CN110846396A - ENG gene probe group for detecting pulmonary hypertension and application thereof - Google Patents

Abstract

The invention discloses an ENG gene probe group for detecting pulmonary hypertension, which is a gene probe composition for detecting endothelial factor (Endoglin, ENG) gene mutation, and the gene probe composition consists of 324 probes.

Description

ENG gene probe group for detecting pulmonary hypertension and application thereof

Technical Field

The invention belongs to the technical field of gene mutation, and particularly relates to an ENG gene probe group for detecting pulmonary hypertension and application thereof.

Background

Pulmonary arterial hypertension (PH) is a pulmonary vascular disease with mean pulmonary arterial pressure not less than 20mmHg detected by a right heart catheter in a resting state. The data from admission records in 50 hospitals in the united states showed that idiopathic and familial PH accounted for 49.7% of the total number of PH patients, some of whom were carriers of mutations in the Endoglin (ENG) gene. Therefore, the gene probe for detecting the ENG gene mutation has important significance for PH accurate diagnosis and treatment.

Disclosure of Invention

The invention aims to provide an ENG gene probe group for detecting pulmonary hypertension.

The invention also aims to provide application of the ENG gene probe group in preparing a diagnostic kit for pulmonary hypertension.

The final object of the present invention is to provide a method for in vitro detection of gene mutations in pulmonary hypertension for purposes other than disease diagnosis and treatment.

The first object of the present invention is achieved by the following technical solutions: a BMPR2 gene probe set for detecting pulmonary hypertension is a gene probe composition for detecting gene mutation of endothelial factor (ENG), and the gene probe composition consists of the following 324 probes (the positions of the gene probes on the corresponding chromosome of a human reference genome HG 19) as follows:

the ENG gene probe group is a probe combination for detecting the mutation of the ENG gene of the pulmonary hypertension related gene, and comprises a group of probe compositions aiming at the 5 'UTR region, the exon region, the splicing region and the 3' UTR region of the ENG gene.

Preferably, the probe composition covers the exon region and the expression regulatory region of the ENG gene as described above, and is a probe composition for detecting a pathogenic base mutation of the ENG gene such as base substitution, gene deletion, gene insertion.

Preferably, in the probe composition, an overlap exists between every two adjacent probe sequences, the length of the overlap between every two adjacent probe sequences is 1/2-2/3 of the length of each probe, and two or three layers of probe coverage areas are formed on each probe.

The second object of the present invention can be achieved by the following technical solutions: the ENG gene probe group is applied to the preparation of a diagnostic kit for pulmonary hypertension.

The last object of the present invention can be achieved by the following technical solutions: a method for detecting the gene mutation of pulmonary hypertension for non-disease diagnosis and treatment comprises the following steps:

(1) extracting genome DNA of a subject, or extracting RNA of the subject and reversely transcribing the RNA into cDNA;

(2) interrupting the DNA or cDNA to the range of 150-200 bp;

(3) preparing a DNA fragment library by using an illumina TruSeq DNA library preparation kit for the disrupted DNA;

(4) the DNA fragment library was hybridized with the above-mentioned ENG gene probe set to detect gene mutation.

The invention has the advantages that: compared with whole genome sequencing, the method greatly saves the required sequencing data amount; all mutations of the pathogenic genes are detected at one time, zero omission of disease gene diagnosis is realized, and guarantee is provided for disease treatment and intervention; high-depth sequencing is carried out, so that high-accuracy detection on gene mutation is realized; the cost is low, and the requirement on the sequencing data volume is not high; high-depth sequencing realizes the accuracy of mutation detection.

Detailed Description

The objects and functions of the present invention and methods for accomplishing the same will be set forth hereinafter with reference to the exemplary embodiments. However, the present invention is not limited to the exemplary embodiments disclosed below; it can be implemented in different forms. The nature of the description is merely to assist those skilled in the relevant art in a comprehensive understanding of the specific details of the invention.

Example 1

Gene sequencing is one of the great technological advances in the high-tech field in recent years, and the main principle is that a specific gene probe is captured in a target area to perform hybridization reaction with an actual sample, and information of all genes to be detected is obtained through high-throughput second-generation sequencing. The technology provides a new solution for genetic diagnosis of the pulmonary hypertension by the advantages of high flux, rapidness, high accuracy and the like, and has important effects on clinical treatment and prognosis evaluation of children patients.

In the present invention, the human reference genome is HG 19.

For purposes of the present specification and claims, reference to a gene sequence will be understood by those skilled in the art to include virtually either or both of the complementary double strands. For convenience, in the present specification and claims, although only one strand is given in most cases, the other strand complementary thereto is actually disclosed. For example, reference to a probe sequence actually includes the sequence and its complement. One skilled in the art will also appreciate that one strand may be used to detect the other strand and vice versa.

The gene sequences in this application include either the DNA form or the RNA form, one of which is disclosed, meaning the other is also disclosed. For example, reference to a probe sequence actually includes the corresponding RNA sequence.

In the present invention, probe sequences having a length of 100bp are designed from the first base in the 5 'to 3' direction of the coding sequence of the gene according to the principle of reverse complementary sequence, and there is an overlap between every two adjacent probe sequences, which is 1/2 or 2/3 of the length of the probe. For probe overlap between every two adjacent probe sequences, the overlap between every two adjacent probe sequences is 1/2 or 2/3 of the length of the probe, because 2 or 3 layers of probe coverage will be formed for each region, so the probe coverage is uniform, and thus the uniformity of capture is not affected, and the non-uniform probe coverage affects the uniformity of capture. Thus, the overlap between each two adjacent probe sequences is either 1/2 or 2/3 of the length of the probe. In the case where the overlap between each two adjacent probe sequences is 1/2 the probe length, preferably the probe length is even; in the case where the overlap between every two adjacent probe sequences is 2/3 times the length of the probe, it is preferred that the length of the probe is an integral multiple of 3. However, in the case where the probe length is not an even number or an integral multiple of 3, it is also possible to overlap the probe length 1/2 or 2/3 by an approximate integer, although the effect is not as good as in the case where the probe length is an even number or an integral multiple of 3.

At the 5 'end and 3' end of each probe sequence, TAGGTGTGTAGGCGC and GTCAGCTAGTACGCA primer sequences were added, respectively, which are primer binding sequences added for PCR amplification of the enriched probes, such that amplification of all probes was achieved using one pair of primers. For forward TTAGATAGGTGTGTAGGCGC and reverse TAAGGTGCGTACTAGCTGAC, the primers were chosen because they do not have homologous sequences on the human genome, do not interfere with PCR amplification, and do not overlap or interfere with each other.

The position table on the chromosome corresponding to the probes corresponding to the genes is shown in the following table 1:

TABLE 1 location of Gene Probe compositions on the corresponding chromosome

Example 2

1. Preparation of kit for related pathogenic gene of hereditary metabolic disease

2. The kit comprises a genetic metabolic disease related pathogenic gene DNA probe library prepared by the following method:

1) acquiring an endothelial factor (ENG) coding sequence according to a human reference genome HG19 by combining an Ensembl, CCDS, Gencode, VEGA, SNP and a CytoBand database;

2) aiming at the coding sequences of the 5 'UTR region, the exon region, the splicing region and the 3' UTR region of the ENG gene, designing probe sequences with the length of 100bp from the first base in the direction from 5 'to 3' according to the principle of reverse complementary sequences, and partially overlapping every two adjacent probe sequences;

3) adding TAGGTGTGTAGGCGC and GTCAGCTAGTACGCA sequences to the 5 'end and the 3' end of each probe sequence respectively to form a probe sequence list with the same sequence at both ends;

4) adopting oligonucleotide in-situ synthesis technology to synthesize the sequences in the probe sequence list on a chip in a large scale;

5) eluting the oligonucleotides on the chip with ammonia water, and dissolving in 100 microliters of ultrapure water to form an oligonucleotide mixture;

6) the oligonucleotide mixture is amplified by a PCR method by adopting a forward primer TTAGATAGGTGTGTAGGCGC with a biotin label at the 5 'end and a reverse primer TAAGGTGCGTACTAGCTGAC with the same label at the 5' end to form a DNA probe library of the genetic metabolic disease related pathogenic gene with the biotin label.

The reaction system is as follows: KAPA 2G Buffer B5 ×: 10 mu L of the solution; dNTP (10 mM): 1 mu L of the solution; forward primer (25 μ M): 0.5 mu L; reverse primer (25 μ M): 0.5 mu L; oligonucleotide mixture: 5 mu L of the solution; KAPA 2G robust DNA Taq: 0.8 mu L; h₂O：32.2μL。

The reaction conditions were as follows:

2. and (3) screening a kit for related pathogenic genes of the genetic metabolic diseases:

1) taking 200-500 ng of genome DNA of a human subject, and breaking the genome DNA to the range of 150-200bp by using an ultrasonic disruptor;

2) preparing a DNA small fragment library by adopting an Illumina TruSeq DNA library preparation kit;

3) carrying out liquid phase hybridization on the DNA small fragment library and the prepared genetic metabolic disease related pathogenic gene DNA probe library to capture the genetic metabolic disease related pathogenic genes;

4) PCR was performed using an Illumina PE PCR primer1.0: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCT and Illumina PE PCR primer 2.0: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT is a primer, and the captured product is amplified to obtain a sequencing library;

the reaction system is as follows: and (3) capturing a product: 10 mu L of the solution; PE PCR primer1.0 (25. mu.M): 2.5 mu L; PE PCR primer2.0 (25. mu.M): 2.5 mu L; phusion High-Fidelity 2 × PCR Master Mix: 25 mu L of the solution; ultrapure water: 10 mu L of the solution; the reaction conditions were as follows:

5) performing on-machine sequencing on the sequencing library by adopting an Illumina high-throughput sequencer Nextseq550 to obtain sequencing data of related pathogenic genes of the hereditary metabolic disease;

6) sequencing data were aligned to the human reference genome HG19 using BWA MEM software using the parameters: the method is characterized in that the method comprises the following steps of obtaining single nucleotide polymorphism, insertion or deletion which are different from a reference genome, namely detected gene mutation, by the aid of bwa mem-M-k 40-t 8-R '@ RG \ tID, Hiseq \ tPL and Illumina \ tSM, sample'.

3. Target area capture effect evaluation:

1) counting the size, the comparison rate, the repetition rate and the quality value of data by using a samtools in samtools-1.2 software, and then calculating the sequencing depth of each position in a target area by using a samtools depth in software;

2) dividing the data volume of the compared target area by the total data volume to obtain the capture efficiency;

3) and respectively counting the number of bases with the sequencing depth of more than or equal to 1, more than or equal to 4, more than or equal to 10 and more than or equal to 20 according to the sequencing depth of each position in the target area, and dividing the number of bases by the total number of bases in the target area to obtain the parameters of 1 multiplied by coverage, 4 multiplied by coverage, 10 multiplied by coverage and 20 multiplied by coverage.

The following are partial test results for partial PH patients:

patient 1:

the patient detects a deleterious mutation in the exon region, resulting in abnormal expression of the ENG gene.

Patient 2:

the patient detects a deleterious mutation in the exon region, resulting in abnormal expression of the ENG gene.

Normal control volunteers detected no deleterious mutations in the ENG gene region.

While the invention has been described in connection with preferred embodiments, it should be understood that the scope of the invention is not limited to the embodiments described herein. Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.

Claims (5)

1. An ENG gene probe group for detecting pulmonary hypertension, which is characterized in that: the ENG gene probe group is a gene probe composition for detecting gene mutation of Endoglin (ENG), and the gene probe composition consists of the following 324 probes, and is specifically as follows:

2. the ENG gene probe set for detecting pulmonary hypertension according to claim 1, wherein: the gene probe set covering the exon region and the expression regulatory region of the ENG gene as set forth in claim 1 is a gene probe set for detecting a pathogenic base mutation such as base substitution, gene deletion, gene insertion of the ENG gene.

3. The ENG gene probe set for detecting pulmonary hypertension according to claim 1, wherein: the probe composition has an overlap between every two adjacent probe sequences, the length of the overlap between every two adjacent probe sequences is 1/2-2/3 of the length of each probe, and two layers or three layers of probe coverage areas are formed on each probe.

4. Use of the ENG gene probe set according to any one of claims 1 to 3 for the preparation of a diagnostic kit for pulmonary hypertension.

5. A non-disease diagnosis and treatment purpose pulmonary hypertension gene mutation in vitro detection method is characterized by comprising the following steps:

(1) extracting genomic DNA of a subject; or extracting RNA of a subject and performing reverse transcription to obtain cDNA;

(2) interrupting the DNA or cDNA to the range of 150-200 bp;

(3) preparing a DNA fragment library by using an illumina TruSeq DNA library preparation kit for the disrupted DNA;

(4) hybridizing the DNA fragment library with the ENG gene probe set of any one of claims 1 to 3, and detecting a gene mutation.