CN110819594A

CN110819594A - Mesenchymal stem cell for continuously over-expressing IFN-gamma and application thereof

Info

Publication number: CN110819594A
Application number: CN201911065933.8A
Authority: CN
Inventors: 贾永前; 陈影影; 吴鹏强; 王甫珏
Original assignee: Sichuan University
Current assignee: Sichuan University
Priority date: 2019-11-04
Filing date: 2019-11-04
Publication date: 2020-02-21

Abstract

The invention belongs to the technical field of stem cells, and particularly relates to a mesenchymal stem cell for continuously over-expressing IFN-gamma and application thereof. Aiming at the problem that the prior art lacks an effective method for preventing aGVHD, the invention provides a mesenchymal stem cell for continuously over-expressing IFN-gamma, wherein a recombinant vector contained in the mesenchymal stem cell contains a gene capable of continuously encoding IFN-gamma and can continuously over-express the IFN-gamma. The mesenchymal stem cells continuously overexpressing IFN-gamma have simple preparation method, simultaneously play the roles of anti-tumor and immunity in the body after the allogeneic hematopoietic stem cells are transplanted, reduce the incidence or the severity of aGVHD, simultaneously do not influence the GVL effect, and provide a new method for preventing and treating the aGVHD after the allogeneic hematopoietic stem cells are transplanted. The expression vector has higher expression efficiency, higher infection efficiency and better expression stability.

Description

Mesenchymal stem cell for continuously over-expressing IFN-gamma and application thereof

Technical Field

The invention belongs to the technical field of stem cells, and particularly relates to a mesenchymal stem cell for continuously over-expressing IFN-gamma and application thereof.

Background

Allogeneic hematopoietic stem cell transplantation (allo-HSCT) is mainly characterized by activation of immune cells such as donor T lymphocytes, and by the immune mechanism, the remaining leukemia cells of the recipient are eliminated to the maximum extent in order to achieve graft-versus-leukemia (GVL) effect. However, the activation of donor T cells in the recipient often causes acute graft versus host disease (aGVHD), which is the most serious complication of allo-HSCT and seriously affects the success rate of transplantation. The mechanism of this is mainly that donor T cells act on recipient cells by activating antigen presenting cells and inducing cytokine release, causing damage to target organs such as skin, lung, liver, etc. of a patient.

Currently, treatment for aGVHD recommends prevention mainly after allo-HSCT, and drugs include cyclosporine a, methotrexate, antithymocyte globulin, and the like; while the first-line medication for aGVHD that has already occurred is recommended to be methylprednisolone, the second-line therapy includes mycophenolate mofetil capsule, methotrexate, tacrolimus, anti-TNF antibodies, Mesenchymal Stem Cell (MSC) infusion, etc. However, the clinical therapeutic effect of the above methods is still not ideal.

IFN-gamma is a protein derived from a variety of cells such as CD⁴⁺Th1 cell, CD⁸⁺Pleiotropic cytokines secreted by cells, NK cells, B cells and the like have important significance in immune regulation, can play an anti-tumor role by participating in regulating immune response, regulating cell cycle, promoting apoptosis, resisting tumor neovascularization, resisting virus, combining with chemical drugs and the like, and can inhibit the proliferation of leukemia K562 cells and promote apoptosis by promoting the expression of Fas and FasL proteins.

MSCs are pluripotent stem cells that are widely available and have multipotent differentiation potential, and studies have shown that MSCs have low immunogenicity and immunoregulatory ability due to their low expression of Major Histocompatibility Complex (MHC) class I molecules, and do not express MHC class II molecules, FasL, CD80, CD86, CD40, CD 40L. in the aGVHD environment, MSCs can jointly constitute an immunosuppressive microenvironment by soluble antiproliferative factors such as transforming growth factor β (TGF- β), hepatocyte growth factor, indoleamine-2, 3-dioxygenase (IDO), Inducible Nitric Oxide Synthase (iNOS), heme oxygenase (HO-1), cyclophilin E2(PGE2), IFN- γ, interleukin-10 (IL-10), and human leukocyte antigen-MSG 5(HLA-G5), blocking activation of T lymphocytes, apoptosis of T lymphocytes to accelerate immune progression, but have been shown to be an immune suppression principle, but have been shown to be a high probability of preventing and treating infectious diseases due to their high probability of proliferation.

In conclusion, the prior art lacks an effective method for preventing aGVHD, and the invention intends to provide human umbilical cord mesenchymal stem cells continuously overexpressing IFN- γ in order to prevent the generation of aGVHD or reduce the severity thereof, while not affecting the GVL effect.

Disclosure of Invention

The technical problem to be solved by the invention is as follows: the prior art lacks an effective method for preventing aGVHD.

The technical scheme for solving the technical problem of the invention is as follows: provided is a mesenchymal stem cell that persistently overexpresses IFN-gamma. The recombinant vector contained in the mesenchymal stem cell contains a gene which can continuously code IFN-gamma and can continuously over-express the IFN-gamma.

Wherein, in the mesenchymal stem cell continuously over-expressing IFN-gamma, the nucleotide sequence of the gene continuously coding the IFN-gamma is shown as SEQ ID NO. 1.

Nucleotide sequence of SEQ ID NO 1 IFN-gamma

atgaaatatacaagttatatcttggcttttcagctctgcatcgttttgggttctcttggctgttactgccaggacccatatgtaaaagaagcagaaaaccttaagaaatattttaatgcaggtcattcagatgtagcggataatggaactcttttcttaggcattttgaagaattggaaagaggagagtgacagaaaaataatgcagagccaaattgtctccttttacttcaaactttttaaaaactttaaagatgaccagagcatccaaaagagtgtggagaccatcaaggaagacatgaatgtcaagtttttcaatagcaacaaaaagaaacgagatgacttcgaaaagctgactaattattcggtaactgacttgaatgtccaacgcaaagcaatacatgaactcatccaagtgatggctgaactgtcgccagcagctaaaacagggaagcgaaaaaggagtcagatgctgtttcgaggtcgaagagcatcccagtag。

Wherein, in the mesenchymal stem cell continuously over-expressing IFN-gamma, the recombinant vector is a viral vector. Further, the viral vector is a lentiviral vector.

Wherein, in the mesenchymal stem cell continuously over-expressing IFN-gamma, the mesenchymal stem cell is human umbilical cord mesenchymal stem cell.

The invention also provides a preparation method of the mesenchymal stem cell for continuously over-expressing IFN-gamma, which comprises the following steps:

constructing a slow virus vector for expressing IFN-gamma, and packaging virus particles; recovering the frozen 3 rd generation human umbilical cord mesenchymal stem cells, changing the culture solution, culturing, subculturing, selecting the 5 th generation human umbilical cord mesenchymal stem cells in logarithmic phase, digesting and counting by pancreatin when the cells grow to 80-90% confluence, and performing digestion and counting at 37 ℃ with 5% CO₂Culturing overnight under the condition; viral particles infected cells, 37 ℃, 5% CO₂Culturing under the condition for 24 hr, changing culture medium, changing to screening culture medium after 48 hr, and culturing at 37 deg.C with 5% CO₂Culturing under the condition to obtain the mesenchymal stem cells modified by the recombinant genes.

Further, the screening medium is DMEM/F12 complete medium containing 1ug/ml puromycin.

The invention also provides application of the mesenchymal stem cells continuously overexpressing IFN-gamma in preventing or treating acute graft-versus-host disease.

Compared with the prior art, the invention has the beneficial effects that:

the invention constructs a lentiviral vector for continuously expressing IFN-gamma, infects human umbilical cord mesenchymal stem cells to obtain mesenchymal stem cells capable of continuously over-expressing IFN-gamma, researches the action mechanism of IFN-gamma in the immune regulation of HuMSCs, discovers for the first time that the recombinant modified mesenchymal stem cells simultaneously play the anti-tumor and immune functions in an organism after allogeneic hematopoietic stem cell transplantation, reduces the incidence or severity of acute graft-versus-host disease, does not influence GVL effect, and provides a new method for preventing and treating the acute graft-versus-host disease after the allogeneic hematopoietic stem cell transplantation. The expression vector has higher expression efficiency, higher infection efficiency and better expression stability.

Drawings

FIG. 1 shows the result of enzyme digestion identification of recombinant lentiviral vector plasmid PCDH-hIFN-gamma;

FIG. 2 shows the result of QPCR detection of hIFN- γ expression; compared with a control group, the interferon-gamma group has P <0.05 and has statistical significance, and compared with the control group, the no-load group has P >0.05 and has no significant difference;

FIG. 3 shows the result of detecting hIFN-gamma protein expression by ELISA; compared with a control group, the interferon-gamma group has P <0.05 and the concentration of hIFN-gamma is (459.9+2.232pg/ml), and compared with the control group, the unloaded group has P >0.05 and has no obvious difference;

FIG. 4 shows the results of co-culture of HuMSCs with T lymphocytes; the P <0.05 was more pronounced in the control (0.7707+0.02605), empty (0.7494+0.06716) and interferon- γ (0.4209+0.02816) groups compared to the T cell group alone, with P < 0.05.

FIG. 5a shows the results of co-culturing HuMSCs with K562 cells, with P <0.05 in the control (0.5847+0.01067), the empty (0.5919+0.01780) and the interferon- γ (0.3450+0.006082) groups, where P <0.05 is more pronounced in the interferon- γ group;

FIG. 5b shows the results of co-culturing HuMSCs with HL-60 cells; p <0.05 in the control (0.9223+0.02592), empty (0.9759+0.02237) and interferon- γ (0.6229+0.01476) groups, compared to the HL-60 cell group, with interferon- γ group more pronounced, P < 0.05;

FIG. 5c shows the results of co-culturing HuMSCs with MOLM-13 cells; p <0.05 in the control (0.7382+0.01877), empty (0.7329+0.02198) and interferon- γ (0.6345+0.006068) groups, compared to the MOLM-13 cell group, where interferon- γ group was more pronounced, P < 0.05;

FIG. 5d shows the results of co-culturing HuMSCs with THP-1 cells; compared with the THP-1 cell group, P of a control group (0.8344+0.001391), an unloaded group (0.8059+0.02384) and a interferon-gamma group (0.8348+0.01519) is less than 0.05, and the P is less than 0.05 without significant difference among the three groups;

FIG. 5e shows the results of co-culturing HuMSCs with U937 cells; compared with the U937 cell group, P of the control group (0.8763+0.009838), the no-load group (0.8785+0.03000) and the interferon-gamma group (0.8671+0.04155) is less than 0.05, and no significant difference exists among the three groups, and P is less than 0.05.

Detailed Description

The invention provides a mesenchymal stem cell for continuously over-expressing IFN-gamma, wherein a recombinant vector contained in the mesenchymal stem cell contains a gene capable of continuously encoding the IFN-gamma, and the gene can continuously over-express the IFN-gamma.

The lentivirus vector is used as an exogenous gene vector, is a gene therapy vector constructed on the basis of main functional elements of HIV-1, can infect divided cells, resting cells and carry out high-efficiency integration and expression on primary cells difficult to infect, can carry a gene fragment within 10kb, and is an effective tool for in vitro cell transfection and gene therapy due to the characteristics of sustainable expression, small immune response and the like.

The expression vector of the invention is particularly selected from a lentiviral vector, and the lentiviral vector has the following advantages: (1) lentiviruses have a wider host range, can infect cells in a division phase and also can infect cells in a resting phase, and particularly can remarkably improve the transfection efficiency for cells which are difficult to infect (primary cells, stem cells, undifferentiated cells and the like). (2) Lentivirus infects host cell, can integrate the target gene into host chromosome, will not lose in the process of division and differentiation, can express stably in vivo for a long time. (3) Compared with adenovirus vectors, lentivirus is a replication-active pseudovirus, has low immune activity and cannot cause host immune response.

Wherein, in the mesenchymal stem cell continuously over-expressing IFN-gamma, the mesenchymal stem cell is human umbilical cord mesenchymal stem cell. The human umbilical cord mesenchymal stem cells have wide sources and can be obtained by separating various human tissues, such as bone marrow, fat, peripheral blood, umbilical cord blood and the like; the mesenchymal stem cells have nonspecific immunosuppressive activity and immunoregulation effect, and can act on various immune cells to play a role in regulating the immune system.

The following examples are intended to illustrate specific embodiments of the present invention without limiting the scope of the invention to the examples.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

EXAMPLE 1 construction of IFN-. gamma.overexpression vectors

(1) Selecting a target gene: the cDNA sequence of IFN-gamma was determined by Pubmed search. The nucleotide sequence of the target gene is shown as SEQ ID NO. 1.

The primers of the target gene are shown as SEQ ID NO. 2 and SEQ ID NO. 3.

The upstream primer is 5'-CGGAATTCATGAAATATACAAGTTAT-3'. (SEQ ID NO:2)

The downstream primer is 5'-CGGGATCCTTACTGGGATGCTCTTCGA-3'. (SEQ ID NO:3)

The restriction enzymes are: EcoR I and BamH I.

(2) Connecting a target gene with a shuttle vector and analyzing and identifying results:

carrying out PCR amplification on a target gene from a plasmid, and carrying out enzyme digestion on a pCDH vector and an IFN-gamma gene by using two restriction enzymes of EcoR I and BamH I; by T₄The IFN-gamma gene and the pCDH carrier fragment are respectively connected by ligase to construct a recombinant plasmid pCDH-IFN-gamma.

The basic process of target gene amplification is as follows:

① purpose gene PCR

The reaction system is as follows, 50ul

IFN-γ：

PCR reaction cycle set-up (25 cycles for each PCR)

② target gene and carrier, enzyme cutting after PCR product is recovered.

The enzyme digestion system is as follows: and measuring to determine the concentration of the sample to be cut before carrying out the enzyme digestion reaction.

IFN-gamma gene and pCDH enzyme digestion system:

pCDH enzyme digestion:

pCDH 1ug

IFN-gamma gene enzyme digestion:

③ connecting the target gene with a vector:

the enzyme digestion product of the target gene and the vector needs to be recovered by gel before connection, and the specific operation refers to an Axygen DNA gel recovery kit (thinking about biotechnology, Inc.). The specific operation is shown in the instruction book (AxyPrep DNA gel recovery kit instruction book).

IFN-. gamma.and pCDH ligation reaction system (20 ul):

self-ligation system (negative control):

pCDH enzyme digestion fragment 16. mu.l

Buffer 2μl

T₄Ligase 2. mu.l.

Wherein the molar ratio of the target gene to the vector is as follows: the target gene is as follows: the total volume of the vector was 10:1, 16ul, and the corresponding volume loading was calculated.

④ verification after the target gene is connected with the vector:

the verification method comprises the following steps: performing electrophoresis verification after PCR; carrying out electrophoresis verification after enzyme digestion; and (5) sequencing and verifying the target gene.

Example 1 a recombinant lentiviral vector plasmid was successfully constructed. The ligation products are subjected to enzyme digestion verification by two restriction enzymes of EcoR I and BamH I, and agarose electrophoresis shows that the size and the position of a band are the target gene IFN-gamma (shown in figure 1).

Example 2 construction of recombinant Lentiviral vectors

The preparation principle and the flow are as follows:

the lentiviral packaging system was a three-plasmid system with helper plasmids pSPAX2, pMD2G (from the national emphasis laboratory of biotherapy, university of sichuan) in which the screening marker was puromycin.

(1) Plasmid preparation:

plasmid preparation was carried out using TIANGEN endotoxin-free plasmid macroextraction kit (Tiangen Biochemical technology Co., Ltd., Beijing).

The plasmid preparation steps were carried out in detail according to the instructions of Tiangen endotoxin-free plasmid Profibration kit DP-117.

(2) Transfection

① the cells were trypsinized at the logarithmic growth phase of 293T cells 24 hours before transfection, adjusted to 6X 10X 5/ml in DMEM medium containing 10% fetal bovine serum, re-plated in 10cm dishes and placed at 37 ℃ in 5% CO₂The incubator can be used for transfection when the cells grow to 70-80% of the basal area;

② the cell culture solution is replaced by serum-free culture solution 2-6h before transfection;

③ preparing a corresponding virus transfection reaction system from sterilized centrifuge tubes;

three-plasmid system reaction system: 1ml of

④ Add 1ml of virus suspension to each well at 37 deg.C, 3% CO₂Incubation in an incubator;

⑤ transfection for 12 hours, the medium was replaced with fresh 10% serum at 37 ℃ with 5% CO₂The incubator was allowed to continue the cultivation for 48 hours.

(3) Virus collection

After 293T cells were transfected, culture supernatants were collected for 48 hours, centrifuged at 2000rpm for 10min, collected and filtered through a 0.22um filter to remove cell debris, and virus solutions were dispensed and directly infected with target cells or stored at-80 ℃.

(4) Lentiviral titer detection

The operation was carried out using a viral genomic DNA/RNA extraction kit (Tiangen Biochemical technology Co., Ltd., Beijing) according to the instruction of the viral genomic DNA/RNA extraction kit DP-315.

Example 3 transfection of recombinant Lentiviral plasmids into human umbilical cord mesenchymal Stem cells

(1) Recovery and passage of HuMSCs

And (3) resuscitation: the three generations of HuMSCs that were preserved were first quickly removed from the liquid nitrogen and placed in a 37 deg.C water tank for rapid resuscitation. 300g, 5min, supernatant was removed, resuspended in DMEM/F12 medium containing 10% fetal bovine serum and 1% diabesin (penicillin and streptomycin), placed at 37 deg.C and 5% CO₂And (5) incubator culture.

Passage: when the cells grow to a density of about 80-90%, cell passaging can be performed. Washing a culture dish by using PBS buffer solution, and discarding PBS; adding about 1ml of 0.2% pancreatin digestive juice, and rounding and falling off HuMSCs (observed under a microscope); immediately adding equal volume of culture medium to terminate reaction, centrifuging for 5min at 300g, discarding supernatant, adding culture medium for resuspension, subculturing at 1:3, standing at 37 deg.C and 5% CO₂Culturing in an incubator.

(2) Transfection

When HuMSCs grew to 70-80%, cells were trypsinized and added to 6-well plates at 1X 10X 5/well, 37 ℃ with 5% CO₂Incubate overnight. And after the cell adhesion fusion degree reaches 30%, adding the collected virus stock solution for infection. After 24h, the normal culture medium or the selection medium (complete medium containing 1ug/ml puromycin) was replaced or the relevant assay was performed.

(3) Detecting the expression level of the target gene hIFN-gamma after in vitro infection of pCDH-IFN-gamma

Collecting HuMSCs in a six-well plate, extracting total RNA of cells by a Trizol method, measuring the concentration of the total RNA (TRIREAGENT, MRC company), performing reverse transcription of the RNA into cDNA by using a TaKaRa genome reverse transcription kit (Clontech company), and detecting the expression level of a target gene by a real-time fluorescent quantitative PCR method, wherein a hIFN-gamma gene forward primer is as follows: 5'-TGAATGTCCAACGCAAAGCA-3' (SEQ ID NO:4), and the reverse primer is: 5'-CTGGGATGCTCTTCGACCTC-3' (SEQ ID NO: 5). The mIFN-gamma gene forward primer is as follows: 5'-CAGCAACAGCAAGGCGAAAAAGG-3' (SEQ ID NO:6), and the reverse primer is: 5'-TTTCCGCTTCCTGAGGCTGGAT-3' (SEQ ID NO: 7).

The QPCR results showed that recombinant lentivirus-modified HuMSCs significantly increased the relative mRNA expression level of the gene of interest (p <0.05) compared to the control and empty-loaded groups, while there was no significant difference between the control and empty-loaded groups (p >0.05) (as shown in fig. 2). The ELISA detection result is consistent with the QPCR result, and the recombinant lentivirus modified HuMSCs can detect the expression of hIFN-gamma protein in the culture supernatant compared with the control group (as shown in figure 3).

Example 4 in vitro Experimental study of IFN- γ overexpressing HuMSCs

The culture medium supernatant in the six-well plate was collected, centrifuged at 2000rpm at 4 ℃ for 10 minutes, and the supernatant was collected and the expression of the target gene was detected according to the ELISA kit (Takeda Biotechnology Co., Ltd.) (EK 180-01).

(1) Co-culture of IFN-gamma over-expressed HuMSCs and T lymphocytes

Pancreatin digestion counting HuMSCs, re-suspending with RPMI1640 complete culture medium, inoculating in 96-well plate, 1 x 10^ 4/well, setting 3 multiple wells in each group, at 37 deg.C, 5% CO₂Incubate overnight. Taking 5ml of healthy adult venous blood under aseptic condition, separating mononuclear cells (MNC) from lymphocyte separating medium Ficoll, counting, inoculating to the 96-well plate according to the ratio of 1 x 10^ 4/well, culturing with HuMSCs at 200 ul/well. anti-CD 3mAb (1ug/ml), anti-CD 28mAb (1ug/ml) (Tianjin Sanjiangbio) were added simultaneously to each well. After 72 hours, after gentle blowing, 100ul of cell suspension was added to a new 96-well plate, 10ul of CCK-8(CCK-8 cell activity assay kit, Dalian Meilun Biotechnology Co., Ltd.) was added to each well, incubation was continued for 4 hours, and the OD value of each well was measured with a microplate reader.

The results show that: the HuMSCs have an inhibiting effect on the proliferation of T lymphocytes. After 72h of co-culture of the HuMSCs and the T lymphocytes, compared with the T cell group alone, the co-culture result indicates that the HuMSCs have inhibition effect on the proliferation of the T lymphocytes (as shown in figure 4), wherein the inhibition effect of the hIFN-gamma group is more obvious than that of the control group and the no-load group (p is less than 0.05).

(2) Co-culture of IFN-gamma over-expressed HuMSCs and leukemia cells

Pancreatin digestion counting HuMSCs, re-suspending with RPMI1640 complete culture medium, inoculating in 96-well plate, 1 x 10^ 4/well, setting 3 multiple wells in each group, at 37 deg.C, 5% CO₂Incubate overnight. Leukemia cell lines were seeded at 1 × 10^4, 200 ul/well in the above 96 well plates and co-cultured with HuMSCs. After 72 hours, 100ul of the cell suspension was placed in a 96-well plate, and 10ul of CCK8 was added to each well at 37 ℃ with 5% CO₂After 4 hours of incubation, the OD of each well was measured at 450nm using a microplate reader.

The results show that: HuMSCs inhibited leukemia cell line proliferation (as shown in FIGS. 5a-5 e). After HuMSCs and leukemia cells are co-cultured for 72h, CCK8 detection results indicate that HuMSCs have inhibition effect on leukemia cell line proliferation, wherein K562, HL-60, MOLM-13 cell lines and interferon-gamma groups have more obvious inhibition effect (p is less than 0.05) compared with a control group and an idle group (fig. 5a-5c), and the inhibition effect between three groups has no obvious difference (p is more than 0.05) in THP-1 and U937 cell lines (fig. 5d-5 e).

The invention constructs the human umbilical cord mesenchymal stem cell capable of continuously over-expressing IFN-gamma, and co-cultures the recombinant mesenchymal stem cell with the T lymphocyte and the leukemia cell, and the result shows that the recombinant mesenchymal stem cell has obvious inhibiting effect on the proliferation of the T lymphocyte and the proliferation of the leukemia cell line. Therefore, the recombinant mesenchymal stem cells can be used in an organism after allogeneic hematopoietic stem cell transplantation to simultaneously play the roles of anti-tumor and immunity, can reduce the incidence or severity of aGVHD, and does not influence the GVL effect. The invention provides a new method for preventing and treating aGVHD after allogeneic hematopoietic stem cell transplantation, and has good practical significance.

Sequence listing

<110> Sichuan university

<120> mesenchymal stem cell continuously overexpressing IFN-gamma and use thereof

<130>A191205K

<141>2019-11-04

<160>7

<170>SIPOSequenceListing 1.0

<210>1

<211>501

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgaaatata caagttatat cttggctttt cagctctgca tcgttttggg ttctcttggc 60

tgttactgcc aggacccata tgtaaaagaa gcagaaaacc ttaagaaata ttttaatgca 120

ggtcattcag atgtagcgga taatggaact cttttcttag gcattttgaa gaattggaaa 180

gaggagagtg acagaaaaat aatgcagagc caaattgtct ccttttactt caaacttttt 240

aaaaacttta aagatgacca gagcatccaa aagagtgtgg agaccatcaa ggaagacatg 300

aatgtcaagt ttttcaatag caacaaaaag aaacgagatg acttcgaaaa gctgactaat 360

tattcggtaa ctgacttgaa tgtccaacgc aaagcaatac atgaactcat ccaagtgatg 420

gctgaactgt cgccagcagc taaaacaggg aagcgaaaaa ggagtcagat gctgtttcga 480

ggtcgaagag catcccagta g 501

<210>2

<211>26

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

cggaattcat gaaatataca agttat 26

<210>3

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

cgggatcctt actgggatgc tcttcga 27

<210>4

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

tgaatgtcca acgcaaagca 20

<210>5

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ctgggatgct cttcgacctc 20

<210>6

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

cagcaacagc aaggcgaaaa agg 23

<210>7

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

tttccgcttc ctgaggctgg at 22

Claims

1. Mesenchymal stem cells that persistently overexpress IFN- γ, characterized by: the recombinant vector contained in the mesenchymal stem cell contains a gene which can continuously code IFN-gamma and can continuously over-express the IFN-gamma.

2. Mesenchymal stem cells persistently overexpressing IFN- γ according to claim 1, characterized in that: the nucleotide sequence of the gene continuously coding IFN-gamma is shown in SEQ ID NO. 1.

3. Mesenchymal stem cells persistently overexpressing IFN- γ according to claim 1, characterized in that: the recombinant vector is a viral vector.

4. Mesenchymal stem cells persistently overexpressing IFN- γ according to claim 3, characterized in that: the virus vector is a lentivirus vector.

5. Mesenchymal stem cells persistently overexpressing IFN- γ according to claim 1, characterized in that: the mesenchymal stem cells are human umbilical cord mesenchymal stem cells.

6. The method for preparing the mesenchymal stem cell continuously overexpressing IFN-gamma as in any one of claims 1 to 5, comprising the steps of:

constructing a slow virus vector for expressing IFN-gamma, and packaging virus particles; recovering the frozen 3 rd generation human umbilical cord mesenchymal stem cells, after liquid change and passage, selecting the 5 th generation human umbilical cord mesenchymal stem cells in logarithmic phase, digesting and counting the cells by pancreatin when the cells grow to 80-90% confluence, and performing 5% CO at 37 DEG C₂Culturing overnight under the condition; viral particles infected cells, 37 ℃, 5% CO₂Culturing under the condition for 24 hr, changing culture medium, changing to screening culture medium after 48 hr, and culturing at 37 deg.C with 5% CO₂Culturing under the condition to obtain the mesenchymal stem cells modified by the recombinant genes.

7. The method for preparing mesenchymal stem cells continuously overexpressing IFN- γ according to claim 6, characterized in that: the screening culture medium is DMEM/F12 complete culture medium containing 1ug/ml puromycin.

8. Use of the mesenchymal stem cell continuously overexpressing IFN-gamma as defined in any one of claims 1 to 5 for the prevention or treatment of acute graft versus host disease.