctgggctca cagctctctt 100

<210>216

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>216

taccagtgag cacagctggt ccttgaagcc attcagaggc ctttgatcta gggaagagac 60

agaggccagg ttagaaggaa gccactgcat tccatatccc 100

<210>217

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>217

cacctgcagc tgcctgcaac agcttggcac taggccacac cagtttcatg tccggttcac 60

acaggtggtg cctgcagtct agagaagcag cacatcacag 100

<210>218

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>218

aggatgaggt cttctctctg gataccatgg ggatcattag gtggctggaa aagggagaag 60

ggctgtgggt ttgtgtaaca tttcagacca ccttgaacac 100

<210>219

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>219

tggatgaagc caaaggtgaa gtcagctcct aggctcttta gctctgggaa ggagagaata 60

aggttactat actgtcccac agcacagaaa gtgtgggctt 100

<210>220

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>220

caaaagctgg attgctcgtg cccgagttcg gggttctgga ttctctagag aggacctagg 60

ggaaaacagg atagagagaa cctgcaatta cccagttcaa 100

<210>221

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>221

agcaacttca gggtacaact ctttgaagat cccactgttg acaaggaggt tgagatcagg 60

aaaaaagtgc taaagatgta agtattcctg ctcgaatgat 100

<210>222

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>222

gcaggctttt ttagatgagc tggtatgtat taatgctaat tgtgattgta aaaaacattc 60

ttcaggattt acctttccta gtaggctgga tgatggcatt 100

<210>223

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>223

atatggacca catgttcctg agcttgagat gctaggaaga cttgggtatg tgtcctaaag 60

aactttacat tgaggagctg atatgtggga cttattgctg 100

<210>224

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>224

gcagtacaca ggcatgctgg tctccttcac cccgcggcac ttcaggcaga cctgaaaggg 60

agcagccccg atgggcgcca gccctcccgc gctggccaga100

<210>225

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>225

ctcggttcag cttattcacc tggtttgtga tgttggtgtc cagggacagc acctgcagag 60

accacagccc acatcgggaa ggagctcccg gggcctccct 100

<210>226

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>226

actgcgcctc agcccgtcct tcatgcagtg gtacacggcc acgatgtacg ctgtggagag 60

gcacacacac cacaggccct gagtcgggct gctgcaaaca 100

<210>227

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>227

gtctcctttg aatggatgct gcagaggaag cattgaagac gctgcttcag tgaaatcgac 60

cttgttctca actttccttt atttcccctt gtatctatct 100

<210>228

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>228

gttgtggtactgggtgatct ccttcaccca gcccacgacc atgctcttca ggatcctgaa 60

agagaaggtg cacgacaccc tcgtaccctc agcctcccac 100

<210>229

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>229

tgtggagatg tcctctggta ggttcccaat gggaatgtga aagtacctgc accagggcac 60

aggtcagcac cggggcacat cgccgggtca cagagaccac 100

<210>230

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>230

gtgctctgct gagtacaggg cgccaaggct gggcatctgg ttgctgcgca cctagaccaa 60

cgcaggccac gtcagcctcc ccctgcgcag gaggaagtgg 100

<210>231

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>231

attgaccaca cacacacagc ccaggtgcac cagggcccgg aacagtaacg gaacctggaa 60

gaatcgggca gacaggccgg caagggctgg atggtggggg 100

<210>232

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>232

gtcactgcca acgagcgccc acagcctgaa caggccggcc tggctggtct cgctgatctg 60

aaaggccaca cggacataca gcacatcaca ggacacactg 100

<210>233

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>233

cctccatgtc aggagcactt ggcctcggac tgtcttctga ggcctcggcc atcgtgacct 60

ggaaagaccc agtgaagcct taaatctcag gatctcgggc 100

<210>234

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>234

tctggatggc gcttcccagc cgctcaatgt agtagtccca atccagaatc tgcatgtgca 60

ggaaacgggc acagagaaca gcaggtggca gcagccaaga 100

<210>235

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>235

atcttccagc ttccgagaca tggaacggtt ctcagagatg agctcgaata gctcagagtc 60

aggcatgttg gctgcctaga gaaagacaat gggtaaaaca 100

<210>236

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>236

gaggacggct cagccagctc ctggtactgg tcattggtga agccttcctg agaaacaaga 60

gtgaagaggg ggcagcttca ctcatgatgg cccaaacctg 100

<210>237

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>237

ctgtgaagca gacgatgcca gccatctcca tggagtacca gcgagccctg agaggacacc 60

acaaactggt gggtggggct ggcatggctc ctccaggggg 100

<210>238

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>238

tgagacgctc ttccaccttg gtgatgtgga tcttcttgta ggctttccgg cagtaatcta 60

agcacgacgg agatgggcag agcaggtggg tgagatctcc 100

<210>239

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>239

gtccaccatg gcagagggct gggaggggtg agaaagcact tagggctggg cagagagagc 60

tccgactctg acacgggaag taaagtctca cctgcaggcg 100

<210>240

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>240

ggaagtcaaa ggcggcagga ttctagcaca acagtgagac gacggggtca gaggggaaac 60

acacccacac tagcctgcct caggtttgac gctgtggctg 100

<210>241

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>241

taagtggcga cagcatctga cacagaatac gtggccagag tctgaggaga gaacgccaga 60

gagcagggcc atcaaaaatc aagagcccag ggtcaagtgt 100

<210>242

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>242

gcatgctcag accgtggact gctgcccggg cctccacaaa tggcctgggt tggaaagagg 60

acagacaagc aagtgggcag gtcaggctct aatgcccctt 100

<210>243

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>243

aactcaaaat cttcaatatc ttctgaaaca atctccctgt tggtgatgag gtagccctag 60

ccaagttcat tagcaatcag cacaagtcag aggctgcaaa 100

<210>244

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>244

ggaaaagcat ttcctcggta tctgacattg taccaatgag cctgcaaaac acacagtgtg 60

ctaactagag ttctacatcc aggaaagtct attcttctgt 100

<210>245

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>245

cctcactttg acaagatcct ccacagtgtg gaaggacagc ctgatgtaat ttcgcttcaa 60

acccaccaag tgatttggct ataatgcgaa gagatcacgc 100

<210>246

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>246

actgcactgc ctaagcgctt atcttcatct aaaatctcgg tctacaagag aatcagtcaa 60

cacagacaca agaccatcct ctacacagtt agagaaactt 100

<210>247

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>247

tttatttact aagtcttcac ggaagacagt aatttcctgt gtacagtact gaattctgaa 60

atgaaaacag tagttgaatt tgacttctca gaaaaaaatg 100

<210>248

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>248

gctggtgaat aacctaaaca ataaaagagt aaatgaacaa tacttttcta gtctacaaat 60

caagttaaaa accctttaac catgactttc taataataaa 100

<210>249

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>249

ttggtcatta acagactaga aaaagagaat gcctattttt gactatcata atacacaaag 60

gtgagccaaa agtgaagcaa gagactatac cttctgaaaa 100

<210>250

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>250

aattatcttt tccagtttat cttcaagctc taattcactg atagactgaa gagcttctgt 60

gaggtactta atagcttcac taagaaaagg aaaggaaaaa 100

<210>251

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>251

cttgctcttc cgagtctgtt tttttgtctt tgtccttctt cttttgctct gaggcctcct 60

tcttgccttt ctgctcccgc ctatatgctg taaggacgga 100

<210>252

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>252

agttgttagc actgagagaa gagaaaggct gtcagactcc ctcttgtttg taaggcgtga 60

gtgggaaaag gagcacccag aggtggaacg ggaaagcctg 100

<210>253

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>253

ctgcgaggag accgggggtg agcaaagctg ccgttccagc acctgcttcc ctcctgcccg 60

ttcgtccgcc ccccccgagc tgctcaccgc ctccttgatg 100

<210>254

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>254

agatcccgac gtgacgctag cgggacagga agccatcttc attctggcac gagccgcggt 60

gcgcctgcag cgcgagggca tgcgggagtg ggggaggtgg 100

<210>255

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>255

gctcagcagg gaaaaaggaa aacccttcag aggagagact tgggtagagt ggcactgcag 60

tgtctgggga cagacaaggg agggctgggc tggtttcccc 100

<210>256

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>256

cccacctgcc gccagagagg acaagagccc atcagaggaa tccgccccca cgacgtcccc 60

agagtctgtg tcagggtaag gcgggggcag cagtcccagc 100

<210>257

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>257

ccaggtatcg gagcagccgg ccacggaagc aggtgggtgt gcacatgccg catctgccct 60

ccaggtacct gactcacatt acactccacc ccgcagtgct 100

<210>258

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>258

gaaagaagct atagagaggg taagaggcct ggctgagggg tgactgcagg tgggcaggac 60

ccctaccctc tcctgctcac acttaaccta tcttcccaca 100

<210>259

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>259

gaaaaacttt gtggtggtta tggtgaccaa agtaagtttc aacctcattc tgtatatctt 60

tatgcatgta ggtcttttta aaaatgatga tcacaagtcc 100

<210>260

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>260

agagccagtt tcaacaaccc tgacagagca gtggagtatc ttttaatggt gagaaatatg 60

ttttacttta ctccattctg ttgtttaaga ttaaaatctc 100

<210>261

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>261

ccagcgttac tacagcagat aggtcgagag aatcctcaat tacttcaggt gactaatcag 60

tgtcagtttc acaagtgatt tagagtgtgt cacaatttga 100

<210>262

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>262

ctgccaattt tcttctacag cagaactttg atgaagattg aaagggactt ttttatatct 60

cacacttcac accagtgcat tacactaact tgttcactgg 100

<210>263

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>263

gaattccaaa agtaggtatc tttggttgtt ttgacggggc tttttgactt gcctcaggct 60

gaaaggagcg tggtcttggg ggatggagac atgatacatg 100

<210>264

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>264

ttctttggtc aagtttttcc gcatctcttt cagctcatca ctagccattt cctatgaggt 60

agggggcaat accactcagt tatagacacc ttctatatat 100

<210>265

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>265

atcagctcca attgcaatgt agtcatctaa aaataggcat aaagaattgt caaattattg 60

taacagatta aaagaaaatt ctaataccag gtaattaaac 100

<210>266

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>266

tttctcagtt gatggcccat ctgaaaatta tgaaatctct taagttgcta gcatttgtaa 60

aaactaaaaa ctaaaatact gcgttaacag gctatttgca 100

<210>267

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>267

ttttaaagat ctttgaaaca aagtccagtt tctactagtt aaaacacaaa attaattatc 60

tttagcttac ccattttgtt cttatgaaat tctactttgc 100

<210>268

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>268

tgggagtgga catgcaggct atgggggtgg ggggcactta gaaggagaaa ggcctaaaac 60

tggaatctct tgtccctgag gctggctctg gtctttgtgt 100

<210>269

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>269

cgggcagctc tggcgggctg gaaaacggct cgatgcacag ggcctcaaag gtgtcatctg 60

tggaggaagc agcagagctg caggggggta ttccagctct 100

<210>270

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>270

ccaagagttg gtcatcctga ggagagaagc aggatcttgg gagaggccct acatggggca 60

agtcccaaag acttctgacc agcaactaca cgggaagtca 100

<210>271

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>271

gccggatcat gaggaacacg tcctgggggc ggcgggccgg cgtgagcacg aagcccgggc 60

cccccgcgcg gcccagccgc cccccgccgc ccccggcccg 100

<210>272

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>272

gaccccgcac agcctctgcc gccccccagg gaggcggcac agaggctgag gcaggcgacc 60

acccgggccg tggaagggtg gaatgagaag tttggggagg 100

<210>273

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>273

ctcctcctgc gcgggccagg tgggcccctg ccggtctggc acccctgacc cccgggacgg 60

ggagcagccc tgctgcagta gagacctgcc tgcctctgca 100

<210>274

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>274

aggggaaagg cgcagggtga gtgggcaggc ggcgagcggg aaggggtccc agaggcctca 60

gtgggggagg agaagctgtg ggggggttgt gccctgggcc 100

<210>275

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>275

cttgcctcca ccctcatctg ccaggtgact cccagtgtcc tgtgtgctga gccccctgcc 60

cggcgctgcc acagcctctg cccagagcac tggccggcct 100

<210>276

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>276

gtttgagcct gtgcagcact ggtgccgtgc cccgaggcca gacggccggc tctgtgagcg 60

ccaagaccgg ctgaaggtga ggccgtggcc cgagggcggg 100

<210>277

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>277

ggaagaagag gaggtacccc agcctcacca acctgaaggc tcaggctgat accgcccgcg 60

ctcgcattgg gagaaaagtc ttcgccaagt aagagtggct 100

<210>278

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>278

tgccagctcc tcccgggagg cgtcactcct agggacgggc catgctgcct cagttcccca 60

ccccgggccc ccttgggacc tgtcccagtc ctgtcccgtc 100

<210>279

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>279

cacgtctgcc agaacgcgcc ggtcgtctgc gtggggggca gggcaggggt gggtgtgtgt 60

gcccgtgagc tggctgactc cgccgcagcc cccaaccctg 100

<210>280

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>280

gtacagcagg tacaaggctg ggcggggtag gcggggagag gggagcacgg tcagccgggg 60

ccagtcagaa acccagcccg cccgccaccc cccccatgcc 100

<210>281

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>281

ctgcaggggt ggggatggga aaggttggag ctggttctgg agctgagtcc ggggccccgt 60

ccctccccag ccacaggcag ctcacctgga aggtgccgag 100

<210>282

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>282

tcatccacct gcttgaagtt caccttggtg gccttctcca ggatgacacg ggcctgccgg 60

ggcgggcaga ggcgaggctg agaccctgcc cacctggaca 100

<210>283

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>283

gagctgctcg aagcgggcca ggcgcagctc caggtccaca tcatctggga gccgcgaaca 60

tgtttgtcag gggcggagac ccaggatgca ggtccccgga 100

<210>284

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>284

gtcgcacagc tcgtgccaca gctgcagggc atggggcagt gggggagagt ctcaggctca 60

gtcatggagg gggtggccct cccacccagt tgccggctcc 100

<210>285

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>285

gcacggtcga aggtgcggcg ggtgtgtgtg acgcgcccct ggtccatgag gaactggcag 60

taatctagcc acagacgagg catctggggg tgtggggaga 100

<210>286

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>286

gatgtagcga agccagcatt tgacagagaa ttggttccgc atgatttcct cctcataggg 60

gaggtcctct tcctcctgcc agggccaggg aatgggaaga 100

<210>287

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>287

atgcttcttg actaccccaa acttcaagag acctcttcac aatctacaac acaaaatcca 60

tatttaaata agttgtgatt cagacttgcg aaatattata 100

<210>288

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>288

aatcaaattc cataacaggt cctaagaaaa ggaaaatgaa ctctagtttc cttttttatg 60

actagaacaa tatattttcc tctattttat tagcttatca 100

<210>289

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>289

cgcgggttgc tctaaagccg ccgcctccgg caaagccccg tcggccgccg ccatctctgg 60

cccactccga ggacctagct cccagctcca cgcacgcgca 100

<210>290

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>290

gcttctcctt tttctgcagg caaaaatgaa gtgggagaaa agtgttaagc actgacattt 60

tcaggaaaaa tattaagatg gaaactgtga atgtaaagac 100

<210>291

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>291

acacattccc aaactcgttc cggggcacct gtgtcgggtg agcaagtcag catttggcca 60

gcaggggaac aaggcggcct ggtcctgagc ccttctgatg100

<210>292

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>292

acacaatccc tgtggaacca acacaggaca caaaggtaac tcagtccaca gccccactgc 60

gggaatgcgg gacagtggag agcgcagccc tgcaggctcc 100

<210>293

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>293

ccgcttcagg gcatacagag ggtggttctt atataagcca atggcagtgg gcaaaggctg 60

gtccatgtgt ttagcctgaa actgcaaagg ccagacagac 100

<210>294

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>294

cttcctcgct ggaggagggc ttgctccgtt tctttctgcc tcccttgttc ctcttccctt 60

tggcacttgg cctgcaggtg cccttagcaa aggtttcctc 100

<210>295

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>295

gttccaatga acctggggagaaagcaggca ttccttgtgt cagaggtcag ggcaaagggg 60

aattttcatt tccagccaag aaaataaaaa gagggagtga 100

<210>296

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>296

cgccctccga agatatgtct caaactccag ttttatcttt tcactgcaac aaatagtgaa 60

aaatctggga atgaaggggg gaactgaaac cagactccac 100

<210>297

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>297

ttcatggtag cccctctctt cagatggtgt gccttcttga ggtcacttgg aaagtccctg 60

tgtaaagacc acaggaagga agatgaagaa gactcagaca 100

<210>298

<211>100

<212>DNA

<213> Artificial sequence (chemical Synthesis)

<400>298

tgcgcagttc gcgtccccgc ggctccccgc cggccgcgcg tttccgagcc atgttgcttg 60

tctgggcaaa ttccacttcg cgagtgacgc acccggccgc 100

Claims

1. A kit for detecting effectiveness of a DNA nucleotide excision repair pathway is characterized by comprising a probe library which is composed of probes shown in SEQ ID No. 1-298 and aims at genes related to the DNA nucleotide excision repair pathway.

2. The kit for detecting the effectiveness of a DNA nucleotide excision repair pathway according to claim 1, wherein the genes related to the DNA nucleotide excision repair pathway include LIG1, PCNA, POLD1, POLD2, POLD3, POLD4, RFC1, RFC2, RFC3, RFC4, RFC5, RPA1, RPA2, RPA3, RPA4, CCNH, CDK 4, CETN 4, CUL 44, CUL4, DDB 4, ERCC 2H4, GTF2H4, MMS 4, p idle, mnle 4, mnf 2H4, uvoc 4, rpb 4, rpc 4, uvelr 4, rpc 4, uvelf 4, rpc 36.

3. The kit for detecting the effectiveness of a DNA nucleotide excision repair pathway according to claim 1, wherein the probe sequence corresponding to gene LIG1 is shown in SEQ ID No. 1-11, the probe sequence corresponding to gene PCNA is shown in SEQ ID No. 12-15, the probe sequence corresponding to gene POLD1 is shown in SEQ ID No. 16-28, the probe sequence corresponding to gene POLD2 is shown in SEQ ID No. 29-33, the probe sequence corresponding to gene POLD3 is shown in SEQ ID No. 34-37, the probe sequence corresponding to gene POLD4 is shown in SEQ ID No. 38-40, the probe sequence corresponding to gene RFC1 is shown in SEQ ID No. 41-50, the probe sequence corresponding to gene RFC2 is shown in SEQ ID No. 51-54, the probe sequence corresponding to gene 3 is shown in SEQ ID No. 55-58, and the probe sequence corresponding to gene RFC4 is shown in SEQ ID No. 59-62, the probe sequence corresponding to the gene RFC5 is shown as SEQ ID NO. 63-65, the probe sequence corresponding to the gene RPA1 is shown as SEQ ID NO. 66-71, the probe sequence corresponding to the gene RPA2 is shown as SEQ ID NO. 72-75, the probe sequence corresponding to the gene RPA3 is shown as SEQ ID NO. 76-78, the probe sequence corresponding to the gene RPA4 is shown as SEQ ID NO. 79-80, the probe sequence corresponding to the gene CCNH is shown as SEQ ID NO. 81-83, the probe sequence corresponding to the gene CDK7 is shown as SEQ ID NO. 84-86, the probe sequence corresponding to the gene CETN2 is shown as SEQ ID NO. 87-90, the probe sequence corresponding to the gene CUL3 is shown as SEQ ID NO. 91-98, the probe sequence corresponding to the gene CUL4A is shown as SEQ ID NO. 99-CU106, the probe sequence corresponding to the gene L5 is shown as SEQ ID NO. 107-98, and the probe sequence corresponding to DDB 127 is shown as SEQ ID NO. 115-1, the probe sequence corresponding to the gene DDB2 is shown as SEQ ID NO. 128-131, the probe sequence corresponding to the gene ERCC1 is shown as SEQ ID NO. 132-134, the probe sequence corresponding to the gene ERCC2 is shown as SEQ ID NO. 135-144, the probe sequence corresponding to the gene ERCC3 is shown as SEQ ID NO. 145-150, the probe sequence corresponding to the gene ERCC4 is shown as SEQ ID NO. 151-156, the probe sequence corresponding to the gene ERCC5 is shown as SEQ ID NO. 157-165, the probe sequence corresponding to the gene ERCC6 is shown as SEQ ID NO. 166-177, the probe sequence corresponding to the gene ERCC8 is shown as SEQ ID NO. 178-181, the probe sequence corresponding to the gene GTF2H1 is shown as SEQ ID NO. 188, the probe sequence corresponding to the gene GTF2H2 is shown as SEQ ID NO. 189-197, the probe sequence corresponding to the gene GTF2H3 is shown as SEQ ID NO.198, the probe sequence corresponding to the gene GTF2H 198 is shown as SEQ ID NO. 202-207, the probe sequence corresponding to the gene GTF2H5 is shown as SEQ ID number 208, the probe sequence corresponding to the gene MMS19 is shown as SEQ ID No. 209-220, the probe sequence corresponding to the gene MNAT1 is shown as SEQ ID No. 221-223, the probe sequence corresponding to the gene POLE is shown as SEQ ID No. 224-246, the probe sequence corresponding to the gene POLE2 is shown as SEQ ID No. 247-250, the probe sequence corresponding to the gene POLE3 is shown as SEQ ID No. 251-253, the probe sequence corresponding to the gene POLE4 is shown as SEQ ID No. 254-255, the probe sequence corresponding to the gene RAD23A is shown as SEQ ID No. 256-258, the probe sequence corresponding to the gene POLE 23B is shown as SEQ ID No. 259-262, the probe sequence corresponding to the gene RBX1 is shown as SEQ ID No.263, the probe sequence corresponding to the gene TCEA1 is shown as SEQ ID No. 264-266, the probe sequence corresponding to the gene ELOC is shown as SEQ ID NO.267, and the probe sequence corresponding to the gene ELOB is shown as SEQ ID NO. 268-271; the probe sequence corresponding to the gene UVSSA is shown as SEQ ID NO. 272-277; the probe sequence corresponding to the gene XAB2 is shown as SEQ ID NO. 278-286; the probe sequence corresponding to the gene XPA is shown as SEQ ID NO. 287-289; the probe sequence corresponding to the gene XPC is shown in SEQ ID NO. 290-298.

4. A method for detecting a gene associated with a DNA nucleotide excision repair pathway comprising the steps of:

(1) obtaining a DNA sample library of a subject;

5. The method according to claim 4, wherein the DNA sample library in the step (1) is composed of double-stranded DNA fragments;

6. The method according to claim 4, wherein the probe in the step (2) is selectively labeled.

7. The method according to claim 6, wherein the probe in the step (2) is labeled with biotin.