CN110819653A

CN110819653A - Recombinant horse serum albumin and preparation method and application thereof

Info

Publication number: CN110819653A
Application number: CN201911274177.XA
Authority: CN
Inventors: 范铁炯; 胡金贵; 胡双锋; 孙九如; 梁光军; 史小月; 柏伟; 李鑫
Original assignee: Shanghai Sailun Biotechnology Ltd By Share Ltd
Current assignee: Shanghai Sailun Biotechnology Ltd By Share Ltd
Priority date: 2019-12-12
Filing date: 2019-12-12
Publication date: 2020-02-21

Abstract

The invention discloses a recombinant horse serum albumin and a preparation method thereof, wherein a nucleotide sequence (shown as SEQ ID NO: 2) which is optimized by a codon and used for coding the horse serum albumin is constructed into an eukaryotic cell induction expression vector, then is transferred into eukaryotic cells for culture, then is subjected to induction expression, and is purified, so that the recombinant horse serum albumin is obtained. In addition, the invention also discloses application of the recombinant horse serum albumin in preparing rabies vaccines for immunizing horses. The high anti-rabies virus antibody is obtained after the horse is immunized by the rabies antigen taking the recombinant horse serum albumin as the stabilizer, and the anti-human serum albumin antibody is not detected. The recombinant horse serum albumin obtained by the invention can replace human serum albumin to be used as a stabilizer of a rabies vaccine for immune horses, and is used for producing high-quality horse anti-human rabies virus serum.

Description

Recombinant horse serum albumin and preparation method and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to the field of recombinant expression protein, specifically to expression of a mammalian plasma protein, and in particular to recombinant horse serum albumin (ESA) and a preparation method thereof; in addition, the invention also relates to application of the recombinant horse serum albumin obtained by the method.

Background

Serum albumin is the most predominant protein in mammalian plasma and is widely used as an adjuvant or protective agent in the pharmaceutical industry to stabilize the active ingredients of drugs. Many viral vaccines employ albumin as a protective agent. One of them is the human rabies vaccine.

Rabies (Rabies) is a natural epidemic disease of the acute lethal Central Nervous System (CNS) in humans and all warm-blooded animals caused by the Rabies virus (RABV). The disease is distributed globally, and people are infected by being bitten by sick animals, and the disease can be transmitted by the same species and different species of animals, besides the bite, by inhalation, ingestion or vertical transmission. Human rabies patients die for almost 100%. China is one of the countries with serious prevalence of rabies, and the enhancement of the research and the prevention and the treatment of rabies is very urgent and has great burden. According to the WHO guidance principle for preventing and treating rabies, the exposing treatment is carried out immediately or as early as possible after the suspected sick animals grab and bite the animals. Except for the injection of rabies vaccine, the anti-rabies virus immunoglobulin should be locally infiltrated and injected immediately or as early as possible after wound treatment, so that the body is protected.

The anti-human rabies immune globulin is prepared by using human rabies vaccine to immunize horses and then collecting blood. Because human rabies vaccine is added with human serum albumin in the preparation process, the human rabies vaccine is used for immunizing horses, and the horses generate high-titer anti-human serum albumin antibodies, the anti-human serum finished products contain a certain amount of anti-human serum albumin antibodies, sensitization is easy to generate after injection, and the probability of anaphylactic reaction is very high. To overcome this problem, we developed genetic engineering expression studies of horse serum albumin. Recombinant horse serum albumin is used to replace human serum albumin to serve as a protective agent in the cell culture virus production process of rabies virus vaccines and in vaccine stock solution, so as to avoid the side effects.

In the invention patent CN201710147935, which is applied by the applicant on 3/13.2017, the applicant adopts a signal peptide of yeast α -mating factor (α -mating factor) as a signal peptide of Interferon, and the signal peptide is used for secretion expression of the Interferon to obtain a good effect, but in pichia pastoris secretion expression of horse serum albumin, the applicant uses a signal peptide of α -mating factor (α -mating factor) of yeast as a signal peptide of the albumin, and the expression level of target protein is very low.

The research aims to adopt pichia pastoris to express horse serum albumin in a recombination way, and the horse serum albumin is used for replacing human serum albumin to prepare the rabies virus vaccine for horses.

Disclosure of Invention

One of the technical problems to be solved by the present invention is to provide a method for preparing recombinant horse serum albumin (ESA).

The second technical problem to be solved by the invention is to provide the recombinant horse serum albumin prepared by the method.

The second technical problem to be solved by the invention is to provide an application of the recombinant horse serum albumin, and the recombinant horse serum albumin is used as a stabilizer or a protective agent for preparing rabies vaccines for immunizing horses. The recombinant horse serum albumin is used for replacing human serum albumin to be used as a protective agent in a cell culture virus production process of the rabies virus vaccine and a vaccine stock solution so as to avoid side effects of anaphylactic reaction.

In order to solve the technical problems, the invention adopts the following technical scheme:

in the first aspect of the invention, a preparation method of recombinant horse serum albumin is provided, wherein a nucleotide sequence which is optimized by codon and used for coding the horse serum albumin is constructed into an eukaryotic cell induced expression vector, then is transferred into the eukaryotic cell for culture, then is induced and expressed, and is purified, so that the recombinant horse serum albumin is obtained; the nucleotide sequence of the coded horse serum albumin which is optimized by the codon is a sequence shown as SEQ ID NO. 2.

As a preferred embodiment of the present invention, the culturing comprises a preliminary step of pre-inoculation.

As a preferred technical scheme of the invention, the eukaryotic cell is a yeast cell (such as saccharomyces cerevisiae, hansenula or pichia pastoris), preferably is a pichia pastoris cell, and most preferably is pichia pastoris GS 115.

In a preferred embodiment of the present invention, the expression mode may be intracellular expression or secretory expression, and the present invention is preferably a secretory expression method, wherein the eukaryotic cell inducible expression vector is a secretory expression vector, and after the inducible expression, the cells and particulate matter are removed by centrifugation, and the supernatant is collected and purified.

As a preferred technical scheme of the invention, the secretion expression vector is a pichia pastoris expression vector, the expression vector can be pHIL-D2, pPIC9, pGAP, pPIC3.5, preferably pHIL-D2 expression vector, the secretion expression vector contains a horse serum albumin expression cassette, and a signal peptide required by secretion expression can be yeast α -factor secretion signal peptide or a horse serum albumin self-secretion signal peptide, preferably a horse serum albumin self-secretion signal peptide.

As a preferred technical scheme of the invention, the codon-optimized nucleotide Sequence for coding horse serum albumin is optimized according to a Sequence (shown as a Sequence in SEQ ID NO: 1) provided by NCBI Reference Sequence NM-001082503.1 according to a codon preferred by yeast, EcoR I is added before an initiator and after a terminator, a cDNA expression cassette is artificially synthesized and inserted into an EcoR I site of a Pichia pastoris expression vector pHIL-D2 to construct an ESA horse serum albumin/pHIL-D2 expression vector; taking a certain amount of pHIL-D2 plasmid DNA, carrying out enzyme digestion linearization by Sal I, adding into pichia pastoris culture, transferring the plasmid DNA into yeast by an electric shock method, integrating the plasmid DNA into yeast genome DNA, and screening by using a histidine-deficient culture medium to obtain a cell strain for expressing albumin.

As a preferred embodiment of the present invention, the medium used for inducing expression after transferring into eukaryotic cells for culture may be BMGY/BMMY (a complex glycerol or methanol medium with buffering action consisting of 1% yeast extract, 2% peptone, 100 mM potassium phosphate pH 6.0, 1.34% amino acid-free yeast nitrogen source, 4x 10-5% biotin, 1% glycerol or 0.5% methanol), BMG/BMM (a minimum glycerol or methanol medium with buffering action consisting of 100 mM potassium phosphate pH 6.0, 1.34% amino acid-free yeast nitrogen source, 4x 10-5% biotin, 1% glycerol or 0.5% methanol), or YPD/YPM (1% yeast extract, 2% peptone, 2% glucose or 0.5% methanol), the YPD/YPM medium system is preferably used in the present invention.

As a preferred technical scheme of the invention, the culture steps are as follows: selecting clone, inoculating into YPD culture medium, culturing at 30 deg.C and 200rpm for 24-72 hr, preferably 48 hr, centrifuging to remove supernatant, changing culture medium to YPM, culturing at 28 deg.C and 200rpm for 24-120 hr, preferably culturing at 28 deg.C and 200rpm for 48-96 hr, more preferably culturing at 28 deg.C and 200rpm for 72 hr.

As a preferred embodiment of the present invention, the inducible expression is achieved by gradually adding methanol during the yeast culture, preferably 0.5-1.5% methanol every 24 hours, more preferably 1% methanol every 24 hours.

As a preferred technical scheme of the invention, the purification method is to separate and purify culture supernatant obtained by a centrifugation method by anion-cation exchange chromatography. The method comprises capturing the target protein by cation exchange chromatography, wherein the cation exchange gel can be CM-Sepharose FF gel or SP-Sepharose FF gel, preferably SP-Sepharose FF gel. Anion exchange chromatography captures horse serum albumin. The anion exchange gel may be Q-Sepharose FF gel or DEAE-Sepharose FF gel, preferably DEAE-Sepharose FF gel.

In a second aspect of the present invention, there is provided a recombinant horse serum albumin produced by the above-described production method.

In a third aspect of the invention, the invention provides an application of the recombinant horse serum albumin in preparing rabies vaccines for immunizing horses. The recombinant horse serum albumin is used as a rabies vaccine protective agent or a stabilizing agent for producing horse anti-human rabies virus immunoglobulin for immunizing horses.

Compared with the prior art, the invention has the following beneficial effects: experiments prove that the horse anti-human rabies antiserum obtained by immunizing horses with the vaccine obtained by the method does not have an anti-human serum albumin antibody, and the quality meets the requirements of pharmacopoeia. The invention adopts the signal peptide of the target protein to express, and the expression level of the target protein is high. The recombinant horse serum albumin is used for replacing human serum albumin to serve as a protective agent in a cell culture virus production process of the rabies virus vaccine and a vaccine stock solution, so that a certain amount of anti-human serum albumin antibody is prevented from being contained in an anti-serum finished product, sensitization is easily generated after injection, and the side effect of very high allergic reaction probability is avoided. Adding 2% horse serum albumin (w/v) and 2% sorbitol (w/v) into rabies antigen, and preserving at 2-8 ℃ for 2 years with unchanged titer; after a horse is immunized by a rabies antigen with commercially available human serum albumin as a stabilizer, a horse anti-human serum albumin antibody with high titer is generated; leading the final product horse anti-human rabies serum to generate extremely high positive reaction when being applied in people. And the rabies antigen using horse serum albumin as a stabilizer is used for immunizing horses to obtain high anti-rabies virus antibodies, and the anti-human serum albumin antibody is not detected. The recombinant horse serum albumin obtained by the invention can replace human serum albumin to be used as a stabilizer of a rabies vaccine for immune horses, and is used for producing high-quality horse anti-human rabies virus serum.

Drawings

FIG. 1 is a schematic structural diagram of a recombinant Pichia pastoris expression vector according to example 2 of the invention.

FIG. 2 is an SDS-PAGE electrophoretogram for screening expression clones induced with methanol and detecting the amount of target protein expressed by the clones in example 3 of the present invention. In FIG. 2, from left to right, 1-9 wells show the results of 2. mu.l of culture supernatant obtained after 2 days of YPD culture and 3 days of YPM culture of clones 1-9; and the 10 th hole is a protein molecular weight standard. FIG. 2 shows clone 5 does not express the protein of interest; clone 1 expresses trace amount of target protein;

clones

4 and 6 expressed higher amounts.

FIG. 3 is a SDS-PAGE image of clone 6 of example 4 of the present invention grown in YPD medium at high density for 2 days, and sampled by methanol induction. In FIG. 3, from left to right, the 1 st well is the protein molecular weight standard, and the 2 nd to 9 th wells are clones 1 to 8, respectively. It can be seen from the figure that the expression levels of the target proteins of 8 clones were substantially the same.

FIG. 4 is SDS-PAGE of a purified target protein obtained by DEAE-Sepharose FF ion exchange chromatography in example 5 of the present invention; in FIG. 4, the 1 st well is DEAE-Sepharose purified recombinant horse serum albumin; and the 2 nd hole is a protein molecular weight standard.

FIG. 5 is a SEC-HPLC (high pressure liquid phase) chromatogram of recombinant horse serum albumin in example 5 of the present invention. 20 microgram of recombinant horse serum albumin was chromatographed on Agilent1260 high performance liquid chromatography using TSK gel UP-SW3000 (4.6 mm I.D.. times.15 cm) chromatography column. The target protein peaks at 11.215 minutes and has a purity of more than 99%.

Detailed Description

In order to clearly understand the technical contents of the present invention, the preparation of the recombinant equine serum albumin, the preparation of equine rabies vaccine and the immunization method are specifically taken as examples, and the following specific examples are given for detailed description. However, the specific embodiments are merely illustrative, and not restrictive of the invention.

Example 1 horse serum Albumin amino acid sequence, codon optimised according to Yeast preferences

In the process of transcribing amino acids from nucleic acids, there are 20 amino acids constituting a protein, 61 codons for coding amino acids, and several codons corresponding to one amino acid. The yeast has a bias to codons, so that the translation efficiency of a plurality of codons of one amino acid in the yeast cell is high, and the translation efficiency of some codons is low. The nucleotide sequence of the horse serum albumin contains a plurality of codons with low yeast cell translation efficiency (the nucleotide sequence of the horse serum albumin is shown in SEQ ID No.1, and the amino acid sequence of the horse serum albumin is shown in SEQ ID No. 4). In order to increase the intracellular expression level of a target protein, the present invention has been proposed to replace all nucleotide sequences of horse serum albumin by a sequence having the highest translation efficiency in yeast cells by Shanghai bioengineering Co. The optimized sequence is shown in SEQ ID No.2, and the sequence is synthesized by the committee by a manual method, and EcoR I (GAATTC) restriction endonuclease sequences (shown in SEQ ID No. 3) are respectively introduced to the front end and the 3' end of an initiation codon. Cloning into pBluescript KS (-) vector yielded plasmid ESA/pBluescript.

Example 2 construction of Pichia cell expression vector ESA/pHIL-D2

20 microliters of the reaction system contained 20 micrograms of ESA/pBluescript (prepared in example 1), 20 units of EcoR I (purchased from gay biosciences), agarose electrophoresis after 4 hours of 37 ° C digestion, horse serum albumin DNA (ESA cdna) having a molecular weight of about 1.6Kb was cut under an ultraviolet lamp, and DNA was recovered using a whatke DNA recovery kit.

The pHIL-D2 plasmid linearization reaction conditions are as follows: the 20 microliter reaction system contains 10 micrograms of pHIL-D2 plasmid and 20 units of EcoR I (purchased from Bao organisms), and after the enzyme digestion at 37 ℃ for 4 hours, the enzyme digestion is carried out once by using the equal volume of phenol, chloroform (1: 1, v/v), and then ethanol precipitation is carried out to recover DNA. The ethanol solution was placed on ice for 15 minutes, centrifuged at 14000rpm for 10 minutes to recover the precipitated DNA, and the DNA was dissolved in 90. mu.l of 10mmol/L Tris-HCl (pH 8.3). 0.5. mu.l of calf intestinal alkaline phosphatase (CIP) and 10. mu.l of 10xCIP buffer (from New England Biolabs) were added and incubated at 37 ℃ for 30 minutes, EDTA (pH 8.0) was added to give a final concentration of 5mmol/L, the mixture was mixed well and incubated at 65 ℃ for 30 minutes, and CIP was inactivated. After cooling the reaction to room temperature, the reaction was quenched with phenol: chloroform extraction is carried out once, and DNA is recovered by an ethanol precipitation method.

Ligation of linearized hil-D2 plasmid and ESA cDNA a 20 μ l reaction system (containing 2 μ l of linearized pcdna3.1 DNA,2 μ l of T4 DNA ligase (available from daikon), 14 μ l of ESA cDNA, 2 μ l of 10x T4 DNA ligase buffer) was used, and the mixture was set at 16 ° C for overnight reaction. The cDNA of horse serum albumin was ligated with the linearized pHIL-D2 plasmid. The ligated product was transfected into E.coli competent cells.

Coli competent cells were prepared by picking a single colony E.coli DH5 α cell from a fresh plate cultured at 37 ℃ for 16-20 hours, transferring to a 500ml flask containing 100ml LB medium, culturing at 37 ℃ and 250rpm for about 2-3 hours, and measuring OD every 20-30 min₆₀₀The value ≈ 0.4. The bacteria are transferred to a 50ml polypropylene centrifuge tube precooled with ice under aseptic conditions, and placed on ice for 10-20 min. Centrifuging at 4000r/min for 10min at 4 ℃. Discard the centrifugation supernatant and invert the tube for 1min to allow the last traces of the culture to drain. 10ml of 0.1mM CaCl precooled with ice₂Resuspend each pellet and place on ice for 30 min. Centrifuge at 4000r/min for 10min at 4 ℃, discard the supernatant, invert the tube for 1min to drain the last remaining traces of culture. 2ml of ice-precooled 0.1M CaCl per 50ml of initial culture₂Resuspend each pellet. Using a cooled sterile tip, 200. mu.l of the competent cell suspension was transferred to a sterile microfuge tube, 5. mu.l of DNA or ligation reaction mixture was added, the contents were mixed by gentle rotation, and placed on ice for 30 min. The centrifuge tube was placed on a test tube rack pre-warmed to 40 ℃ in a circulating water bath, and after standing for 90 seconds, the tube was quickly transferred to an ice bath to cool the cells for 1 minute. Add 800. mu.l SOC Medium (SOC Medium: 2% w/v tryptone, 0.5% w/v yeast extract, 10mM NaCl, 2.5mM KCl, 10mM MgCl)₂，10mM MgSO₄20mM glucose, pH7.0), the medium was warmed to 37 ℃ with a water bath, and the tubes were then transferred to a 37 ℃ shaker and incubated for 45min to resuscitate the bacteria. Taking 2 blocks containing50 micrograms ampicillin/ml LB agar plate, each plate coated with 200 microliter after recovery of Escherichia coli, 37 degrees C were cultured overnight. 10 clones were picked and the correct orientation of the horse serum albumin cassette was identified by PCR. The PCR reactions were configured as follows: to a 0.5 ml PCR reaction tube, 25. mu.l of 10XTAQ buffer and 25 mM MgCl were added₂15. mu.l, 1.25 mM dNTP 40. mu.l, 100 pmol/microliter primer 1 (shown in SEQ ID No. 5) 2.5. mu.l, 100 pmol/microliter primer 2 (shown in SEQ ID No. 6) 2.5. mu.l, pure water 165. mu.l, 5U/. mu.l Taq enzyme 2.5. mu.l. After fully mixing, the mixture is subpackaged into 10 PCR tubes, each tube is 25 mu l, escherichia coli is picked out by using a sterile wooden toothpick for cloning, and the escherichia coli is added into the tube containing the PCR reaction solution. The PCR reaction conditions were 94 ℃ for 2 minutes in the first step, 94 ℃ for 30 seconds in the second step, 60 ℃ for 30 seconds in the third step, 72 ℃ for 90 seconds in the fourth step, 30 cycles of repeating the second to fourth steps, and 72 ℃ for 5 minutes in the fifth step. The PCR product was analyzed by 1% agarose electrophoresis, and the DNA fragment of about 1.5kd was inserted into the expression cassette in the forward direction and about 0.5kd was inserted into the expression cassette in the reverse direction. And (3) selecting the clone of the DNA fragment of which the PCR product is about 1.5kd, preparing plasmid DNA, and performing DNA sequencing to confirm the plasmid DNA to be used for transfecting pichia pastoris. The structural schematic diagram of the constructed recombinant horse serum albumin pichia pastoris cell expression vector ESA/pHIL-D2 is shown in figure 1.

Example 3 construction of Pichia pastoris cell Strain expressing recombinant horse serum Albumin (ESA/GS 115)

40 micrograms of plasmid DNA containing a Pichia pastoris cell expression vector ESA/pHIL-D2 and 40 units of Sal I (purchased from Bao) were digested at 37 ℃ for 4 hours to linearize the plasmid DNA, and the digested reaction was extracted once with an equal volume of phenol, chloroform (1: 1, v/v), and then ethanol precipitation was performed to recover the DNA. The ethanol solution was placed on ice for 15 minutes, centrifuged at 14000rpm for 10 minutes to recover the precipitated DNA, and the DNA was dissolved in 20. mu.l of 10mmol/L Tris-HCl (pH 8.0).

Single colonies of GS115 were picked up and added to 50ml of a pharmaceutical tube containing 5ml of YPD medium and grown overnight at 200rpm at 30 ℃. 0.5 ml of cultured GS115 was added to a 2-liter flask containing 500ml of fresh YPD (1% yeast extract, 2% peptone, 2% glucose) medium, grown overnight at 200rpm at 30 ℃,up to OD₆₀₀And (5) = 1.3-1.5. Centrifugation was carried out at 1500rpm for 5 minutes at 4 ℃ and the supernatant was discarded, and GS115 cells were resuspended in 500ml of sterile water precooled in an ice bath. Centrifugation was carried out at 1500rpm for 5 minutes, the supernatant was discarded, and GS115 cells were resuspended in 250 ml of sterile water precooled by an ice bath. Centrifugation was carried out at 1500rpm for 5 minutes at 4 ℃ and the supernatant was discarded, and GS115 cells were resuspended in 20 ml of 1M sorbitol precooled by an ice bath. Centrifugation was carried out at 1500rpm for 5 minutes at 4 ℃ and the supernatant was discarded, and GS115 cells were resuspended in 1ml of 1M sorbitol precooled by an ice bath. The volume of the GS115 cell resuspension at this point was approximately 1.5 ml. Mixing 80 microliters of the resuspended cells with 10 microliters of linear plasmid DNA, transferring to a 0.2 cm electric rotating cup which is cooled in an ice bath in advance, standing on the ice bath for 5 minutes, and then carrying out electric rotation, wherein the parameter of the electric rotation is voltage 1.5 kV; a capacitance of 25 μ F; the resistance is 200 omega. The shock time was 10 milliseconds.

1M sorbitol, precooled in an ice bath, was immediately added and transferred to a 1.5 ml sterile centrifuge tube. Mu.l of this was spread on RDB plates (RDB: containing 1M sorbitol, 2% glucose, 1.34% Yeast Nitrogen Base (YNB), 4X10^-5% biotin, 2% agar), 3 RDB plates were coated in total. The RDB plate was incubated at 30 ℃ until colonies were generated.

10 white colonies were picked, inoculated into 5ml YPD medium, and grown at 30 ℃ and 200rpm for 2 days. The inoculated yeast culture tube was centrifuged at 3000rmp for 5 minutes, the supernatant was removed under aseptic conditions, 5ml of YPM medium (containing 0.5% methanol, 1% yeast extract and 2% peptone) was added thereto, the mixture was grown at 30 ℃ and 200rpm, 25. mu.l of sterile methanol was added to each of the 24 th and 48 th hours of the culture, the mixture was cultured for 72 hours, the culture was centrifuged, and the supernatant was collected and analyzed for the expression of the clone by SDS-PAGE (see FIG. 2). It can be seen from FIG. 2 that clone 6 was expressed in the highest amount.

Example 4 horse serum Albumin expression cloning screening and purification

First screening: clone 6 was picked and inoculated on YPD agar plates (1% yeast extract, 2% peptone, 2% glucose, 2% agar) by agar plate streaking and inoculating 2 days later, 8 single clones were picked and inoculated on another YPD agar plate, respectively, and simultaneously inoculated on a 50ml culture tube (Falcon chemical tube) containing 5ml of YPD medium, the agar plates were placed in a 30 ℃ incubator for 2 days, stored at 4 ℃, the tube was placed in a 30 ℃ shaker 200rmp for 2 days, the supernatant was discarded under aseptic conditions, 5ml of YPM medium (containing 0.5% methanol, 1% yeast extract, 2% peptone) was added and grown at 30 ℃ and 200rpm, 25. mu.l of sterile methanol was added at 24 and 48 hours of culture, and after 72 hours of culture, the supernatant was centrifuged, and the expression of the clones was analyzed by SDS-PAGE, as shown in FIG. 3. As shown in FIG. 3, all 8 clones selected in this round of selection expressed horse serum albumin in substantially the same amount.

And (3) second screening: clone 1 of the 5 clones selected in the first round was selected, inoculated on YPD agar plates by agar plate streaking and split inoculation, 5 single clones were selected after 2 days of culture at 30 ℃ and inoculated on another YPD agar plate, and simultaneously inoculated in a 50ml culture tube (Falcon chemical tube) containing 5ml of YPD medium, the agar plates were placed in a 30 ℃ incubator for 2 days and stored at 4 ℃, the tube was cultured on a 30 ℃ shaker for 2 days, the supernatant was discarded under aseptic conditions, 5ml of YPM medium (containing 0.5% methanol, 1% yeast extract and 2% peptone) was added thereto, the resulting mixture was grown at 30 ℃ and 200rpm, 25. mu.l of sterile methanol was added to the culture at 24 and 48 hours, the culture was centrifuged after 72 hours, the supernatant was taken and the expression of the clones was analyzed by SDS-PAGE. The 5 clones selected in the screening round all express horse serum albumin with the same expression amount.

And (3) third screening: clone 1 of the 5 clones selected in the second round was selected, and inoculated on YPD agar plates by agar plate streaking and split inoculation, 5 single clones were selected after 2 days of culture at 30 ℃ and inoculated on another YPD agar plate, and simultaneously inoculated in a 50ml culture tube (Falcon control tube) containing 5ml of YPD medium, the agar plates were placed in a 30 ℃ incubator for 2 days and stored at 4 ℃, the tube was cultured on a 30 ℃ shaker 200rmp for 2 days, the supernatant was discarded under aseptic conditions, 5ml of YPM medium (containing 0.5% methanol, 1% yeast extract and 2% peptone) was added thereto, the tube was grown at 30 ℃ and 200rpm, 25. mu.l of sterile methanol was added at 24 and 48 hours of culture, the tube was cultured for 72 hours and centrifuged, the supernatant was taken, and the expression of the clones was analyzed by SDS-PAGE. The 5 clones selected in the screening round all express horse serum albumin with the same expression amount.

Clone 1 from the third round of selection was inoculated into a 50ml tube (falcon tube) containing 10ml YPD medium, the tube was cultured at 30 ℃ for 2 days with 200rmp, centrifuged to remove the supernatant, the cell pellet was added with 5ml YPD and 5ml glycerol, mixed well and dispensed into a 0.5 ml plastic sterile tube at 0.2 ml/tube, and stored at-70 ℃. This is the master seed pool.

Example 5 purification of recombinant horse serum Albumin

30 ml of SP-Sepharose FF gel was packed in a chromatography column of 2.5cm diameter, and the gel was equilibrated with 20mM acetic acid, 50mM sodium chloride pH4.0 buffer until the pH and conductivity of the flow-through solution were the same as those of the equilibration solution.

Clone 1 from the third round of screening in example 4 was picked up and inoculated into 1000ml YPD medium, cultured at 30 ℃ for 2 days with shaking table 200rmp, centrifuged to remove the supernatant, and 1000ml YP medium containing 1% methanol was added to the cell pellet, cultured at 30 ℃ with shaking table 200rmp, 10ml methanol was added to each of the cells at 2 hours and 3 days, and the culture was terminated at the end of day 3, centrifuged to remove the pellet, and the supernatant was adjusted to pH4.5 with 1M acetic acid and passed through SP-Sepharose FF column chromatography at 10 ml/min. After the completion of the loading, the sample was washed with 20mM acetic acid, 50mM sodium chloride buffer pH4.5 to OD₂₈₀Less than 0.05, followed by washing with 20mM acetic acid, 150 mM sodium chloride pH4.5 buffer to OD₂₈₀Less than 0.05, eluting with 20mM phosphoric acid, 500 mM sodium chloride, pH7.0 buffer solution, and collecting OD₂₈₀A protein greater than 0.1. The concentrate was concentrated to 50 mg/ml by ultrafiltration using an ultrafiltration membrane module with a cut-off of 10kD and replaced with 20mM phosphoric acid, 50mM sodium chloride, pH7.0 buffer.

20 ml of DEAE-Sepharose FF gel was packed in a 2.5cm diameter column, and the gel was equilibrated with 20mM phosphoric acid, 50mM sodium chloride, pH7.0 buffer until the pH of the flow-through solution and the conductivity were the same as those of the equilibration solution, and the ultrafiltered sample was passed through the DEAE-Sepharose FF column at a rate of 5ml per minute. After the completion of the loading, the sample was washed with 20mM phosphoric acid, 50mM sodium chloride, pH7.0 buffer solution to OD₂₈₀Less than 0.05, followed by washing with 20mM phosphoric acid, 100 mM sodium chloride, pH7.0 buffer to an OD280 of less than 0.05, followed by elution with 20mM phosphoric acid, 3500 mM sodium chloride, pH7.0 buffer, and collection of proteins having an OD280 of greater than 0.1. FIG. 4 shows DEAE-SepharoseSDS-PAGE electrophoresis of the target protein purified by e FF ion exchange chromatography shows that a band is found at 66KD, and the band is horse serum albumin.

DEAE-Sepharose FF purified target protein was concentrated to 100 mg/ml by ultrafiltration using an ultrafiltration membrane having a cut-off of 10kD, and the buffer was replaced with 20mM phosphoric acid, 150 mM sodium chloride, pH 7.0. To identify the purity of the recombinant horse serum albumin, the purity was analyzed by high pressure liquid chromatography (SEC-HPLC) using TSK gel UP-SW3000 (4.6 mm I.D.. times.15 cm) as a column on Agilent1260 HPLC, and the loading was 20. mu.g. FIG. 5 is a HPLC chromatogram of recombinant horse serum albumin showing a peak at 11.215 min with a purity of more than 99% and a small peak at 10.879 min as a dimer of the target protein.

Example 6 rabies antigen preparation

Recovering VERO cells, carrying out passage and amplification culture according to a production process, inoculating rabies viruses after reaching a production scale, inoculating the rabies viruses to the VERO cells according to a ratio of virus to cell of 1: 200, carrying out replication and proliferation, harvesting virus cell culture fluid when the virus titer reaches an optimal level, concentrating the harvested rabies virus fluid by a 0.45 mu M filter core by 20 times, adding β -propiolactone inactivating agent into 4 liters of virus fluid by a ratio of 1ml, uniformly stirring, incubating for 48 hours at 4 ℃ for inactivation, then completely degrading β -propiolactone at 37 ℃ for 2 hours, passing through a Sepharose 4B molecular exclusion gel chromatography column with the column height of 90cm after passing through the virus inactivation inspection, washing by pH7.0, 20mM phosphoric acid and 0.15M sodium chloride buffer solution, and collecting a protein peak flowing out of the external water volume, namely the purified rabies antigen.

Rabies antigens obtained by column chromatography were divided into 3 groups. Adding rabies antigen to aggravate horse serum albumin per 100ml to 2% (w/v) and sorbitol to 2% (w/v), adjusting pH to 7.0-7.2 with 1N hydrochloric acid or sodium hydroxide, and storing at 2-8 deg.C in dark place; the second group is added with human serum albumin to 2% (w/v) and sorbitol to 2% (w/v) per 100ml rabies antigen, 1N hydrochloric acid or sodium hydroxide is used for adjusting the pH to 7.0-7.2, and the mixture is stored in a dark place at the temperature of 2-8 ℃; and adding sorbitol to 2% (w/v) per 100ml rabies antigen, adjusting pH to 7.0-7.2 with 1N hydrochloric acid or sodium hydroxide, and storing at 2-8 deg.C in dark place.

Example 7 rabies antigen stability assay

Three groups of rabies antigens added with different stabilizers are subjected to stability experiments at 2-8 ℃ for 24 months, 25 ℃ for 12 months and 37 ℃ for 3 months. Table 1 shows the results of the stability experiment:

TABLE 1

Example 8 horse immunization experiments

6 horses at 4 years old were picked and randomized into 2 groups of 3 horses. The numbers of the first group of horses are 1, 2 and 3, and the used antigen is rabies antigen taking human serum albumin as a protective agent; the second group of horses are numbered 4, 5 and 6, and the antigens used are rabies antigens with recombinant horse serum albumin as a stabilizer. The dose of each horse for immunization is 5U, and the antigen and the equivalent Freund's incomplete adjuvant are mixed into emulsion during immunization and then are injected subcutaneously at the neck. The injection is performed for 4 times, each time at 2 weeks intervals, and the jugular vein is collected 10 days after the fourth injection for detection.

Example 9 determination of the anti-rabies Virus antibody titre of horse serum

The ELISA plate coated by rabies virus selects IgG antibody determination kit (enzyme linked immunosorbent assay) purchased from Ningbo Tian run human rabies virus, positive control serum is horse anti-human rabies virus serum which is immunized by rabies virus vaccine stock solution (purchased from Ningbo Rong Ann biological medicine Co., Ltd.) and has known antibody titer, the sample to be detected is serum collected after the horse in example 8 is immunized four times, and the negative serum is normal horse serum. HRP-labeled rabbit anti-horse IgG was purchased from beijing baiolai bock technologies ltd.

And taking out the ELISA plate coated with the rabies virus antigen from the kit. And diluting the positive control serum by 1000 times with PBS, diluting the horse serum sample to be detected by 1000 times with PBS, diluting the negative control serum by 20 times with PBS, respectively adding 0.1ml of the diluted positive control serum sample and the diluted negative control serum sample into the reaction hole of the enzyme label plate coated with the rabies virus antigen, and incubating for 1 hour at 37 ℃. Wash 3 times for 3 minutes each time. HRP-labeled rabbit anti-horse IgG was diluted with PBS at a ratio of 1:10000, 0.1ml was added to each well, incubated at 37 ℃ for 1 hour, and then discarded, followed by washing 3 times for 3 minutes each. After the last washing, the residual liquid was drained, 0.1ml of a temporarily prepared TMB (3, 3',5,5' -tetramethylbenzidine) substrate solution was added to each reaction well, and after 20 minutes of reaction at 37 ℃, 0.05ml of 2M sulfuric acid was added to each reaction well to terminate the reaction. OD450 was read on an ELISA detector. The ELISA results in table 2 show that both of the horses immunized with rabies antigen with two different albumins as protective agents showed a positive anti-rabies antibody response and similar antibody titers.

TABLE 2 equine serum anti-rabies virus titers

Example 10 horse serum anti-human serum albumin titer assay

Human serum albumin was purchased from Shanghai Bioproducts institute, and horse anti-human serum albumin serum was prepared as a positive control in my Immunity laboratory, while the negative control was normal horse serum. Human serum albumin was diluted with 0.05M carbonate coating buffer pH9.6 to a protein content of 1. mu.g/ml. 0.1ml of the solution was added to the reaction well of each polystyrene plate overnight at 4 ℃. The next day, the well was discarded, and the wells were washed 3 times with wash buffer for 3 minutes each time (washing, the same below). 0.2ml of a blocking solution (20 mM PBS, pH7.2, containing 5% skimmed milk powder) was added to each well, and the mixture was left at room temperature for 1 hour and then discarded, followed by washing once. The positive control serum and the serum of the horse immunized with the rabies antigen taking human serum albumin as a protective agent are diluted by 1000 times by PBS, and the rabies antigen immune horse serum sample taking recombinant horse serum albumin as a protective agent and the negative control serum are diluted by 20 times by PBS, and then 0.1ml is added into the coated reaction hole and incubated for 1 hour at 37 ℃. Wash 3 times for 3 minutes each time. HRP-labeled rabbit anti-horse IgG was diluted with PBS at a ratio of 1:10000, 0.1ml was added to each well, incubated at 37 ℃ for 1 hour, and then discarded, followed by washing 3 times for 3 minutes each. After the last washing, residual liquid is sucked dry, and temporarily prepared TMB (3, 3',5,5' -tetramethyl biphenyl) is added into each reaction holeAmine) substrate solution 0.1ml, reacted at 37 ℃ for 20 minutes, and then 0.05ml of 2M sulfuric acid was added to each reaction well to terminate the reaction. OD read on ELISA Detector₄₅₀. From Table 3, it can be seen that there were no human serum anti-albumin antibodies in horse sera immunized with rabies antigen with recombinant horse serum albumin as protective agent.

TABLE 3 detection of horse serum anti-human serum albumin antibody by ELISA method

。

Sequence listing

<110> Shanghai Sailon Biotechnology Ltd

<120> recombinant horse serum albumin and preparation method and application thereof

<130>WH-NP-19-100486

<160>6

<170>PatentIn version 3.5

<210>1

<211>1827

<212>DNA

<213> Artificial sequence (unknown)

<400>1

acaatgaagt gggtaacctt tgtttccctt ctctttctct tcagctctgc ttattccaga 60

ggcgtgttgc gtcgtgatac acacaagagt gagattgctc atcggtttaa tgatttggga 120

gaaaaacatt tcaaaggcct ggtgctggtt gccttttctc agtatctcca gcagtgccca 180

tttgaggacc acgtaaaatt agtgaatgaa gtaactgaat ttgcaaaaaa atgtgctgct 240

gatgagtcag ctgaaaattg tgacaagtca cttcatactc tttttggaga taaactgtgt 300

acagttgcaa ctcttcgtgc aacctacggt gaactggctg actgctgtga aaaacaagaa 360

cctgagagaa atgaatgctt cctgacacac aaagatgatc acccgaacct ccccaagctg 420

aaaccagaac cggacgctca gtgcgccgcc ttccaggaag atccagacaa gtttctggga 480

aaatacctgt atgaagttgc cagaagacat ccttactttt acggcccaga actacttttc 540

cacgctgagg aatataaagc agattttaca gaatgctgtc cagctgatga taagctggcc 600

tgtctgatac cgaagcttga tgctttgaag gaaagaatac tgctttcatc tgccaaagag 660

agactcaagt gctccagttt ccaaaatttt ggggagagag ctgtcaaagc atggtcagta 720

gctcgcctga gccagaaatt tcccaaggct gactttgcag aggtttccaa gatagtgaca 780

gatcttacca aagtccacaa ggaatgctgc cacggtgacc tgcttgaatg tgccgatgac 840

agggcggatc ttgccaagta catatgtgaa catcaagatt caatctctgg caaactgaaa 900

gcatgctgtg ataaaccttt gttgcaaaaa tcccactgca ttgccgaggt gaaagaagat 960

gacctgccta gtgacctgcc tgcattagct gctgattttg ctgaagataa ggaaatctgc 1020

aaacactata aggatgccaa agatgtcttc ctgggcacgt ttttgtatga atactcaaga 1080

aggcatcctg attactccgt ctccttgctg ttgagaattg ccaagacata tgaagccacg 1140

ctggagaagt gctgtgcgga ggccgaccct cctgcgtgct accgcacagt gtttgatcag 1200

tttacacctc ttgtggagga gcctaagagt ttagtcaagaaaaactgtga cctttttgaa 1260

gaggttggag agtatgactt tcaaaatgcg ctcatagttc gttacaccaa gaaagcaccc 1320

caggtgtcaa ctccaactct cgtggagatt ggaaggaccc tggggaaagt gggcagcaga 1380

tgctgtaaac ttcctgaatc agaaagattg ccctgttctg aaaaccatct ggccttggcc 1440

ctgaaccggt tgtgtgtgtt gcatgagaag acaccagtga gtgagaagat taccaaatgc 1500

tgcacggatt ccttggcgga aagacggcca tgcttttctg ctctggaact cgatgaagga 1560

tatgttccca aagaatttaa ggctgaaaca ttcaccttcc atgcagatat atgcacactt 1620

cctgaagatg agaaacaaat caagaaacaa tctgcacttg ctgaactggt gaaacacaag 1680

cccaaggcaa caaaagaaca actgaaaact gtcctgggaa atttctcagc ctttgtagcc 1740

aagtgctgcg gacgtgagga caaagaggcc tgctttgctg aggagggtcc aaaacttgtt 1800

gcttcgagtc aacttgcctt agcctaa 1827

<210>2

<211>1824

<212>DNA

<213> Artificial sequence (unknown)

<400>2

atgaagtggg tgacgtttgt aagtctgttg tttttgttct catccgccta ctcaagaggc 60

gtcctgcgtc gtgacactca taaatccgag atagctcata ggttcaatga tcttggagag 120

aaacatttta agggccttgt tctggtcgca ttttcccagt acctgcagca gtgtcccttc 180

gaagatcacg ttaagttggt aaatgaggtg acggaatttg ccaagaagtg tgccgccgat 240

gagtccgccg agaactgcga taagtctttg catactcttt tcggagacaa gttatgtaca 300

gtggccactc taagggccacttatggcgaa cttgctgact gctgcgagaa acaggagcct 360

gagaggaatg aatgtttcct tacacacaaa gacgatcatc ccaatcttcc aaaactgaaa 420

cctgagccag acgcacagtg tgcagcattc caagaggatc ctgacaaatt cctaggaaaa 480

tatctttatg aagtggccag gagacatcct tatttctacg gtccagaact gctattccac 540

gcagaggagt acaaggctga cttcacggag tgctgtccag cagacgataa actggcttgt 600

ttgattccta agttggatgc tttaaaggag agaattttgc tatcttctgc caaagaacgt 660

ctaaaatgtt ctagttttca gaactttggt gaaagggcag tcaaagcctg gtcagtagct 720

aggttatcac aaaaatttcc aaaggcagac tttgctgagg tatccaagat agtcaccgac 780

ttaactaagg ttcacaagga atgctgtcac ggtgacctat tggaatgcgc tgatgatcgt 840

gctgacctgg ccaaatacat ctgcgaacat caggactcta tatcaggcaa gcttaaagcc 900

tgttgtgaca agcccctttt gcaaaagtca cattgcatag ctgaggtcaa ggaggacgat 960

ctgccttcag atctgccagc attggccgcc gacttcgccg aggataaaga aatctgcaag 1020

cactataaag acgctaagga cgttttttta ggaaccttct tgtatgagta ttcccgtcgt 1080

cacccagatt atagtgtctc tttgctacta agaattgcaa agacatatga ggctacgctt 1140

gagaaatgct gtgcagaagc agacccccct gcatgctatc gtactgtgtt cgaccagttc 1200

acgcccttag tcgaagagcc taaatccttg gtaaaaaaaa attgcgattt atttgaagag 1260

gtgggagaat acgactttca aaatgctcta atagtccgtt atacaaaaaa ggccccccaa 1320

gtatctactc ccacgttggt tgagatcggc agaacgcttg gcaaggtcgg ctctcgttgc 1380

tgtaaattac ctgaatccga acgtttacca tgcagtgaaa atcacttagc cttggctctg 1440

aacagattgt gtgtgttgca cgagaaaacc ccagtcagtg aaaaaattac taaatgctgt 1500

acggactcat tagctgaacg tcgtccatgc ttctcagcac tggagttaga cgagggctac 1560

gtgcccaaag agtttaaagc agaaacgttc acctttcatg cagacatctg tacgttacca 1620

gaagatgaaa aacagatcaa gaagcaatca gccttggccg agctagttaa acacaagcct 1680

aaggccacga aagagcagtt gaaaacggtt ctgggcaatt tctcagcttt tgtcgccaaa 1740

tgttgcggca gagaggataa agaggcatgc ttcgcagagg agggccccaa gctagttgct 1800

tcctcacaat tggcactagc ctaa 1824

<210>3

<211>1842

<212>DNA

<213> Artificial sequence (unknown)

<400>3

ctgaattcaa taatgaagtg ggtgacgttt gtaagtctgt tgtttttgtt ctcatccgcc 60

tactcaagag gcgtcctgcg tcgtgacact cataaatccg agatagctca taggttcaat 120

gatcttggag agaaacattt taagggcctt gttctggtcg cattttccca gtacctgcag 180

cagtgtccct tcgaagatca cgttaagttg gtaaatgagg tgacggaatt tgccaagaag 240

tgtgccgccg atgagtccgc cgagaactgc gataagtctt tgcatactct tttcggagac 300

aagttatgta cagtggccac tctaagggcc acttatggcg aacttgctga ctgctgcgag 360

aaacaggagc ctgagaggaa tgaatgtttc cttacacaca aagacgatca tcccaatctt 420

ccaaaactga aacctgagcc agacgcacag tgtgcagcat tccaagagga tcctgacaaa 480

ttcctaggaa aatatcttta tgaagtggcc aggagacatc cttatttcta cggtccagaa 540

ctgctattcc acgcagagga gtacaaggct gacttcacgg agtgctgtcc agcagacgat 600

aaactggctt gtttgattcc taagttggat gctttaaagg agagaatttt gctatcttct 660

gccaaagaac gtctaaaatg ttctagtttt cagaactttg gtgaaagggc agtcaaagcc 720

tggtcagtag ctaggttatc acaaaaattt ccaaaggcag actttgctga ggtatccaag 780

atagtcaccg acttaactaa ggttcacaag gaatgctgtc acggtgacct attggaatgc 840

gctgatgatc gtgctgacct ggccaaatac atctgcgaac atcaggactc tatatcaggc 900

aagcttaaag cctgttgtga caagcccctt ttgcaaaagt cacattgcat agctgaggtc 960

aaggaggacg atctgccttc agatctgcca gcattggccg ccgacttcgc cgaggataaa 1020

gaaatctgca agcactataa agacgctaag gacgtttttt taggaacctt cttgtatgag 1080

tattcccgtc gtcacccaga ttatagtgtc tctttgctac taagaattgc aaagacatat 1140

gaggctacgc ttgagaaatg ctgtgcagaa gcagaccccc ctgcatgcta tcgtactgtg 1200

ttcgaccagt tcacgccctt agtcgaagag cctaaatcct tggtaaaaaa aaattgcgat 1260

ttatttgaag aggtgggaga atacgacttt caaaatgctc taatagtccg ttatacaaaa 1320

aaggcccccc aagtatctac tcccacgttg gttgagatcg gcagaacgct tggcaaggtc 1380

ggctctcgtt gctgtaaatt acctgaatcc gaacgtttac catgcagtga aaatcactta 1440

gccttggctc tgaacagatt gtgtgtgttg cacgagaaaa ccccagtcag tgaaaaaatt 1500

actaaatgct gtacggactc attagctgaa cgtcgtccat gcttctcagc actggagtta 1560

gacgagggct acgtgcccaa agagtttaaa gcagaaacgt tcacctttca tgcagacatc 1620

tgtacgttac cagaagatga aaaacagatc aagaagcaat cagccttggc cgagctagtt 1680

aaacacaagc ctaaggccac gaaagagcag ttgaaaacgg ttctgggcaa tttctcagct 1740

tttgtcgcca aatgttgcgg cagagaggat aaagaggcat gcttcgcaga ggagggcccc 1800

aagctagttg cttcctcaca attggcacta gcctaagaat tc 1842

<210>4

<211>607

<212>PRT

<213> Artificial sequence (unknown)

<400>4

MKWVTFVSLL FLFSSAYSRG VLRRDTHKSE IAHRFNDLGE KHFKGLVLVA FSQYLQQCPF 60

EDHVKLVNEV TEFAKKCAAD ESAENCDKSL HTLFGDKLCT VATLRATYGE LADCCEKQEP 120

ERNECFLTHK DDHPNLPKLK PEPDAQCAAF QEDPDKFLGK YLYEVARRHP YFYGPELLFH 180

AEEYKADFTE CCPADDKLAC LIPKLDALKE RILLSSAKER LKCSSFQNFG ERAVKAWSVA 240

RLSQKFPKAD FAEVSKIVTD LTKVHKECCH GDLLECADDR ADLAKYICEH QDSISGKLKA 300

CCDKPLLQKS HCIAEVKEDD LPSDLPALAA DFAEDKEICK HYKDAKDVFL GTFLYEYSRR 360

HPDYSVSLLL RIAKTYEATL EKCCAEADPP ACYRTVFDQF TPLVEEPKSL VKKNCDLFEE 420

VGEYDFQNAL IVRYTKKAPQ VSTPTLVEIG RTLGKVGSRC CKLPESERLP CSENHLALAL 480

NRLCVLHEKT PVSEKITKCC TDSLAERRPC FSALELDEGY VPKEFKAETF TFHADICTLP 540

EDEKQIKKQS ALAELVKHKP KATKEQLKTV LGNFSAFVAK CCGREDKEAC FAEEGPKLVA 600

SSQLALA 607

<210>5

<211>21

<212>DNA

<213> Artificial sequence (unknown)

<220>

<221>misc_feature

<223> primer

<400>5

cctgagagga atgaatgttt c 21

<210>6

<211>21

<212>DNA

<213> Artificial sequence (unknown)

<220>

<221>misc_feature

<223> primer

<400>6

gcaaatggca ttctgacatc c 21

Claims

1. A preparation method of recombinant horse serum albumin is characterized in that a nucleotide sequence which is optimized by codon and used for coding the horse serum albumin is constructed into an eukaryotic cell induced expression vector, then the vector is transferred into the eukaryotic cell for culture, induced expression is carried out, and purification is carried out, so as to obtain the recombinant horse serum albumin; the nucleotide sequence of the coded horse serum albumin which is optimized by the codon is a sequence shown as SEQ ID NO. 2.

2. The method of claim 1, wherein the culturing comprises a preliminary step of pre-seeding.

3. The method of claim 1, wherein the eukaryotic cell is a yeast cell.

4. The method of claim 3, wherein the cell is a Pichia pastoris cell.

5. The method of claim 4, wherein the Pichia pastoris cell is Pichia pastoris GS 115.

6. The method of claim 1, wherein said eukaryotic cell inducible expression vector is a secretory expression vector, and after said inducible expression, cells and particulate matter are removed by centrifugation, and the supernatant is removed and subjected to said purification.

7. The method for preparing recombinant horse serum albumin according to claim 6, characterized in that the secretion expression vector is a Pichia pastoris expression vector, in particular a pHIL-D2 expression vector, and contains a horse serum albumin expression cassette, and the secretion signal peptide is a horse serum albumin self-secretion signal peptide.

8. The method for preparing recombinant horse serum albumin according to claim 7, characterized in that the codon optimized nucleotide sequence coding horse serum albumin is optimized according to the codon preferred by yeast, EcoR I is added before the initiator and after the terminator, cDNA expression cassettes are artificially synthesized and inserted into EcoRI site of Pichia pastoris expression vector pHIL-D2 to construct ESA horse serum albumin/pHIL-D2 expression vector; taking a certain amount of pHIL-D2 plasmid DNA, carrying out enzyme digestion linearization by SalI, adding into Pichia pastoris culture, transferring the plasmid DNA into yeast by an electric shock method, integrating the plasmid DNA into yeast genome DNA, and screening by using a histidine-deficient culture medium to obtain a cell strain for expressing albumin.

9. The method of claim 1, wherein the transfer into eukaryotic cells is performed to induce expression after culturing in YPD/YPM medium comprising 1% yeast extract, 2% peptone, and 2% glucose or 0.5% methanol.

10. The method for preparing recombinant horse serum albumin according to claim 9, wherein the culturing step is specifically: selecting clone, inoculating into YPD culture medium, culturing at 30 deg.C and 200rpm for 24-72 hr; centrifuging to remove supernatant, changing culture medium to YPM, culturing at 28 deg.C and 200rpm for 24-120 hr.

11. The method for preparing recombinant horse serum albumin according to claim 10, wherein the culturing step is specifically: selecting clone, inoculating into YPD culture medium, culturing at 30 deg.C and 200rpm for 48 hr; centrifuging to remove supernatant, changing culture medium to YPM, culturing at 28 deg.C and 200rpm for 48-96 hr.

12. The method for preparing recombinant horse serum albumin according to claim 11, wherein the culturing step is specifically: selecting clone, inoculating into YPD culture medium, culturing at 30 deg.C and 200rpm for 48 hr; the supernatant was centrifuged off, YPM was used as a medium, and the medium was cultured at 28 ℃ and 200rpm for 72 hours.

13. The method of claim 1 or 7, wherein said inducible expression is achieved by stepwise addition of methanol during yeast culture, with methanol being added at intervals of 0.5-1.5% every 24 hours.

14. The method of claim 13, wherein 1% methanol is added every 24 hours.

15. The method for producing recombinant horse serum albumin according to claim 6, wherein the purification method comprises separating and purifying the culture supernatant obtained by centrifugation by anion-cation exchange chromatography; separating and purifying by anion-cation exchange chromatography, and adopting cation exchange gel CM-Sepharose FF gel or SP-Sepharose FF gel; anion exchange gel Q-Sepharose FF gel or DEAE-Sepharose FF gel is used.

16. The method of claim 15, wherein the cation exchange gel is an SP-Sepharose FF gel; the anion exchange gel is DEAE-Sepharose FF gel.

17. A recombinant horse serum albumin produced by the production method according to any one of claims 1 to 16.

18. Use of recombinant horse serum albumin according to claim 17 for the preparation of a rabies vaccine for immunization of horses.

19. The use of claim 18, wherein the recombinant horse serum albumin is used as a protective or stabilizing agent for rabies vaccine for immunization of horses.