CN110845614A

CN110845614A - Human cell surface immunoregulatory molecules

Info

Publication number: CN110845614A
Application number: CN201810955275.9A
Authority: CN
Inventors: 陈列平; 罗利群
Original assignee: Tayu Huaxia Biotech Medical Group Co ltd
Current assignee: Tayu Huaxia Biotech Medical Group Co ltd
Priority date: 2018-08-21
Filing date: 2018-08-21
Publication date: 2020-02-28

Abstract

The present invention provides isolated monoclonal antibodies or antigen-binding fragments thereof directed against human cell surface immunoregulatory molecules, comprising the heavy chain CDR1, CDR2, and CDR3 listed in table 2 and the light chain CDR1, CDR2, and CDR3 listed in table 2.

Description

Human cell surface immunoregulatory molecules

Technical Field

The invention relates to the field of biological pharmacy, in particular to a monoclonal antibody aiming at human cell surface immune regulatory molecules and application thereof in disease treatment.

Background

Programmed death receptor 1(PD-1) is an immunosuppressive receptor expressed on activated T cells and B cells. Blocking the interaction between PD-1 and one of its ligands, PD-L1, enhances the immunity of tumor-specific CD8+ T cells, thus contributing to the immune system's elimination of tumor cells. Molecular and Biochemical assays of the PD-1checkpointPathway, Vassiki A.Boussiositis, NEJM n engl j med 375; PD-1 and related studies are reviewed in detail in 18nejm.

The role of PD-1 in cancer has been established in the literature. PD-1 (on tumor infiltrating lymphocytes) and/or PD-L1 (on tumor cells) have been found in many primary tumors in humans. Such tissues include lung, liver, ovarian, cervical, skin, colon, glioma, bladder, breast, kidney, esophagus, stomach, oral squamous cell, urothelial and pancreatic cancers, as well as head and neck tumors.

Blocking the PD-1/PD-L1 interaction may lead to increased immunity of tumor-specific T cells, and thus, help in the elimination of tumor cells by the immune system.

PCT International application PCT/US2008/007463 discloses an antibody directed to the human programmed death receptor PD-1.

The PD-1/PD-L1 pathway is a well-documented target for the development of antibody therapies for cancer treatment. anti-PD-1 antibodies are also useful for chronic viral infections. Recently, studies have shown that PD-1 is highly expressed in T cells from HIV-infected individuals.

Disclosure of Invention

The present invention provides an isolated monoclonal antibody or antigen binding fragment thereof against human PD-1, comprising: the heavy chain CDRs 1, CDR2, and CDR3 listed in table 2, and the light chain CDRs 1, CDR2, and CDR3 listed in table 2.

In one embodiment, the antibody or antigen-binding fragment thereof comprises: (i) the heavy chain amino acid sequence shown in SEQ ID NO. 3 and the light chain amino acid sequence shown in SEQ ID NO. 4; or (ii) the heavy chain amino acid sequence shown in SEQ ID NO 3 which does not include a signal peptide portion and the light chain amino acid sequence shown in SEQ ID NO 4 which does not include a signal peptide portion.

Wherein, the 1 st to 19 th (i.e., MNFGLSLIFLVLVLKGVLC) of the heavy chain amino acid sequence shown in SEQ ID NO. 3 is a signal peptide portion; the 1 st to 20 th (i.e., MEKDTLLLWVLLLWVPGSTG) positions of the light chain amino acid sequence shown in SEQ ID NO. 4 are a signal peptide portion.

The signal peptide is added for the purpose of facilitating purification and the like, and is not an essential part of the antibody structure. It will be appreciated by those skilled in the art that in the antibodies or antibody fragments of the invention, the signal peptide is optional, that is, may or may not comprise a signal peptide.

The present invention also provides an isolated humanized monoclonal antibody or antigen binding fragment thereof directed to human PD-1, comprising:

(1) a heavy chain amino acid sequence selected from the group consisting of SEQ ID NOS 13, 14, 15 and 16 or SEQ ID NOS 13, 14, 15 and 16 which do not include a signal peptide portion; and

(2) a light chain amino acid sequence selected from the group consisting of SEQ ID NOs 17, 18, 19 and 20 or SEQ ID NOs 17, 18, 19 and 20 that do not include a signal peptide portion.

Wherein, the 1 st to 24 th (i.e., MDPKGSLSWRILLFLSLAFELSYG) of the heavy chain amino acid sequences shown in SEQ ID NOS 13, 14, 15 and 16 are a signal peptide portion; 17, 18, 19 and 20 (i.e., METDTLLLWVLLLWVPGSTG) are signal peptide portions.

In some embodiments, the antigen binding fragment is selected from the group consisting of: fab, Fab '-SH, Fv, scFv, F (ab')₂And diabodies.

The invention provides isolated polynucleotides encoding the antibodies or antigen binding fragments thereof.

In some embodiments, the heavy chain coding sequence of the polynucleotide is set forth in SEQ ID NO. 1 and the light chain coding sequence is set forth in SEQ ID NO. 2.

In some embodiments, the polynucleotide encodes a humanized antibody or antigen-binding fragment thereof, and the heavy chain coding sequence is selected from

SEQ ID NOs

5, 6, 7, and 8 and the light chain coding sequence is selected from

SEQ ID NOs

9, 10, 11, and 12.

The invention provides expression vectors comprising the isolated polynucleotides, and host cells comprising the expression vectors.

The invention provides a pharmaceutical composition comprising the antibody or antigen-binding fragment thereof and a pharmaceutically acceptable carrier.

The invention provides methods of increasing the activity of an immune cell comprising contacting an immune cell with the antibody or antigen-binding fragment thereof.

The invention provides a method of treating a disease, comprising administering to a subject in need of treatment a therapeutically effective amount of an antibody or antigen-binding fragment thereof of the invention.

In some embodiments, wherein the disease is selected from the group consisting of cancer, infectious disease, transplant rejection, autoimmune disease, and neurological disease. In some embodiments, the method comprises administering to the subject a combination of other drugs or therapies, including chemotherapy, radiation therapy, targeted therapy, gene therapy, cell therapy, stem cell therapy.

The invention provides the use of the antibody or antigen-binding fragment thereof in the manufacture of a medicament for the treatment of a disease, wherein the disease is selected from: cancer, infectious diseases, transplant rejection, autoimmune diseases, and neurological diseases.

The invention provides a method of modulating a function of a cell comprising delivering into the cell a polynucleotide sequence encoding an antibody or antigen-binding fragment thereof of the invention.

In some embodiments, the methods are used for gene therapy, CAR-T therapy, or CRISPR therapy.

In some embodiments, the anti-human PD-1 monoclonal antibody is generated by a PD-1 gene knock-out mouse, with higher affinity, better blocking effect, and higher cell killing activity. Test results show that the method can obtain the monoclonal antibody with high affinity. The affinity is about 4-7 times higher than that of the currently marketed PD-1 antibody, and the blocking of the PD-L1/PD-1 interaction in vitro is very effective. And the activity of inhibiting the growth of the tumor in vitro is also improved.

Drawings

FIG. 1 shows the binding activity of PD-1 antibodies to PD-1 protein.

FIG. 2 shows the blocking effect of PD-1 antibody on the binding of PD-1 protein to PD-L1 protein.

Figure 3 shows the results of different antibody competition binding experiments.

FIG. 4 shows the binding and blocking effect of the recombinant DNA antibody.

FIG. 5 shows the binding activity of humanized antibody to PD-1 protein

Figure 6 shows the blocking effect of the humanized antibody.

FIG. 7 shows the affinity comparison of different mutants of the humanized parent antibody.

Detailed Description

By "antibody" is meant any form of antibody that exhibits a desired biological activity, e.g., inhibition of binding of a ligand to its receptor or by inhibition of ligand-induced receptor signaling. Thus, "antibody" is used in its broadest sense and specifically includes, but is not limited to, monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, and multispecific antibodies (e.g., bispecific antibodies).

"antibody fragment" and "antigen-binding fragment" are used interchangeably herein to mean antigen-binding fragments and antibody analogs of an antibody, which typically include at least a portion of the antigen-binding or variable region (e.g., one or more CDRs) of a parent antibody. Antibody fragments retain at least some of the binding specificity of the parent antibody. Preferably, the antibody fragment retains at least 50%, 70%, 80%, 90%, 95%, or 100% or more of the binding affinity of the parent antibody to the target. Examples of antibody fragments include, but are not limited to: fab, Fab ', F (ab')₂And Fv fragments; a diabody; linear antibodies (linear antibodies); single chain antibody molecules, such as sc-Fv, single antibodies (technology from Genmab); nanobodies (technology from domanis); domain antibodies (technology from Ablynx); and multispecific antibodies formed from antibody fragments. Engineered antibody variants are reviewed in Holliger and Hudson (2005) nat biotechnol.23: 1126, 1136.

"Fab fragment" consists of one light chain and one heavy chain C _H1 and variable regions. The heavy chain of a Fab molecule cannot form a disulfide bond with another heavy chain molecule.

The "Fc" region contains a C comprising an antibody _H1 and C _H2 domain. Two heavy chain fragments consisting of two or more members of twoSulfur bonds and are held together by the hydrophobic interaction of the CH3 domain.

"Fab' fragment" contains one light chain and contains V_HDomains and C _H1 domain and C _H1 and C _H2 domain, whereby an interchain disulfide bond can be formed between the two heavy chains of the two Fab 'fragments to form F (ab')₂A molecule.

“F(ab′)₂Fragment "contains two light chains and two contains C _H1 and C _H2 domain, thereby forming an interchain disulfide bond between the two heavy chains. Thus, F (ab')₂The fragment consists of two Fab' fragments held together by a disulfide bond between the two heavy chains.

The "Fv region" comprises variable regions from both the heavy and light chains, but lacks the constant region.

"Single chain Fv antibody" (or "scFv antibody") refers to a V comprising an antibody_HAnd V_LAntibody fragments of domains, wherein the domains are present in a single polypeptide chain. Generally, Fv polypeptides are additionally V_HAnd V_LThe domains contain a polypeptide linker between them that enables the scFv to form the desired structure for antigen binding. See international patent application WO 88/01649.

A "diabody" is a small antibody fragment that has two antigen-binding sites. Said fragments being comprised in the same polypeptide chain as the light chain variable domain (V)_L) Linked heavy chain variable domains (V)_H)(V_H-V_LOr V_L-V_H). By using linkers that are too short to pair between two domains of the same chain, the domains are forced to pair with complementary domains of another chain and form two antigen binding sites.

The term "chimeric" antibody refers to an antibody and fragments of said antibody that exhibit the desired biological activity: wherein a portion of the heavy and/or light chains are identical or homologous to sequences corresponding to antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chains are identical or homologous to sequences corresponding to antibodies derived from another species or belonging to another antibody class or subclass (see, e.g., U.S. Pat. No. 4,816,567 and Morrison et al, 1984, Proc. Natl. Acad. Sci. USA 81: 6851-.

"humanized" forms of non-human (e.g., murine) antibodies are chimeric antibodies that contain minimal sequences derived from non-human immunoglobulins. In general, a humanized antibody comprises substantially all of at least one and typically two variable domains, wherein all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence. The humanized antibody also optionally comprises at least a portion of an immunoglobulin (typically a human immunoglobulin) constant region (Fc). For more details see Jones et al, Nature 321: 522-525 (1986); riechmann et al, Nature 332: 323-329(1988).

An "isolated" antibody is one that has been identified and separated from its natural environmental components. In some embodiments, the antibody is purified to the following extent: (1) more than 95% by weight of antibody, most preferably more than 99% by weight, as determined by the Lowry method; (2) to the extent sufficient to obtain at least 15 residues of the N-terminal or internal amino acid sequence by use of a spinning cup sequencer; or (3) homogeneity by SDS-PAGE under reducing or non-reducing conditions with Coomassie blue or preferably silver staining.

An "isolated" nucleic acid molecule is one that is identified and separated from at least one contaminating nucleic acid molecule (typically associated with it in the natural source of the antibody nucleic acid). Thus, an isolated nucleic acid molecule is distinguished from a nucleic acid molecule that is present in its natural cell.

The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible natural mutations that may be present in minor amounts. Monoclonal antibodies are highly specific and can be directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations, which typically include a plurality of different antibodies directed against a plurality of different determinants (epitopes), each monoclonal antibody is directed against only a single determinant on the antigen. The modifier "monoclonal" indicates the identity of the antibody obtained from a population of substantially homogeneous antibodies, and is not to be construed as requiring preparation of the antibody by any particular method. Monoclonal antibodies herein expressly include "chimeric" antibodies.

For further description of antibodies and their use see chinese patent application CN201510367410.4, which is incorporated herein by reference in its entirety.

The term "immune cell" as used herein includes cells that have a hematopoietic origin and play a role in the immune response. The immune cells include: lymphocytes, such as B cells and T cells; a natural killer cell; myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils and granulocytes.

As used herein, a sequence "variant" refers to a sequence that differs from the sequence shown at one or more amino acid residues, but which substantially retains its biological activity. For example, a variant may retain at least 50%, preferably at least 70%, or even 90% of the biological activity of the original sequence.

The term "about" as used herein means that a numerical value is within an acceptable error range for the particular value determined by one of ordinary skill in the art, which numerical value depends in part on how the value is measured or determined (i.e., the limits of the measurement system). For example, "about" or "substantially comprising" may mean a range of no more than 20%, preferably no more than 10%, more preferably no more than 5%. Unless otherwise indicated, when a particular value occurs herein, the meaning of "about" should be assumed to be within an acceptable error range for that particular value.

When referring to an animal, human, cell, or subject by "administering" and "treatment," it is meant that the exogenous drug, therapeutic agent, diagnostic agent, or composition is contacted with the animal, human, cell, or subject. "administration" and "treatment" can refer to, for example, methods of treatment, pharmacokinetics, diagnostics, research and experimentation. "administering" and "treatment" also mean in vitro and ex vivo treatment of cells, for example, by agents, diagnostic agents, therapies, combinations, or by other cells.

The term "therapeutically effective amount" as used herein refers to an amount of active compound sufficient to elicit the biological or medical response desired by a clinician in a subject. A "therapeutically effective amount" of an antibody of the invention can be determined by one of skill in the art based on the route of administration, the weight of the subject, the age, the condition, and the like. For example, a typical total weekly dose may be at least 0.05 μ g/kg body weight, typically at least 1 μ g/kg body weight.

The medicine provided by the invention can be prepared into clinically acceptable dosage forms such as powder, injection and the like. The pharmaceutical compositions of the invention may be administered to a subject using any suitable route, for example, orally, by intravenous infusion, intramuscularly, subcutaneously, subdermally, rectally, sublingually, or by inhalation, transdermally, and the like.

The pharmaceutical formulation of the invention comprises the PD-1 antibody or antigen-binding fragment thereof of the invention and a pharmaceutically acceptable carrier. To prepare a pharmaceutical or sterile composition, the antibody or fragment thereof is admixed with a pharmaceutically acceptable carrier (or excipient).

The pharmaceutical compositions of the present invention may also contain other agents, including but not limited to cytotoxic, cytostatic, antiangiogenic or antimetabolic agents, tumor-targeting agents, immunostimulants or immunomodulators or antibodies conjugated to cytotoxic, cytostatic or other toxic agents. The pharmaceutical compositions may also be administered with other forms of treatment, such as surgery, chemotherapy, and radiation.

An antibody or antigen-binding fragment of the invention that specifically binds to human PD-1 can be used to increase, enhance, stimulate, or up-regulate an immune response. The antibodies and antibody fragments of the invention are particularly useful for treating subjects suffering from a disease that can be treated by raising a T cell-mediated immune response. Preferred subjects include human patients in need of an increased immune response.

The antibodies or antigen-binding fragments of the invention are useful for treating cancer (i.e., inhibiting the growth or survival of tumor cells). Preferred cancers for which growth can be inhibited by the antibodies of the invention include cancers that are generally responsive to immunotherapy, but also cancers that have not been correlated with immunotherapy to date. Non-limiting examples of preferred cancers for treatment include melanoma (e.g., malignant metastatic melanoma), renal cancer (e.g., clear cell carcinoma), prostate cancer (e.g., hormone refractory prostate adenocarcinoma), pancreatic adenocarcinoma, breast cancer, colon cancer, lung cancer (e.g., non-small cell lung cancer), esophageal cancer, head and neck squamous cell carcinoma, liver cancer, ovarian cancer, cervical cancer, thyroid cancer, glioblastoma, glioma, leukemia, lymphoma, and other malignancies. In addition, the invention includes refractory or recurrent cancers whose growth can be inhibited by the antibodies of the invention.

The antibodies of the invention or antigen binding fragments thereof may be used alone or in combination with other agents: anti-neoplastic or immunogenic agents (e.g., attenuated cancer cells, tumor antigens (including recombinant proteins, peptides and carbohydrate molecules), antigen presenting cells such as dendritic cells stimulated with tumor-derived antigens or nucleic acids, immunostimulatory cytokines (e.g., IL-2, IFNa2, GM-CSF), and cells transfected with genes encoding immunostimulatory cytokines (e.g., but not limited to GM-CSF), standard cancer treatments (e.g., chemotherapy, radiation therapy or surgery), or other antibodies (including but not limited to antibodies to VEGF, EGFR, Her2/neu, VEGF receptors, other growth factor receptors, CD20, CD40, CTLA-4, OX-40, 4-IBB, and ICOS).

The antibodies or antigen binding fragments thereof of the invention may also be used to prevent or treat infections and infectious diseases. The antibodies or antigen binding fragments thereof may be used alone or in combination with vaccines to stimulate an immune response against pathogens, toxins and autoantigens. The antibodies or antigen binding fragments thereof can be used to stimulate an immune response to a virus that infects humans, such as, but not limited to, human immunodeficiency virus, hepatitis a, b, c virus, epstein-barr virus, human cytomegalovirus, human papilloma virus, herpes virus. The antibodies or antigen-binding fragments thereof can be used to stimulate an immune response to infection by bacterial or fungal parasites and other pathogens.

The antibodies or antigen-binding fragments thereof of the invention may also be used to prevent or treat transplant rejection, autoimmune diseases, and neurological diseases.

The term "autoimmune disease" as used herein refers to any disease caused by an autoimmune response, i.e. an immune response directed against a substance in the body of a subject.

It should be noted that since autoimmunity can affect any organ or tissue of a subject, such as the brain, skin, kidney, lung, liver, heart or thyroid of a subject, the clinical manifestation of the disease depends on the affected site.

Exemplary autoimmune diseases include, but are not limited to, rheumatoid arthritis, psoriatic arthritis, osteoarthritis, still's disease, juvenile arthritis, lupus, diabetes, myasthenia gravis, hashimoto's thyroiditis, alder's thyroiditis, graves ' disease, rheumatoid arthritis syndrome, multiple sclerosis, infectious neuronitis, acute disseminated encephalomyelitis, addison's disease, ocular clonus-myoclonus syndrome, ankylosing spondylitis, antiphospholipid antibody syndrome, aplastic anemia, autoimmune hepatitis, celiac disease, goodpasture's syndrome, idiopathic thrombocytopenic purpura, optic neuritis, scleroderma, primary biliary cirrhosis, reiter's syndrome, takayasu's arteritis, temporal arteritis, warm autoimmune hemolytic anemia, Werner's granulomatosis, psoriatic disease, autoimmune hemolytic anemia, inflammatory bowel disease, inflammatory bowel disease, inflammatory, Systemic alopecia, behcet's disease, chronic fatigue, familial autonomic dysfunction, endometriosis, interstitial cystitis, neuromuscular stiffness, scleroderma, vulvodynia, and the like.

The term "neurological disease" as used herein refers to a disease or condition that affects the central nervous system and/or has an etiology in the central nervous system. Specific examples of illustrative neurological disorders include, but are not limited to: parkinson's disease, Alzheimer's disease, prion disease, Huntington's disease, Rett syndrome, and the like.

The anti-PD-1 antibodies or antigen-binding fragments thereof of the invention can be used in combination with other drugs or therapies, for example, in combination with one or more other therapeutic agents (e.g., a cytotoxic agent, a radiotoxic agent, or an immunosuppressive agent). The antibody may be linked to the agent (as an immunocomplex), or may be administered separately from the therapeutic agent, e.g., the antibody may be administered before, after, or simultaneously with the administration of the therapeutic agent. In addition, the antibody of the present invention can be used in combination with chemotherapy, radiotherapy, targeted therapy, gene therapy, cell therapy, stem cell therapy, etc., particularly for the treatment of cancer.

The anti-PD-1 antibodies or antigen-binding fragments thereof or genes encoding the same of the invention can also be introduced into cells to modulate cell function or activity, or to treat diseases. The methods include in vitro applications and in vivo applications. The method is particularly suitable for use in gene therapy, CAR-T therapy or CRISPR therapy.

Non-therapeutic applications of the antibodies and antibody fragments of the invention include: for flow cytometry analysis, immunohistochemistry and in vitro functional analysis, western blotting and ELISA, etc. The antibodies of the invention may also be used as affinity purification reagents.

The antibodies may also be used in diagnostic assays, for example to detect the expression of PD-1 in specific cells, tissues or serum. For diagnostic applications, the antibody is typically labeled (directly or indirectly) with a detectable moiety. A number of markers are available, which are generally classified into the following categories: biotin, fluorescent dyes, radionucleotides, enzymes, iodine and biosynthetic markers.

The antibodies of the invention can be used in any known assay, such as competitive binding assays, direct and indirect sandwich assays and immunoprecipitation assays. Antibodies may also be used in vivo diagnostic assays. For example with radionuclides (e.g. with radionuclides)¹¹¹In、⁹⁹Tc、⁴C、³1I、¹²⁵I、³H、³²P、³⁵S or¹⁸F) The antibody is labeled in order to locate the antigen or cells expressing the antibody.

The invention will be more fully understood by reference to the following examples. However, these examples should not be construed as limiting the scope of the invention.

EXAMPLE 1 Generation and screening of PD-1 antibodies

1. Production of human PD-1 fusion protein

Utilization of M from human Peripheral Blood Mononuclear Cells (PBMC)T lymphocytes were isolated from ACS magnetic beads (Miltenyi Biotec), RNA (RNeasy mini kit, QIAGEN) was extracted and First strand cDNA (SuperScript First-StrandSynthesis System, Invitrogen) was obtained and the full-length Sequence of the human PD-1 molecule was obtained by PCR reaction based on the DNA Sequence of the human PD-1 gene (NCBI Reference Sequence: NM-005018.2). The human PD-1 fusion protein is obtained by inserting the extracellular part sequence of the PD-1 molecule into an expression plasmid mIgV (H Dong et al Nat Med.1999; 5:1365-1369) containing the mouse immunoglobulin G2aCH2-CH3 domain. Use of a transient expression method for the application of PEI reagent to plasmid DNASigma- Aldrich) 293T cells were transfected to produce human PD-1 mouse Ig fusion Protein (hPD-1mIg), and the cell secretory supernatant was purified of the Protein by IgA purification column (HiTrap Protein A HP, GE healthcare) and identified by SDS-PAGE gel electrophoresis.

2. Construction of PD-1 stably expressing cell line

In order to detect and identify the PD-1 antibody, a cell strain for stably expressing the human PD-1 protein is constructed. The PD-1 full-length sequence obtained above was inserted into pcDNA3.1(-) expression plasmid, Chinese hamster ovary fibroblasts (CHO) were transfected with lipofectamin 2000 transfection reagent (ThermoFisher Scientific), and a positive cell line (CHO/hPD1) stably expressed was obtained by G418 selection.

3. Immunization of mice

6-8 week-old female Balb/c mice were immunized by subcutaneous multiple spot vaccination with a mixed emulsion of hPD-1mIg fusion protein and Freund's complete adjuvant (CFA, Sigma), 80-100. mu.g protein per mouse, 3 weeks later, boosted with the same fusion protein and incomplete adjuvant (IFA, Sigma) emulsion, 3 times in total. Serum was taken about 2 weeks after immunization of mice each time to determine the antibody titer, which was determined by flow cytometry using CHO/hPD1 cells. Secondary antibodies were fluorescently labeled goat anti-mouse igg (ebioscience). When the serum titer reached a sufficiently high level, 80. mu.g of hPD-1mIg fusion protein was dissolved in PBS and the booster was injected intraperitoneally once, and 5 days later the spleen was removed for fusion.

4. Preparation and screening of hybridomas

Hybridoma cells are generated by fusing splenocytes of an immunized mouse with a mouse myeloma cell line (SP2/0-Ag14) under the action of polyethylene glycol (PEG1500, Roche) fusion agent, selectively culturing the fused cells by HAT (Sigma Aldrich), identifying culture supernatant by using a high-throughput transfection and screening system (S Yao et al. Immunity.2011; 34(5):729-40.) established in our laboratory, and detecting the screened positive monoclonal antibody by a flow cytometer to confirm that the positive monoclonal antibody can be combined with PD-1 positive expression cells. The selected positive clone cell strain is subjected to subclone selection by a limiting dilution method for more than 5 times, and is ensured to be a positive clone with a single source.

Example 2 characterization of anti-PD-1 monoclonal antibody

1. Identification of monoclonal antibody isoforms (isotype)

The obtained several monoclonal antibodies were measured with a Mouse IgG isotype detection Kit (Mouse immunoglobulin isotyping Kit, BD Biosciences), and 5 monoclonal antibodies were IgG1 in heavy chains and kappa chains in light chains.

2. Evaluation of specific binding of monoclonal antibodies

1) Species cross-reactive identification showed that several PD-1 antibody clones only bound to human PD-1 protein and no cross-binding to mouse PD-1.

2) Binding reaction of PD-1 antibody with PD-1 protein: the 5 PD-1 antibodies obtained in our laboratory were detected and compared by flow cytometry and the binding activity of CHO/hPD-1 cells, and the results show that the antibodies have stronger binding activity with PD-1 protein (FIG. 1).

3) Blocking effect of PD-1 antibody on binding of PD-1 receptor protein and its ligand PD-L1: the PD-L1 ligand protein expressed on tumor cells is combined with PD-1 receptor expressed on lymphocytes to induce the generation of immune cell function inhibition, so that the tumor evades the monitoring effect of host immune system, and the blocking of the interaction between PD-1 and PD-L1 is an important action mechanism of the PD-1 antibody anti-tumor immunotherapy. To test the blocking activity of the antibodies, we mixed 100ng of hPD-1hIg fusion protein with different PD-1 antibodies at different doses of 100ng, 200ng, 400ng and 800ng, respectively, and set mIgG and PBS buffer controls. Incubating at 4 ℃ for 30 minutes, then acting with PD-L1 positive expression cells (CHO/PD-L1) at 4 ℃ for 30 minutes, centrifuging and washing once by using PBS buffer solution containing 1% calf serum, adding fluorescent labeled goat anti-human IgG, incubating at 4 ℃ for 20 minutes, and detecting by using a flow cytometer after washing. The results showed that 2 PD-1 antibodies had no blocking activity and the remaining 3 antibodies were able to block the binding between PD-1 and PD-L1 protein dose-dependently (fig. 2).

4) Antibody competition binding experiments: to ascertain whether these PD-1 antibodies recognize the same or different epitopes, we performed antibody competitive binding experiments. 10 μ g of each of the different PD-1 antibodies was incubated with CHO/hPD-1 cells at 4 ℃ for 30 minutes, washed once by centrifugation in PBS buffer containing 1% calf serum, 0.1 μ g of Biotin-labeled Ab4 or Ab5 was added, incubated at 4 ℃ for 20 minutes, washed with fluorescently labeled Streptavidin (Streptavidin, SA; eBioscience), incubated at 4 ℃ for 20 minutes, and then analyzed by flow cytometry. The results showed that Ab4 and Ab5 compete with each other for binding to the same epitope, with both antibodies having partial competition binding with Ab3 and no competition binding with Ab1 and Ab2 (fig. 3).

Example 3 sequencing and humanization of anti-PD-1 antibodies

To enable the use of the PD-1 antibody for clinical tumor therapy, we selected Ab4 for sequencing and humanization based on the above test results of antibody activity.

1. Sequencing of monoclonal antibodies

Total RNA was first extracted and purified from hybridoma cells using an RNA purification Kit (RAeasy Mini Kit, Qiagen 74104, qiahredder, Qiagen 79654). The RNA was then reverse transcribed to synthesize the first strand cDNA strand using a Kit (SMARER RACE cDNAamplification Kit, Clontech) according to the company's reagent instructions manual. PCR was performed using 5' RACE technique, universal primer UPM (univariate primer) provided in the kit as the upstream primer, and gene specific primer GSP (genetic primer) designed based on the gene sequences of mouse IgG1 heavy chain variable region and light chain kappa chain as the downstream primer, and SMART first chain cDNA as template. The PCR products were then ligated separately into T-vectors (Zero Blunt TOPO PCR Cloning Kit, Invitrogen K2875-J10). Selecting clone, carrying out sequence determination and analysis to respectively obtain the light chain and heavy chain variable region sequences of the antibody, designing primers according to the heavy chain variable region sequence and the mouse IgG1 sequence, obtaining the full-length sequence of the heavy chain by PCR, and analyzing the sequences by VBASE2 to determine the amino acid sequences and the corresponding CDR regions of the light chain and the heavy chain of the antibody (see Table 2). The DNA coding sequences are shown in Table 1.

2. Monoclonal antibody DNA recombination sequences and antibody expression

To ensure the correctness of the cloned antibody sequence, the full-length light and heavy chain sequences of the antibody are respectively inserted into pcDNA3.1(-) expression plasmid, and protein products are obtained by transient transformation of 293T cells, and are purified and identified to be capable of binding with PD-1 protein (FIG. 4.A) and blocking the binding of PD-1 protein and PD-L1 (FIG. 4.B) as well as the original antibody.

3. Humanization of antibody sequences

In order to enable the use of antibodies for clinical patient therapy, antibody sequences have been humanised. The Fc portion of the antibody heavy chain was first exchanged for human IgG4 sequence, and the CPSCP of IgG hinge region 4 was exchanged for CPPCP of IgG1 (S228P), while the antibody light chain was exchanged for human kappa chain, to obtain the parent antibody of human-mouse chimera (chimeric Ab). After confirming the functional activity of the parent antibody, the heavy chain variable region and the light chain variable region were humanized, and the 3 humanized heavy chain variants (SEQ ID NOS: 6-8 in Table 3 and SEQ ID NOS: 14-16 in Table 4) and 3 humanized light chain variants (SEQ ID NOS: 10-12 in Table 3 and SEQ ID NOS: 18-20 in Table 4) were combined with each other to give 9 different variant sequences (variants 1 to 9). Respectively cloning 1 maternal sequence and 9 variant sequences into a high expression vector, transiently transfecting 293 cells to obtain an antibody supernatant, and verifying the purified antibody to be correct through SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and sequencing. The DNA and amino acid sequences of the antibodies are shown in tables 3 and 4. Wherein the heavy chain amino acid sequence of variant 1 is SEQ ID NO:6, the light chain amino acid sequence is SEQ ID NO: 10; the heavy chain amino acid sequence of variant 2 is SEQ ID NO:6, the light chain amino acid sequence is SEQ ID NO: 11; the heavy chain amino acid sequence of variant 3 is SEQ ID NO:6, the light chain amino acid sequence is SEQ ID NO: 12; the heavy chain amino acid sequence of variant 4 is SEQ ID NO:7, the light chain amino acid sequence is SEQ ID NO. 10; the heavy chain amino acid sequence of variant 5 is SEQ ID NO:7, the light chain amino acid sequence is SEQ ID NO: 11; the heavy chain amino acid sequence of variant 6 is SEQ ID NO:7, the light chain amino acid sequence is SEQ ID NO: 12; the heavy chain amino acid sequence of variant 7 is SEQ ID NO:8, the light chain amino acid sequence is SEQ ID NO: 10; the heavy chain amino acid sequence of variant 8 is SEQ ID NO:8, the light chain amino acid sequence is SEQ ID NO: 11; the heavy chain amino acid sequence of variant 9 is SEQ ID NO:8, the light chain amino acid sequence is SEQ ID NO: 12.

EXAMPLE 4 Properties and Functions of humanized antibodies

1. Binding activity of humanized antibody to PD-1 protein: the chimeric female parent and the mutant antibody are tested and compared, CHO/hPD-1 cells are taken to be suspended in PBS containing 1% calf serum and are subpackaged in flow tubes, different doses of the female parent and the mutant antibody are respectively added, incubation is carried out for 30 minutes at 4 ℃, after the female parent and the mutant antibody are centrifugally washed once by PBS containing 1% calf serum, a fluorescently-labeled goat anti-human IgG secondary antibody (eBioscience) is added, incubation is carried out for 20 minutes at 4 ℃, and then analysis is carried out by a flow cytometer. The results showed that all humanized mutants bound to PD-1 protein, and that some of the partially mutated antibodies had higher binding capacity and some were relatively lower compared to the chimeric parent antibody (fig. 5).

2. Blocking effect of humanized antibody on binding of PD-1 receptor protein and its ligand PD-L1: 400ng, 300ng, 200ng, 100ng and 50ng of different PD-1 antibodies are respectively mixed with 100ng of hPD-1mIg fusion protein, hIgG and PBS buffer solution control groups are set, incubation is carried out for 30 minutes at 4 ℃, then the hIgG and PBS buffer solution control groups act on PD-L1 positive expression cells (CHO/PD-L1) for 30 minutes, after being centrifugally washed by PBS buffer solution containing 1% of calf serum, fluorescent labeled goat anti-mouse IgG is added, incubation is carried out for 20 minutes at 4 ℃, and after being washed, detection is carried out by a flow cytometer. The results showed that all humanized mutant antibodies were able to block the binding between PD-1 and PD-L1 protein in a dose-dependent manner, with some mutants blocking more than the parent antibody (fig. 6).

3. (ii) humanized antibody affinity; the affinity analysis comparison of the parent and mutant antibodies was performed using a Biacore instrument (Biacore T100, GE Healthcare LifeSciences). Protein antigens hPD-1mIg were conjugated to the surface of a CM5 chip, antibodies were detected as analytes (mobile phase), and interactions were detected. The results showed that the mutant antibodies had a slightly different binding rate (Ka) compared to the parent antibody, 2 mutants had a slightly slower dissociation rate (Kd) than the chimeric antibody, and the parent antibody had an affinity (Kd) of 9.89E-11M, a stronger affinity, and 2 mutant Kd values close to those of the chimeric antibody (fig. 7).

Table 1 PD-1 monoclonal antibody DNA sequence (corresponding to Ab4)

Heavy chain sequence (SEQ ID NO:1)

ATGAATTTCGGGCTCAGCTTGATTTTCCTTGTCCTTGTTTTAAAAGGTGTCCTGTGTGAAGTGAAGTTGGTGGAGTCTGGGGGAGGTTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATACCATGTCTTGGATTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCATACATTAGTCATGGTGGTGGTGACACCTACTATCCAGACACTGTAAAGGGCCGATTCACCATCTCCAGGGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACGGCCATGTATTACTGTGCAAGACATAGTGGTTACGAGAGGGGATATTACTATGTTATGGATTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGCCAAAACGACACCCCCATCTGTCTATCCACTGGCCCCTGGATCTGCTGCCCAAACTAACTCCATGGTGACCCTGGGATGCCTGGTCAAGGGCTATTTCCCTGAGCCAGTGACAGTGACCTGGAACTCTGGATCCCTGTCCAGCGGTGTGCACACCTTCcCAGCTGTCCTGCAGTCTGACCTCTACACTCTGAGCAGCTCAGTGACTGTCCCCTCCAGCACCTGGCCCAGCGAGACCGTCACCTGCAACGTTGCCCACCCGGCCAGCAGCACCAAGGTGGACAAGAAAATTGTGCCCAGGGATTGTGGTTGTAAGCCTTGCATATGTACAGTCCCAGAAGTATCATCTGTCTTCATCTTCCCCCCAAAGCCCAAGGATGTGCTCACCATTACTCTGACTCCTAAGGTCACGTGTGTTGTGGTAGACATCAGCAAGGATGATCCCGAGGTCCAGTTCAGCTGGTTTGTAGATGATGTGGAGGTGCACACAGCTCAGACGCAACCCCGGGAGGAGCAGTTCAACAGCACTTTCCGCTCAGTCAGTGAACTTCCCATCATGCACCAGGACTGGCTCAATGGCAAGGAGTTCAAATGCAGGGTCAACAGTGCAGCTTTCCCTGCCCCCATCGAGAAAACCATCTCCAAAACCAAAGGCAGACCGAAGGCTCCACAGGTGTACACCATTCCACCTCCCAAGGAGCAGATGGCCAAGGATAAAGTCAGTCTGACCTGCATGATAACAGACTTCTTCCCTGAAGACATTACTGTGGAGTGGCAGTGGAATGGGCAGCCAGCGGAGAACTACAAGAACACTCAGCCCATCATGGACACAGATGGCTCTTACTTCGTCTACAGCAAGCTCAATGTGCAGAAGAGCAACTGGGAGGCAGGAAATACTTTCACCTGCTCTGTGTTACATGAGGGCCTGCACAACCACCATACTGAGAAGAGCCTCTCCCACTCTCCTGGTAAATGA

Light chain sequence (SEQ ID NO:2)

ATGGAGAAAGACACACTCCTGCTATGGGTCCTGCTTCTCTGGGTTCCAGGTTCCACAGGTGACATTGTGCTGACCCAATTTCCAACTTCTTTGGCTGTGTCTCTAGGGCAGAGGGCCACCATCTCCTGCAGAGCCAGCGAAAGTGTTGATTACTATGGCTTTAGTTTTATAAACTGGTTCCAACAGAAACCAGGACAGCCACCCAAACTCCTCATCTATGCTGCATCCAACCAGGGATCCGGGGTCCCTGCCAGGTTTGGTGGCAGTGGGTCTGGGACAGACTTCAGCCTCAACATCCATCCTATGGAGGAGGATGATACTGCAATGTATTTCTGTCAGCAAAGTAAGGAGGTTCCGTGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAACGGGCTGATGCTGCACCAACTGTATCCATCTTCCCACCATCCAGTGAGCAGTTAACATCTGGAGGTGCCTCAGTCGTGTGCTTCTTGAACAACTTCTACCCCAAAGACATCAATGTCAAGTGGAAGATTGATGGCAGTGAACGACAAAATGGCGTCCTGAACAGTTGGACTGATCAGGACAGCAAAGACAGCACCTACAGCATGAGCAGCACCCTCACGTTGACCAAGGACGAGTATGAACGACATAACAGCTATACCTGTGAGGCCACTCACAAGACATCAACTTCACCCATTTAA

TABLE 2 amino acid sequence of PD-1 monoclonal antibody (corresponding to Ab4)

Heavy chain sequence (SEQ ID NO:3)

Light chain sequence (SEQ ID NO:4)

TABLE 3 maternal and humanized variant DNA sequences of the PD-1 monoclonal antibody

Monoclonal antibody female parent heavy chain hIgG4-S228P (SEQ ID NO:5)

ATGGACCCCAAGGGCAGCCTGAGCTGGAGAATCCTGCTGTTCCTGAGCCTGGCCTTCGAGCTGAGCTACGGCGAAGTGAAGTTGGTGGAGTCTGGGGGAGGTTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATACCATGTCTTGGATTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCATACATTAGTCATGGTGGTGGTGACACCTACTATCCAGACACTGTAAAGGGCCGATTCACCATCTCCAGGGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACGGCCATGTATTACTGTGCAAGACATAGTGGTTACGAGAGGGGATATTACTATGTTATGGATTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGCTAGCACCAAGGGCCCCAGCGTGTTTCCTCTCGCTCCCTGCAGCCGGAGCACATCCGAGAGCACCGCTGCTCTGGGCTGTCTCGTGAAGGACTACTTCCCTGAACCCGTCACCGTCAGCTGGAATAGCGGCGCCCTGACATCCGGCGTCCACACATTCCCCGCTGTCCTGCAGAGCAGCGGCCTGTACAGCCTGAGCTCCGTGGTCACCGTGCCTAGCAGCAGCCTGGGAACAAAGACCTACACCTGCAACGTGGACCATAAGCCCTCCAACACCAAGGTGGACAAGCGGGTGGAATCCAAGTATGGACCCCCCTGTCCTCCTTGCCCTGCTCCTGAATTTCTCGGAGGCCCCTCCGTCTTCCTGTTTCCCCCCAAGCCCAAGGACACCCTGATGATCTCCCGGACACCCGAAGTCACCTGCGTCGTGGTGGATGTCAGCCAGGAAGATCCCGAGGTGCAGTTCAACTGGTACGTGGACGGAGTGGAGGTGCATAACGCCAAAACCAAGCCCAGGGAAGAGCAGTTCAACAGCACCTATCGGGTCGTGTCCGTGCTCACCGTCCTGCATCAGGATTGGCTCAACGGCAAGGAGTACAAGTGCAAGGTGTCCAACAAGGGCCTGCCCTCCTCCATCGAGAAGACCATCTCCAAGGCTAAGGGCCAACCTCGGGAGCCCCAAGTGTATACCCTCCCTCCCAGCCAGGAGGAGATGACCAAGAATCAAGTGAGCCTGACCTGCCTCGTGAAGGGATTTTACCCCTCCGACATCGCTGTGGAATGGGAAAGCAATGGCCAACCTGAGAACAACTACAAGACCACACCCCCCGTGCTGGACTCCGATGGCTCCTTCTTCCTGTACAGCAGGCTGACCGTGGACAAATCCCGGTGGCAAGAGGGAAACGTGTTCAGCTGCTCCGTGATGCACGAGGCTCTCCACAACCACTACACCCAGAAGAGCCTCTCCCTGAGCCTCGGCAAGTAG

Humanized heavy chain variant 1(SEQ ID NO:6)

ATGGACCCCAAGGGCAGCCTGAGCTGGAGAATCCTGCTGTTCCTGAGCCTGGCCTTCGAGCTGAGCTACGGCGAAGTGCAGCTGGTGGAATCTGGCGGCGGACTGGTGCAGCCTGGCGGATCTCTGAGACTGTCTTGTGCCGCCTCCGGCTTCACCTTCTCCAGCTACACCATGTCCTGGGTGCGACAGGCTCCTGGCAAGGGCCTGGAATGGGTGTCCTACATCTCTCACGGCGGAGGCGACACCTACTACGCCGACTCTGTGAAGGGCCGGTTCACCATCTCCCGGGACAACTCCAAGAACACCCTGTACCTGCAGATGAACTCCCTGCGGGCCGAGGACACCGCCGTGTACTACTGTGCTCGGCACTCTGGCTACGAGCGGGGCTACTACTACGTGATGGACTACTGGGGCCAGGGCACCCTCGTGACCGTGTCATCTGCTAGCACCAAGGGCCCCAGCGTGTTTCCTCTCGCTCCCTGCAGCCGGAGCACATCCGAGAGCACCGCTGCTCTGGGCTGTCTCGTGAAGGACTACTTCCCTGAACCCGTCACCGTCAGCTGGAATAGCGGCGCCCTGACATCCGGCGTCCACACATTCCCCGCTGTCCTGCAGAGCAGCGGCCTGTACAGCCTGAGCTCCGTGGTCACCGTGCCTAGCAGCAGCCTGGGAACAAAGACCTACACCTGCAACGTGGACCATAAGCCCTCCAACACCAAGGTGGACAAGCGGGTGGAATCCAAGTATGGACCCCCCTGTCCTCCTTGCCCTGCTCCTGAATTTCTCGGAGGCCCCTCCGTCTTCCTGTTTCCCCCCAAGCCCAAGGACACCCTGATGATCTCCCGGACACCCGAAGTCACCTGCGTCGTGGTGGATGTCAGCCAGGAAGATCCCGAGGTGCAGTTCAACTGGTACGTGGACGGAGTGGAGGTGCATAACGCCAAAACCAAGCCCAGGGAAGAGCAGTTCAACAGCACCTATCGGGTCGTGTCCGTGCTCACCGTCCTGCATCAGGATTGGCTCAACGGCAAGGAGTACAAGTGCAAGGTGTCCAACAAGGGCCTGCCCTCCTCCATCGAGAAGACCATCTCCAAGGCTAAGGGCCAACCTCGGGAGCCCCAAGTGTATACCCTCCCTCCCAGCCAGGAGGAGATGACCAAGAATCAAGTGAGCCTGACCTGCCTCGTGAAGGGATTTTACCCCTCCGACATCGCTGTGGAATGGGAAAGCAATGGCCAACCTGAGAACAACTACAAGACCACACCCCCCGTGCTGGACTCCGATGGCTCCTTCTTCCTGTACAGCAGGCTGACCGTGGACAAATCCCGGTGGCAAGAGGGAAACGTGTTCAGCTGCTCCGTGATGCACGAGGCTCTCCACAACCACTACACCCAGAAGAGCCTCTCCCTGAGCCTCGGCAAGTAG

Humanized heavy chain variant 2(SEQ ID NO:7)

ATGGACCCCAAGGGCAGCCTGAGCTGGAGAATCCTGCTGTTCCTGAGCCTGGCCTTCGAGCTGAGCTACGGCGAAGTGCAGCTGGTGGAATCTGGCGGCGGACTGGTGCAGCCTGGCGGATCTCTGAGACTGTCTTGTGCCGCCTCCGGCTTCACCTTCTCCAGCTACACCATGTCCTGGGTGCGACAGGCTCCTGGCAAGGGCCTGGAATGGGTGTCCTACATCTCTCACGGCGGAGGCGACACCTACTACCCCGACTCTGTGAAGGGCCGGTTCACCATCTCCCGGGACAACTCCAAGAACACCCTGTACCTGCAGATGAACTCCCTGCGGGCCGAGGACACCGCCGTGTACTACTGTGCTCGGCACTCTGGCTACGAGCGGGGCTACTACTACGTGATGGACTACTGGGGCCAGGGCACCCTCGTGACCGTGTCATCTGCTAGCACCAAGGGCCCCAGCGTGTTTCCTCTCGCTCCCTGCAGCCGGAGCACATCCGAGAGCACCGCTGCTCTGGGCTGTCTCGTGAAGGACTACTTCCCTGAACCCGTCACCGTCAGCTGGAATAGCGGCGCCCTGACATCCGGCGTCCACACATTCCCCGCTGTCCTGCAGAGCAGCGGCCTGTACAGCCTGAGCTCCGTGGTCACCGTGCCTAGCAGCAGCCTGGGAACAAAGACCTACACCTGCAACGTGGACCATAAGCCCTCCAACACCAAGGTGGACAAGCGGGTGGAATCCAAGTATGGACCCCCCTGTCCTCCTTGCCCTGCTCCTGAATTTCTCGGAGGCCCCTCCGTCTTCCTGTTTCCCCCCAAGCCCAAGGACACCCTGATGATCTCCCGGACACCCGAAGTCACCTGCGTCGTGGTGGATGTCAGCCAGGAAGATCCCGAGGTGCAGTTCAACTGGTACGTGGACGGAGTGGAGGTGCATAACGCCAAAACCAAGCCCAGGGAAGAGCAGTTCAACAGCACCTATCGGGTCGTGTCCGTGCTCACCGTCCTGCATCAGGATTGGCTCAACGGCAAGGAGTACAAGTGCAAGGTGTCCAACAAGGGCCTGCCCTCCTCCATCGAGAAGACCATCTCCAAGGCTAAGGGCCAACCTCGGGAGCCCCAAGTGTATACCCTCCCTCCCAGCCAGGAGGAGATGACCAAGAATCAAGTGAGCCTGACCTGCCTCGTGAAGGGATTTTACCCCTCCGACATCGCTGTGGAATGGGAAAGCAATGGCCAACCTGAGAACAACTACAAGACCACACCCCCCGTGCTGGACTCCGATGGCTCCTTCTTCCTGTACAGCAGGCTGACCGTGGACAAATCCCGGTGGCAAGAGGGAAACGTGTTCAGCTGCTCCGTGATGCACGAGGCTCTCCACAACCACTACACCCAGAAGAGCCTCTCCCTGAGCCTCGGCAAGTAG

Humanized heavy chain variant 3(SEQ ID NO:8)

ATGGACCCCAAGGGCAGCCTGAGCTGGAGAATCCTGCTGTTCCTGAGCCTGGCCTTCGAGCTGAGCTACGGCGAAGTGAAGCTGCTGGAATCTGGCGGCGGACTGGTGCAGCCTGGCGGATCTCTGAGACTGTCTTGTGCCGCCTCCGGCTTCACCTTCTCCAGCTACACCATGTCCTGGGTGCGACAGGCTCCTGGCAAGGGCCTGGAATGGGTGTCCTACATCTCTCACGGCGGAGGCGACACCTACTACCCCGACTCTGTGAAGGGCCGGTTCACCATCTCCCGGGACAACTCCAAGAACACCCTGTACCTGCAGATGAACTCCCTGCGGGCCGAGGACACCGCCGTGTACTACTGTGCTCGGCACTCTGGCTACGAGCGGGGCTACTACTACGTGATGGACTACTGGGGCAAGGGCACCACCGTGACCGTGTCATCTGCTAGCACCAAGGGCCCCAGCGTGTTTCCTCTCGCTCCCTGCAGCCGGAGCACATCCGAGAGCACCGCTGCTCTGGGCTGTCTCGTGAAGGACTACTTCCCTGAACCCGTCACCGTCAGCTGGAATAGCGGCGCCCTGACATCCGGCGTCCACACATTCCCCGCTGTCCTGCAGAGCAGCGGCCTGTACAGCCTGAGCTCCGTGGTCACCGTGCCTAGCAGCAGCCTGGGAACAAAGACCTACACCTGCAACGTGGACCATAAGCCCTCCAACACCAAGGTGGACAAGCGGGTGGAATCCAAGTATGGACCCCCCTGTCCTCCTTGCCCTGCTCCTGAATTTCTCGGAGGCCCCTCCGTCTTCCTGTTTCCCCCCAAGCCCAAGGACACCCTGATGATCTCCCGGACACCCGAAGTCACCTGCGTCGTGGTGGATGTCAGCCAGGAAGATCCCGAGGTGCAGTTCAACTGGTACGTGGACGGAGTGGAGGTGCATAACGCCAAAACCAAGCCCAGGGAAGAGCAGTTCAACAGCACCTATCGGGTCGTGTCCGTGCTCACCGTCCTGCATCAGGATTGGCTCAACGGCAAGGAGTACAAGTGCAAGGTGTCCAACAAGGGCCTGCCCTCCTCCATCGAGAAGACCATCTCCAAGGCTAAGGGCCAACCTCGGGAGCCCCAAGTGTATACCCTCCCTCCCAGCCAGGAGGAGATGACCAAGAATCAAGTGAGCCTGACCTGCCTCGTGAAGGGATTTTACCCCTCCGACATCGCTGTGGAATGGGAAAGCAATGGCCAACCTGAGAACAACTACAAGACCACACCCCCCGTGCTGGACTCCGATGGCTCCTTCTTCCTGTACAGCAGGCTGACCGTGGACAAATCCCGGTGGCAAGAGGGAAACGTGTTCAGCTGCTCCGTGATGCACGAGGCTCTCCACAACCACTACACCCAGAAGAGCCTCTCCCTGAGCCTCGGCAAGTAG

Monoclonal antibody parent kappa light chain (SEQ ID NO:9)

ATGGAGACCGACACCCTGCTGCTCTGGGTGCTGCTGCTCTGGGTGCCCGGCTCCACCGGAGACATTGTGCTGACCCAATTTCCAACTTCTTTGGCTGTGTCTCTAGGGCAGAGGGCCACCATCTCCTGCAGAGCCAGCGAAAGTGTTGATTACTATGGCTTTAGTTTTATAAACTGGTTCCAACAGAAACCAGGACAGCCACCCAAACTCCTCATCTATGCTGCATCCAACCAGGGATCCGGGGTCCCTGCCAGGTTTGGTGGCAGTGGGTCTGGGACAGACTTCAGCCTCAACATCCATCCTATGGAGGAGGATGATACTGCAATGTATTTCTGTCAGCAAAGTAAGGAGGTTCCGTGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAGCGGACCGTGGCCGCCCCCAGCGTGTTCATCTTCCCTCCCAGCGACGAGCAGCTGAAGTCTGGCACCGCCAGCGTGGTGTGCCTGCTGAACAACTTCTACCCCCGCGAGGCCAAGGTGCAGTGGAAGGTGGACAACGCCCTGCAGAGCGGCAACAGCCAGGAGAGCGTGACCGAGCAGGACTCCAAGGACAGCACCTACAGCCTGAGCAGCACCCTGACCCTGAGCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAGGTGACCCACCAGGGACTGTCTAGCCCCGTGACCAAGAGCTTCAACCGGGGCGAGTGCTAA

Humanized light chain variant 1(SEQ ID NO:10)

ATGGAGACCGACACCCTGCTGCTCTGGGTGCTGCTGCTCTGGGTGCCCGGCTCCACCGGAGACATCGTGATGACCCAGTCCCCCGACTCCCTGGCTGTGTCTCTGGGCGAGAGAGCCACCATCAACTGCAAGTCCTCCGAGTCCGTGGACTACTACGGCTTCTCCTTCCTGAACTGGTTCCAGCAGAAGCCCGGCCAGCCCCCTAAGCTGCTGATCTACGCCGCCTCCAACCGCGAGTCTGGCGTGCCCGATAGATTCTCCGGCTCTGGCTCTGGCACCGACTTTACCCTGACCATCAGCTCCCTGCAGGCCGAGGATGTGGCCGTGTACTACTGCCAGCAGTCCAAAGAGGTGCCCTGGACCTTCGGCCAGGGCACAAAGCTGGAAATCAAGCGGACCGTGGCCGCCCCCAGCGTGTTCATCTTCCCTCCCAGCGACGAGCAGCTGAAGTCTGGCACCGCCAGCGTGGTGTGCCTGCTGAACAACTTCTACCCCCGCGAGGCCAAGGTGCAGTGGAAGGTGGACAACGCCCTGCAGAGCGGCAACAGCCAGGAGAGCGTGACCGAGCAGGACTCCAAGGACAGCACCTACAGCCTGAGCAGCACCCTGACCCTGAGCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAGGTGACCCACCAGGGACTGTCTAGCCCCGTGACCAAGAGCTTCAACCGGGGCGAGTGCTAA

Humanized light chain variant 2(SEQ ID NO:11)

ATGGAGACCGACACCCTGCTGCTCTGGGTGCTGCTGCTCTGGGTGCCCGGCTCCACCGGAGACATCGTGATGACCCAGTCCCCCGACTCCCTGGCTGTGTCTCTGGGCGAGAGAGCCACCATCAACTGCAAGGCCTCCGAGTCCGTGGACTACTACGGCTTCTCCTTCCTGAACTGGTTCCAGCAGAAGCCCGGCCAGCCCCCTAAGCTGCTGATCTACGCCGCCTCCAACCGCGAGTCTGGCGTGCCCGATAGATTCTCCGGCTCTGGCTCTGGCACCGACTTTACCCTGACCATCAGCTCCCTGCAGGCCGAGGATGTGGCCGTGTACTACTGCCAGCAGTCCAAAGAGGTGCCCTGGACCTTCGGCCAGGGCACAAAGCTGGAAATCAAGCGGACCGTGGCCGCCCCCAGCGTGTTCATCTTCCCTCCCAGCGACGAGCAGCTGAAGTCTGGCACCGCCAGCGTGGTGTGCCTGCTGAACAACTTCTACCCCCGCGAGGCCAAGGTGCAGTGGAAGGTGGACAACGCCCTGCAGAGCGGCAACAGCCAGGAGAGCGTGACCGAGCAGGACTCCAAGGACAGCACCTACAGCCTGAGCAGCACCCTGACCCTGAGCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAGGTGACCCACCAGGGACTGTCTAGCCCCGTGACCAAGAGCTTCAACCGGGGCGAGTGCTAA

Humanized light chain variant 3(SEQ ID NO:12)

ATGGAGACCGACACCCTGCTGCTCTGGGTGCTGCTGCTCTGGGTGCCCGGCTCCACCGGAGACATCCAGCTGACCCAGTCCCCCGACTCCCTGTCTGTGTCTCTGGGCGAGAGAGCCACCATCAACTGCAAGGCCTCCGAGTCCGTGGACTACTACGGCTTCTCCTTCCTGAACTGGTTCCAGCAGAAGCCCGGCCAGCCCCCTAAGCTGCTGATCTACGCCGCCTCCAACCGCCAGTCTGGCGTGCCCGATAGATTCTCCGGCTCTGGCTCTGGCACCGACTTTACCCTGACCATCAGCTCCCTGCAGGCCGAGGATGTGGCCGTGTACTTCTGCCAGCAGTCCAAAGAGGTGCCCTGGACCTTCGGCCAGGGCACAAAGCTGGAAATCAAGCGGACCGTGGCCGCCCCCAGCGTGTTCATCTTCCCTCCCAGCGACGAGCAGCTGAAGTCTGGCACCGCCAGCGTGGTGTGCCTGCTGAACAACTTCTACCCCCGCGAGGCCAAGGTGCAGTGGAAGGTGGACAACGCCCTGCAGAGCGGCAACAGCCAGGAGAGCGTGACCGAGCAGGACTCCAAGGACAGCACCTACAGCCTGAGCAGCACCCTGACCCTGAGCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAGGTGACCCACCAGGGACTGTCTAGCCCCGTGACCAAGAGCTTCAACCGGGGCGAGTGCTAA

TABLE 4 amino acid sequences of the parent and humanized variants of the PD-1 monoclonal antibody

Monoclonal antibody female parent heavy chain hIgG4-S228P (SEQ ID NO:13)

Humanized heavy chain variant 1(SEQ ID NO:14)

Humanized heavy chain variant 2(SEQ ID NO:15)

Humanized heavy chain variant 3(SEQ ID NO:16)

Monoclonal antibody parent kappa light chain (SEQ ID NO:17)

Humanized light chain variant 1(SEQ ID NO:18)

Humanized light chain variant 2(SEQ ID NO:19)

Humanized light chain variant 3(SEQ ID NO:20)

Claims

1. An isolated monoclonal antibody or antigen-binding fragment thereof directed against human PD-1, comprising: the heavy chain CDRs 1, CDR2, and CDR3 listed in table 2, and the light chain CDRs 1, CDR2, and CDR3 listed in table 2.

2. The monoclonal antibody or antigen-binding fragment thereof of claim 1, comprising: (i) the heavy chain amino acid sequence shown in SEQ ID NO. 3 and the light chain amino acid sequence shown in SEQ ID NO. 4; or (ii) the heavy chain amino acid sequence shown in SEQ ID NO 3 which does not comprise a signal peptide portion and the light chain amino acid sequence shown in SEQ ID NO 4 which does not comprise a signal peptide portion.

3. The monoclonal antibody or antigen-binding fragment thereof of claim 1, wherein the monoclonal antibody or antigen-binding fragment thereof is humanized and comprises:

(2) a light chain amino acid sequence selected from the group consisting of SEQ ID NOs 17, 18, 19 and 20 or SEQ ID NOs 17, 18, 19 and 20 which do not include a signal peptide portion.

4. The monoclonal antibody or antigen-binding fragment thereof of claim 1, comprising: the heavy chain amino acid sequence shown in SEQ ID NO. 13 and the light chain amino acid sequence shown in SEQ ID NO. 17.

5. The monoclonal antibody of any one of claims 1-4Or an antigen-binding fragment thereof, wherein the antigen-binding fragment is selected from the group consisting of: fab, Fab '-SH, Fv, scFv, F (ab')₂And diabodies.

6. An isolated polynucleotide encoding the antibody or antigen-binding fragment thereof of any one of claims 1-5.

7. The isolated polynucleotide of claim 6, wherein the heavy chain coding sequence is set forth in SEQ ID NO 1 and the light chain coding sequence is set forth in SEQ ID NO 2.

8. The isolated polynucleotide of claim 6, which encodes a humanized antibody or antigen-binding fragment thereof, and wherein:

the heavy chain coding sequence is selected from the group consisting of SEQ ID NOS 5, 6, 7 and 8,

the light chain coding sequence is selected from SEQ ID NOS 9, 10, 11 and 12.

9. An expression vector comprising the isolated polynucleotide of any one of claims 6-8.

10. A host cell comprising the expression vector of claim 9.

11. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof of any one of claims 1-5 and a pharmaceutically acceptable carrier.

12. A method of increasing the activity of an immune cell, comprising contacting the immune cell with the antibody or antigen-binding fragment thereof of any one of claims 1-5.

13. A method of treating a disease, the method comprising administering to a subject in need of treatment a therapeutically effective amount of the antibody or antigen-binding fragment thereof of any one of claims 1-5.

14. The method of claim 13, wherein the disease is selected from the group consisting of: cancer, infectious diseases, transplant rejection, autoimmune diseases, and neurological diseases.

15. The method of claim 13 or 14, comprising administering to the subject a combination of other drugs or therapies.

16. The method of claim 15, wherein the other therapy is selected from the group consisting of: chemotherapy, radiotherapy, targeted therapy, gene therapy, cell therapy, and stem cell therapy.

17. Use of the antibody or antigen-binding fragment thereof of any one of claims 1-5 in the manufacture of a medicament for treating a disease, wherein the disease is selected from the group consisting of: cancer, infectious diseases, transplant rejection, autoimmune diseases, and neurological diseases.

18. The use of claim 17, wherein the medicament is used in combination with other medicaments or therapies.

19. The use of claim 18, wherein the other therapy is selected from the group consisting of: chemotherapy, radiotherapy, targeted therapy, gene therapy, cell therapy, and stem cell therapy.

20. A method of modulating a function of a cell, comprising delivering into the cell a polynucleotide sequence encoding the antibody or antigen-binding fragment thereof of any one of claims 1-5.

21. The method of claim 20, wherein the method is for gene therapy, CAR-T therapy, or CRISPR therapy.