CN110791573A - Microsatellite locus and primer suitable for identifying golden monkey individual - Google Patents
Microsatellite locus and primer suitable for identifying golden monkey individual Download PDFInfo
- Publication number
- CN110791573A CN110791573A CN201911235782.6A CN201911235782A CN110791573A CN 110791573 A CN110791573 A CN 110791573A CN 201911235782 A CN201911235782 A CN 201911235782A CN 110791573 A CN110791573 A CN 110791573A
- Authority
- CN
- China
- Prior art keywords
- primer
- microsatellite locus
- golden monkey
- microsatellite
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention relates to a microsatellite locus and a primer suitable for identifying a cynomolgus monkey individual, wherein the microsatellite locus is a microsatellite locus which has a repeat unit of 3-5 bases, the repeat number of more than 8 and the length of 100-400bp and is screened from a whole genome of the cynomolgus monkey; the primer is 10 pairs of primer groups: RB1F, RB 1R; RB2F, RB 2R; RB3F, RB 3R; RB4F, RB 4R; RB5F, RB 5R; RB6F, RB 6R; RB7F, RB 7R; RB8F, RB 8R; RB9F, RB 9R; RB10F, RB 10R. The invention relates to a primer with high success rate, strong specificity and high polymorphism, which is used for microsatellite individual identification of a Yunnan golden monkey and lays a necessary foundation for genetic diversity analysis, genetic relationship analysis, genetic linkage map construction and germplasm resource library establishment of the Yunnan golden monkey.
Description
Technical Field
The invention belongs to the technical field of molecular biology DNA marking. In particular to the technical field of microsatellite molecular marker loci, primers and application for identifying the cynomolgus monkey individuals.
Background
1. Yunnan golden monkey
The Yunnan golden monkey is a unique primate species in China, is listed as an Endangered (EN) animal red name list by the International Nature protection alliance (IUCN), and is also a level I important protection wild animal in China. At present, the Yunnan golden monkey is only distributed in a narrow region between the lanuguan and the Jinshajiang at the junction of Yunnan and Tibetan provinces, and is one of the unique treasures in the world of China. The Yunnan golden monkey is also an important indicator species of the original forest conditions of the mountainous areas of the Yunnan mountain in the northwest and the adjacent mountainous areas of the southeast Tibetan region, and the survival condition of the Yunnan golden monkey is an important index for inspecting the quality of an ecological system. Therefore, the cynomolgus monkey has an extremely important biological value for protection.
2. Necessity of individual identification of Yunnan golden monkey
The protection and research of the Yunnan golden monkey can not evaluate the genetic diversity of the Yunnan golden monkey only by field investigation, and reasonable protection suggestions are given, so the genetic research of molecular level is needed. The individual identification of the golden monkey is the necessary basis for genetic research.
3. Microsatellite marker status quo of Yunnan golden monkey for individual identification
The individual identification technology based on the microsatellite marker is one of the most widely and reliably applied means in the current animal individual identification. At present, when the genetic species microsatellite marker provided by the literature is used for identifying the cynomolgus monkey individual, the primer amplification effect is poor, the polymorphism is insufficient, and the individual identification cannot be carried out. In view of the above, the present invention is particularly proposed.
Disclosure of Invention
The invention aims to solve the defects of the problems and provides the primer with high success rate, strong specificity and high polymorphism, which is used for identifying the microsatellite individuals of the Yunnan golden monkey and lays a necessary foundation for genetic diversity analysis, genetic relationship analysis, genetic linkage map construction and germplasm resource library establishment of the Yunnan golden monkey.
The invention is realized by adopting the following technical scheme.
The microsatellite locus is a microsatellite locus with a repeating unit of 3-5 bases, a repeating number of more than 8 and a length of 100-400bp, which is screened from the whole genome of the Yunnan golden monkey.
The primers of the invention are 10 pairs of primer groups: RB1F, RB 1R; RB2F, RB 2R; RB3F, RB 3R; RB4F, RB 4R; RB5F, RB 5R; RB6F, RB 6R; RB7F, RB 7R; RB8F, RB 8R; RB9F, RB 9R; RB10F, RB 10R.
The primers are 10 pairs of primer groups; the PCR amplification system is 10 mul PCR reaction system: template 2. mu.l, primer F0.1. mu.l, primer R0.1. mu.l, dNTP 1.2. mu.l, Buffer 2. mu.l, GoldStar DNApolymerase 0.1. mu.l, ddH2O 4.5μl。
The PCR conditions of the 10 pairs of primer groups are as follows: pre-denaturation at 95 ℃ for 10 min; denaturation at 94 ℃ for 30 seconds, touchdown temperature for 40 seconds, extension at 72 ℃ for 40 seconds, and setting 13 cyclic reactions, wherein touchdown temperature means that the annealing temperature is reduced by 0.5 ℃ per cycle; denaturation at 94 ℃ for 30 seconds, annealing temperature for 40 seconds, extension at 72 ℃ for 40 seconds, setting 30 cycles of reaction, and extension at 60 ℃ for 30 minutes.
The method for obtaining the 10 pairs of primer groups by using the microsatellite locus screening comprises the following steps: sequencing an amplification product obtained after PCR amplification of the DNA of the golden monkey through a sequencer to obtain a result, carrying out site analysis by using GeneMapper software to obtain a data peak map, and manually correcting the sequencing result peak map; the sequencing peak has clear peak shape, the distance between peaks meets the integral multiple of the repeating unit, and the number of peaks meets the single peak or double peaks of the identification result of the diploids of the cynomolgus monkey species.
The method for obtaining the 10 pairs of primer groups by using the microsatellite locus screening comprises the following steps: extracting the DNA of samples determined to be different golden monkey individuals, quantifying the DNA by using a Nanodrop quantifier, and displaying the nucleic acid concentration of the DNA samples to be 30-400 ng/mu l, the OD260/280 to be 1.7-2.2 and the OD260/230 to be 1.5-2.0 by using a 1% agarose gel electrophoresis detection result, wherein the target band is clear and bright.
The microsatellite locus or the primer is also used for genetic diversity analysis or genetic relationship analysis or genetic linkage map construction or germplasm resource library establishment of the Yunnan golden monkey.
The invention has the beneficial effects that the microsatellite molecular marker primer developed by the invention is developed based on the whole genome level, relates to 7 chromosomes, is distributed on different positions of the genome, and has no influence on each other. The primers of 10 pairs of microsatellite molecular markers disclosed by the invention have higher polymorphism, and the 10 pairs of primers show high polymorphism, so that a good basis is provided for research of the Yunnan golden monkey individual identification, and the Yunnan golden monkey individual identification can be accurately carried out. In addition, based on the high polymorphism of the 10 pairs of primers, the microsatellite loci and the primers can lay a necessary foundation for genetic diversity analysis, genetic relationship analysis, genetic linkage map construction and germplasm resource library establishment of the golden monkey.
The invention is further explained below with reference to the drawings and the detailed description.
Drawings
FIG. 1 gel electrophoresis detection of PCR products with the primers RB1 of the present invention;
FIG. 2 gel electrophoresis detection of the PCR product with the primers RB2 of the present invention;
FIG. 3 is a gel electrophoresis test of the PCR product of the primer RB3 of the present invention;
FIG. 4 is a gel electrophoresis test of the PCR product of the primer RB4 of the present invention;
FIG. 5 gel electrophoresis detection of PCR products with the primers RB5 of the present invention;
FIG. 6 is a gel electrophoresis test of the PCR product of the primer RB6 of the present invention;
FIG. 7 gel electrophoresis detection of PCR products with the primers RB7 of the present invention;
FIG. 8 is a gel electrophoresis test of the PCR product of the primer RB8 of the present invention;
FIG. 9 gel electrophoresis detection of the PCR product with the primers RB9 of the present invention;
FIG. 10 is a gel electrophoresis test of the PCR product of the primer RB10 of the present invention;
FIG. 11 is a gel electrophoresis test of the PCR product of the primer RB1 of the present invention;
FIG. 12 is a gel electrophoresis test of the PCR product of the primer RB2 of the present invention;
FIG. 13 is a gel electrophoresis test of the PCR product of the primer RB3 of the present invention;
FIG. 14 is a gel electrophoresis test of the PCR product of the primer RB4 of the present invention;
FIG. 15 gel electrophoresis detection of PCR products with the primers RB5 of the present invention;
FIG. 16 is a gel electrophoresis test of the PCR product of the primer RB6 of the present invention;
FIG. 17 gel electrophoresis detection of PCR products with the primers RB7 of the present invention;
FIG. 18 is a gel electrophoresis test of the PCR product of the primer RB8 of the present invention;
FIG. 19 is a gel electrophoresis test of the PCR product of the primer RB9 of the present invention;
FIG. 20 gel electrophoresis detection of PCR products with the primers RB10 of the present invention;
FIG. 21 is a gel electrophoresis test of the primer D6S271 primer PCR product;
FIG. 22 is a gel electrophoresis test of the PCR product of the primer D7S2204 of the literature;
FIG. 23 is a gel electrophoresis test of the primer D8S505 primer PCR product in the literature;
the primer D11S2202 in the reference of FIG. 24 is used for detecting the PCR product by gel electrophoresis;
the primer D17S1290 in the literature of FIG. 25 is used for the detection of PCR products by gel electrophoresis;
FIG. 26 is a gel electrophoresis test of the PCR product with the primer GM 108;
FIG. 27 is a gel electrophoresis test of the primer GM109 primer PCR product in the literature;
FIG. 28 is a gel electrophoresis test of the primer GM213 and the primer PCR product.
Note: 1. the inside of the frame is a partial target strip; 2. m below the glue picture is a right Marker, and each Marker has 6 bright bands corresponding to the length (bp) of the band; 3. negative control is negative.
Detailed Description
For further disclosure, but not limitation, the present invention is described in further detail below with reference to examples. The kits, chemicals and solvents used in the experimental examples were all commercially available.
Referring to the drawings: FIGS. 1 to 10 are graphs showing the amplification effect of 10 pairs of primers according to the present invention. FIG. 11 to FIG. 20 are individual identification charts of 10 pairs of microsatellite primers 15 samples according to the present invention. FIGS. 21 to 28 show experimental results of other microsatellite primers using the same 15 samples. (other microsatellite primers from the literature: Haoet al 2007.Isolation and chirality of 11microsatellite loci for the Sichuan snub-nonsed monkey, Rhinophthalmus roeterna. consensus Genetics,8(5): 1021) 1024; Liu et al 2008.identification of13Human Microstellatemaker via Cross-spectra Amplification of FecalSamples from Rhinophthalmus roenti. int J Primary, 29: 265. 272.)
1. The microsatellite loci with the repeat unit of 3-5 bases, the repeat number of more than 8 and the length of about 100-400bp are screened from the whole genome of the golden monkey.
2. Primers were successfully designed based on homologous sequences using Primer5.0 software.
3. Extracting the DNA of samples determined to be different golden monkey individuals, quantifying the DNA by using a Nanodrop quantifier, wherein the quantitative result shows that the nucleic acid concentration of the DNA sample is 30-400 ng/mu l, the OD260/280 is about 1.7-2.2, the OD260/230 is about 1.5-2.0, and the detection result of 1% agarose gel electrophoresis shows that the target band is clear and bright, thereby indicating that the DNA with better quality is extracted.
4. The 10 pairs of microsatellite primers (shown in Table 1) are respectively used for carrying out PCR amplification on the DNA of the golden monkey, the DNA of the golden monkey is successfully amplified, the amplification product is detected by using 2% agarose gel electrophoresis, the result shows that the target band is clear and bright and the size of the target band accords with the expectation, and only one band exists in the range of the target band, so that the result verifies the operability of the experiment and simultaneously verifies that the specificity of the primers is good. (see FIGS. 1 to 10 in detail)
TABLE 110 pairs of primers designed according to the invention
| Primer name | Sequence of |
| RB1F | GCAAAGACACACACATAGGCTCA |
| RB1R | ATGCCTTCTTTGTCTCTTGATCTT |
| RB2F | AGAGAGAATCCCCCTGAGCAT |
| RB2R | GAGCAAGACTCCATCTCAAAACA |
| RB3F | TTCCAACTAACACTAAAAGGAGGG |
| RB3R | CACAGGGGTGAAAATATTCAAGA |
| RB4F | GACAACCCAGAGCCATCTATGTA |
| RB4R | TGGGTGACAGAGTAAGACTCGGT |
| RB5F | CTGTGGAATCTGCCCATCAA |
| RB5R | GCCTGGACAACAGAGTAAGACAC |
| RB6F | GCTTCTGAATTCTTCCAATGTCC |
| RB6R | CCCTGAATTCCAAGAATGTCAA |
| RB7F | GTCTACTGTGGGTGAACCTGGA |
| RB7R | TGGGCCTAGAAGGTTGTGGT |
| RB8F | AGAGGTTGCAGTGAGCCAAGA |
| RB8R | GGACTACTGCTAAGCAAGGTATCG |
| RB9F | GGGTATCAGTCTGCTTTGGAATC |
| RB9R | GCACAAGTTCCCATTGCCATA |
| RB10F | GCCCTCCACTGCTCAATTTT |
| RB10R | GGTAGGAGAACTGCTTGATCCC |
5. Sequencing is carried out through a 3730 sequencer, results are obtained, locus analysis is carried out through GeneMapper software, a data peak graph is obtained, and manual correction is carried out on the sequencing result peak graph. The sequencing peak has clear peak shape, the distance between peaks meets the integral multiple of the repeating unit, and the number of peaks meets the single peak or double peaks of the identification result of the diploids of the cynomolgus monkey species.
6. Microsatellite amplification was carried out using DNA from a plurality of individuals identified as golden monkey, and the sequencing results showed that 10 pairs of primers were able to distinguish different individuals from each other, even from related individuals. See, in particular, example 3.
7. According to the Botstein standard, a PIC greater than 0.5 is a highly polymorphic site, a PIC between 0.25 and 0.5 is a moderately polymorphic site, and a PIC less than 0.25 is non-polymorphic. The 10 pairs of primers of the invention still show higher polymorphism in the amplification result under the conditions of close genetic relationship and small number of individuals (6 families, 15 individuals). See, in particular, example 3.
8. According to the glue graphs of FIGS. 1 to 10, the amplification effect of the microsatellite primer of the present invention is overall better, and is shown in the following aspects
(1) The specificity is better, and one band is amplified at the amplification site.
(2) The amplification success rate is high, and the samples can be amplified.
(3) The concentration of the amplification product is higher, the band of the amplification product is brighter, and the concentration of the product is higher.
9. FIG. 11 to FIG. 20 are photographs showing that the amplification effect of the microsatellite primer of the present invention is generally good in the following respects
(1) The specificity is better, and one band is amplified at the amplification site.
(2) The success rate of amplification is high and is 73.33 to 100 percent
(3) The concentration of the amplification product is higher, the band of the amplification product is brighter, and the concentration of the product is higher.
Ten microsatellite locus results between every two samples are compared through a microsatellite typing result, and the individual identification principle that 10 pairs of primers are the same or only 1 pair of primers have different amplification results and are the same individual is adopted. Through the known microsatellite data of individuals, 10 pairs of primers can be confirmed to distinguish different individuals, and the individual identification is successfully carried out.
The Primer design software in the second step of the invention can also be Primer premier, Oligo and the like.
Besides the above technical solutions, the PCR reagent in step five of the present invention can also be other reagents acceptable in other biological fields for amplifying sample DNA, such as Buffer, dNTP, DNA polymerase, etc.
Experimental example 1 primer method for screening and amplifying Microsatellite of Yunnan golden monkey
(1) The microsatellite loci with the repeat unit of 3-5 bases, the repeat number of more than 8 and the length of about 100-400bp are screened from the whole genome of the golden monkey.
(2) Primers were successfully designed based on homologous sequences using Primer5.0 software.
Experimental example 2 newly developed microsatellite amplification procedure
The invention adopts a 10 mul PCR system, which comprises the following components: 100ng-200ng DNA sample, 0.1. mu.l Goldstar Polymerase, 0.1. mu.l each of the front and rear primers (10. mu. mol/L), 2. mu.l Buffer, 1.2. mu.l dNTP (2.5mM), sterile water was added to make up to a total volume of 10. mu.l. And performing a gradient PCR experiment on the annealing temperature to obtain the optimal annealing temperature when the PCR amplification effect of each pair of primers is in the optimal state. The final PCR conditions used were: pre-denaturation at 95 ℃ for 10 min; denaturation at 94 ℃ for 30 seconds, touch down temperature for 40 seconds, extension at 72 ℃ for 40 seconds, and setting 13 circulation reactions, wherein the touch down temperature is 0.5 ℃ reduction of annealing temperature per circulation; denaturation at 94 ℃ for 30 seconds, optimal annealing temperature for 40 seconds, extension at 72 ℃ for 40 seconds, setting 30 cycle reactions, and extension at 60 ℃ for 30 minutes. After obtaining the amplification product, the size, brightness and purity of the product were checked by 2% agarose gel electrophoresis. The 10. mu.l PCR reaction system is shown in Table II. The PCR reaction procedure is shown in Table three. The optimal annealing temperatures of the 10 pairs of primers are shown in Table four.
Table two: 10 μ l PCR reaction System
| Stencil (ul) | 2 |
| Primer F (ul) | 0.1 |
| Primer R (ul) | 0.1 |
| dNTP(μl) | 1.2 |
| Buffer(μl) | 2 |
| GoldStar DNA Polymerase(μl) | 0.1 |
| ddH2O(μl) | 4.5 |
Table three: PCR reaction procedure
Table four: optimum annealing temperature of 10 pairs of primers
Experimental example 3 sequencing and Individual identification of the amplification results of the fluorescence-labeled primers
Using sample DNA from 15 individuals of the Fuyun monkey from 6 families (see Table V for relationship), the microsatellite fluorescent primers were subjected to PCR amplification using 10 pairs of the present invention, and the amplification effect was examined by agarose gel electrophoresis at 2% concentration, as shown in FIG. 11-FIG. 20. Sequencing by a 3730 sequencer to obtain a result, carrying out site analysis by using GeneMapper software to obtain a data peak diagram, and manually correcting the sequencing result according to the number of bases of the repetitive unit of each microsatellite site. The sequencing peak has clear peak shape, the distance between peaks meets the integral multiple of the repeating unit, and the number of peaks meets the single peak or double peaks of the identification result of the diploids of the cynomolgus monkey species.
Judging whether the sequencing results of every two sample individuals are the same according to the sequencing results, and identifying the same individual according to the principle that 10 pairs of primers are the same or only one pair of primers has different amplification results.
And (4) carrying out individual identification according to the microsatellite sequencing result, identifying known samples of different individuals into different individuals through a microsatellite experiment, and enabling the identification result to accord with the true condition of the individual to which the sample belongs. Even if a plurality of individuals with close relativity exist, the primer can still successfully distinguish the individuals into different individuals, and the primer can be used for identifying the individuals of the golden monkey.
Table five: genetic relationship between 15 individuals from 6 families
| Offspring | Father and father | Mother | |
| Family 1 | 1 | 3 | 4 |
| Family 1 | 1 | 3 | 4 |
| Family 2 | 5 | 7 | 8 |
| Family 2 | 6 | 7 | 8 |
| Family 3 | 9 | 7 | 10 |
| Family 4 | 11 | 12 | 13 |
| Household 5 | 14 | M | 13 |
| Family 6 | 15 | M | F |
Note: m is a male individual and F is a female individual, and is used only to illustrate relationship.
According to the Botstein standard, a PIC greater than 0.5 is a highly polymorphic site, a PIC between 0.25 and 0.5 is a moderately polymorphic site, and a PIC less than 0.25 is non-polymorphic. Sites with PIC greater than 0.5 can give more accurate results.
15 individuals used in the experiment are from 6 families in the same zoo, the genetic relationship of the individuals is relatively close (see table five in detail), the polymorphism information content PIC value of 10 pairs of primers is counted according to the experimental data, the polymorphism information content PIC value of the primers is greater than 0.5 (see table six in detail) except that the primer RB3 is close to 0.5, and the results show that the 10 pairs of primers can still show relatively high polymorphism in individual identification with the relatively close relationship, and the primers are proved to have relatively high polymorphism. Lays a necessary foundation for genetic diversity analysis, genetic relationship analysis, genetic linkage map construction and germplasm resource library establishment of the Yunnan golden monkey.
Table six: PIC values for 10 primer pairs
| Primer and method for producing the same | RB1 | RB2 | RB3 | RB4 | RB5 |
| PIC | 0.6 | 0.746 | 0.467 | 0.667 | 0.726 |
| Primer and method for producing the same | RB6 | RB7 | RB8 | RB9 | RB10 |
| PIC | 0.561 | 0.588 | 0.685 | 0.594 | 0.613 |
EXAMPLE 4 comparison of Effect of the same samples amplified with the primers of the prior art
In order to compare the effect of the primer of the present invention with that of the prior art, 8 pairs of primers were selected from the prior art to synthesize common primers, and the effect was compared by DNA amplification of 15 individuals of the cynomolgus monkey as in Experimental example 3.
A10. mu.l PCR system was used, the composition of which included: 100ng-200ng DNA sample, 0.1. mu.l Goldstar polymerase, 0.1. mu.l each of the front and rear primers (10. mu. mol/L), 2. mu.l Buffer, 1.2. mu.l dNTP (2.5mM), sterile water was added to make up to a total volume of 10. mu.l. And performing a gradient PCR experiment on the annealing temperature to obtain the optimal annealing temperature when the PCR amplification effect of each pair of primers is in the optimal state. The final PCR conditions used were: pre-denaturation at 95 ℃ for 10 min; denaturation at 94 ℃ for 30 seconds, touch down temperature for 40 seconds, extension at 72 ℃ for 40 seconds, and setting 13 circulation reactions, wherein the touch down temperature is 0.5 ℃ reduction of annealing temperature per circulation; denaturation at 94 ℃ for 30 seconds, optimal annealing temperature for 40 seconds, extension at 72 ℃ for 40 seconds, setting 30 cycle reactions, and extension at 60 ℃ for 30 minutes. After obtaining the amplification product, the size, brightness and purity of the product were checked by 2% agarose gel electrophoresis. The optimal annealing temperatures of the 8 pairs of primers are shown in Table seven. And the amplification effect was examined by agarose gel electrophoresis at 2% concentration, see FIGS. 21-28.
TABLE VII: optimal annealing temperature of 8 pairs of primers in literature
| Primer and method for producing the same | D6S271 | D7S2204 | D8S5505 | D11S2202 |
| Temperature (. degree.C.) | 61 | 61 | 62 | 62 |
| Primer and method for producing the same | D17S1290 | GM108 | GM109 | GM213 |
| Temperature (. degree.C.) | 62 | 60 | 61 | 62 |
The primers in the literature were found by comparison to be poorly effective when amplified using the same conditions and the same samples, with no bright single band. Only GM108 primer pair successfully amplified one sample, and no clearly visible band appeared in the remaining 7 primer pairs. The 10 pairs of microsatellite primers of the invention have bright and concentrated amplification bands and high amplification success rate, which shows that the microsatellite primers of the invention have good amplification effect compared with the primers in the prior art.
The above description is only a part of specific embodiments of the present invention (since the technical solution of the present invention includes parameters, the embodiments are not exhaustive, and the protection scope of the present invention is subject to the parameters of the present invention and other technical points), and the specific contents or common sense known in the solutions are not described herein too much. It should be noted that the above-mentioned embodiments do not limit the present invention in any way, and all technical solutions obtained by means of equivalent substitution or equivalent transformation for those skilled in the art are within the protection scope of the present invention. The scope of the claims of the present application shall be determined by the contents of the claims, and the description of the embodiments and the like in the specification shall be used to explain the contents of the claims.
<110> university of Yunnan
<120> microsatellite loci and primers suitable for identifying Yunnan golden monkey individuals
<160>20
<210>1
<211>23
<212>DNA
<213> Artificial sequence
<400>1
GCAAAGACACACACATAGGCTCA
<210>2
<211>24
<212>DNA
<213> Artificial sequence
<400>2
ATGCCTTCTTTGTCTCTTGATCTT
<210>3
<211>21
<212>DNA
<213> Artificial sequence
<400>3
AGAGAGAATCCCCCTGAGCAT
<210>4
<211>23
<212>DNA
<213> Artificial sequence
<400>4
GAGCAAGACTCCATCTCAAAACA
<210>5
<211>24
<212>DNA
<213> Artificial sequence
<400>5
TTCCAACTAACACTAAAAGGAGGG
<210>6
<211>23
<212>DNA
<213> Artificial sequence
<400>6
CACAGGGGTGAAAATATTCAAGA
<210>7
<211>23
<212>DNA
<213> Artificial sequence
<400>7
GACAACCCAGAGCCATCTATGTA
<210>8
<211>23
<212>DNA
<213> Artificial sequence
<400>8
TGGGTGACAGAGTAAGACTCGGT
<210>9
<211>20
<212>DNA
<213> Artificial sequence
<400>9
CTGTGGAATCTGCCCATCAA
<210>10
<211>23
<212>DNA
<213> Artificial sequence
<400>10
GCCTGGACAACAGAGTAAGACAC
<210>11
<211>23
<212>DNA
<213> Artificial sequence
<400>11
GCTTCTGAATTCTTCCAATGTCC
<210>12
<211>22
<212>DNA
<213> Artificial sequence
<400>12
CCCTGAATTCCAAGAATGTCAA
<210>13
<211>22
<212>DNA
<213> Artificial sequence
<400>13
GTCTACTGTGGGTGAACCTGGA
<210>14
<211>20
<212>DNA
<213> Artificial sequence
<400>14
TGGGCCTAGAAGGTTGTGGT
<210>15
<211>21
<212>DNA
<213> Artificial sequence
<400>15
AGAGGTTGCAGTGAGCCAAGA
<210>16
<211>24
<212>DNA
<213> Artificial sequence
<400>16
GGACTACTGCTAAGCAAGGTATCG
<210>17
<211>23
<212>DNA
<213> Artificial sequence
<400>17
GGGTATCAGTCTGCTTTGGAATC
<210>18
<211>21
<212>DNA
<213> Artificial sequence
<400>18
GCACAAGTTCCCATTGCCATA
<210>19
<211>20
<212>DNA
<213> Artificial sequence
<400>19
GCCCTCCACTGCTCAATTTT
<210>20
<211>22
<212>DNA
<213> Artificial sequence
<400>20
GGTAGGAGAACTGCTTGATCCC
Claims (7)
1. The microsatellite locus and the primer are suitable for identifying the individual of the Yunnan golden monkey, and the microsatellite locus is a microsatellite locus with a repeat unit of 3-5 bases, a repeat number of more than 8 and a length of 100-400bp screened from the whole genome of the Yunnan golden monkey.
2. The microsatellite locus and primer suitable for the identification of the golden monkey individual as claimed in claim 1 wherein the primer is 10 pairs of primer sets: RB1F, RB 1R; RB2F, RB 2R; RB3F, RB 3R; RB4F, RB 4R; RB5F, RB 5R; RB6F, RB 6R; RB7F, RB 7R; RB8F, RB 8R; RB9F, RB 9R; RB10F, RB 10R.
3. The microsatellite locus and primer suitable for the identification of the golden monkey individual as claimed in claim 1 wherein, the primer is 10 pairs of primer groups; the PCR amplification system is 10 mul PCR reaction system: template 2. mu.l, primer F0.1. mu.l, primer R0.1. mu.l, dNTP 1.2. mu.l, Buffer 2. mu.l, GoldStar DNA Polymerase 0.1. mu.l, ddH2O 4.5μl。
4. The microsatellite locus and primer suitable for the identification of the golden monkey individual as claimed in claim 3 wherein the PCR conditions of the 10 pairs of primer sets are: pre-denaturation at 95 ℃ for 10 min; denaturation at 94 ℃ for 30 seconds, touch down temperature for 40 seconds, extension at 72 ℃ for 40 seconds, and setting 13 circulation reactions, wherein the touch down temperature is 0.5 ℃ reduction of annealing temperature per circulation; denaturation at 94 ℃ for 30 seconds, annealing temperature for 40 seconds, extension at 72 ℃ for 40 seconds, setting 30 cycles of reaction, and extension at 60 ℃ for 30 minutes.
5. The microsatellite locus and primer suitable for the identification of the golden monkey individual as claimed in claim 1, wherein the method for obtaining the 10 pairs of primer sets by using the microsatellite locus screening comprises: sequencing an amplification product obtained after PCR amplification of the DNA of the golden monkey through a sequencer to obtain a result, carrying out site analysis by using GeneMapper software to obtain a data peak map, and manually correcting the sequencing result peak map; the sequencing peak has clear peak shape, the distance between peaks meets the integral multiple of the repeating unit, and the number of peaks meets the single peak or double peaks of the identification result of the diploids of the cynomolgus monkey species.
6. The microsatellite locus and primer suitable for the identification of the golden monkey individual as claimed in claim 1, wherein the method for obtaining the 10 pairs of primer sets by using the microsatellite locus screening comprises: extracting the DNA of samples determined to be different golden monkey individuals, quantifying the DNA by using a Nanodrop quantifier, and displaying the nucleic acid concentration of the DNA samples to be 30-400 ng/mu l, the OD260/280 to be 1.7-2.2 and the OD260/230 to be 1.5-2.0 by using a 1% agarose gel electrophoresis detection result, wherein the target band is clear and bright.
7. The microsatellite loci and primers of claim 1 suitable for use in the identification of an individual golden monkey; the method is characterized in that the microsatellite locus or the primer is also used for genetic diversity analysis or genetic relationship analysis or genetic linkage map construction or germplasm resource library establishment of the Yunnan golden monkey.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911235782.6A CN110791573B (en) | 2019-12-05 | 2019-12-05 | Microsatellite locus and primer suitable for identifying golden monkey individual |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911235782.6A CN110791573B (en) | 2019-12-05 | 2019-12-05 | Microsatellite locus and primer suitable for identifying golden monkey individual |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110791573A true CN110791573A (en) | 2020-02-14 |
| CN110791573B CN110791573B (en) | 2022-06-03 |
Family
ID=69447546
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911235782.6A Active CN110791573B (en) | 2019-12-05 | 2019-12-05 | Microsatellite locus and primer suitable for identifying golden monkey individual |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110791573B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114703294A (en) * | 2022-04-02 | 2022-07-05 | 西北大学 | Microsatellite detection method, locus combination, primer combination, kit and application for tracking golden monkey individual |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107586856A (en) * | 2017-10-17 | 2018-01-16 | 中国林业科学研究院森林生态环境与保护研究所 | A kind of Rhinopithecus roxellana Paternity and individual identification method based on SNP site |
| CN107779499A (en) * | 2017-10-17 | 2018-03-09 | 中国林业科学研究院森林生态环境与保护研究所 | Rhinopithecus roxellana genetic monitoring based on SNP site and breed management method |
| CN108034696A (en) * | 2018-02-02 | 2018-05-15 | 中南大学 | A kind of method based on transcript profile sequencing SSR primers development |
| CN108531609A (en) * | 2018-02-02 | 2018-09-14 | 中南大学 | One group of Rhinopithecus roxellana EST-SSR primers and kit based on transcript profile sequencing exploitation |
-
2019
- 2019-12-05 CN CN201911235782.6A patent/CN110791573B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107586856A (en) * | 2017-10-17 | 2018-01-16 | 中国林业科学研究院森林生态环境与保护研究所 | A kind of Rhinopithecus roxellana Paternity and individual identification method based on SNP site |
| CN107779499A (en) * | 2017-10-17 | 2018-03-09 | 中国林业科学研究院森林生态环境与保护研究所 | Rhinopithecus roxellana genetic monitoring based on SNP site and breed management method |
| CN108034696A (en) * | 2018-02-02 | 2018-05-15 | 中南大学 | A kind of method based on transcript profile sequencing SSR primers development |
| CN108531609A (en) * | 2018-02-02 | 2018-09-14 | 中南大学 | One group of Rhinopithecus roxellana EST-SSR primers and kit based on transcript profile sequencing exploitation |
Non-Patent Citations (2)
| Title |
|---|
| LI YU等: "Genomic analysis of snub-nosed monkeys (Rhinopithecus) identifies genes and processes related to high-altitude adaptation", 《NATURE GENETICS》 * |
| 余浩洋等: "川金丝猴基因组微卫星的分布特征研究", 《四川省动物学会会议论文集：第十三届全国野生动物生态与资源保护学术研讨会暨第六届中国西部动物学学术研讨会》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114703294A (en) * | 2022-04-02 | 2022-07-05 | 西北大学 | Microsatellite detection method, locus combination, primer combination, kit and application for tracking golden monkey individual |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110791573B (en) | 2022-06-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109457035B (en) | SSR fluorescence labeling primer for parent-child identification of trachinotus ovatus and application thereof | |
| CN108642208B (en) | General SSR molecular marker for cinnamomum and related plants and development method and application thereof | |
| CN106939334B (en) | Method for detecting fetal DNA content in plasma of pregnant woman | |
| CN110541041B (en) | SNP marker related to Chinese domestic horse dwarf trait and application thereof | |
| CN109486964B (en) | Microsatellite rapid detection method for individual identification and paternity test of donkeys | |
| CN110791573B (en) | Microsatellite locus and primer suitable for identifying golden monkey individual | |
| CN113249510B (en) | Method for identifying authenticity of lettuce hybrid and KASP primer combination used by method | |
| Lee et al. | Identification and characterization of simple sequence repeat markers for Pythium aphanidermatum, P. cryptoirregulare, and P. irregulare and the potential use in Pythium population genetics | |
| CN109929936B (en) | Fluorescence labeling multiplex amplification kit for detecting human Y chromosome rapid mutation STR locus and application | |
| CN108950043B (en) | Drowning-related plankton composite amplification detection system and kit | |
| CN107988334B (en) | Method for SNP typing by direct PCR of oral swab | |
| CN115725749A (en) | Mouse source cell STR detection kit, method and application | |
| CN113736892B (en) | Zokor polymorphism microsatellite molecular markers for plateau | |
| CN110628921B (en) | Human DIP-InDel locus fluorescence labeling kit and detection method | |
| CN110564863B (en) | Gosling sex identification method | |
| CN115505648A (en) | Development and application of KASP molecular marker of drought-resistant gene of corn | |
| CN114606335A (en) | Development and application of KASP molecular marker of sugarcane mosaic virus disease resistance gene of corn | |
| CN107988380B (en) | Method for inter-species molecular identification of Mytilus edulis, Mytilus coruscus and perna viridis | |
| CN109913575B (en) | KASP molecular marker for identifying CMS male sterility restoring gene of pepper, kit and application thereof | |
| CN106591462B (en) | Primer, kit and identification method for identifying genetic relationship between Yangtze river finless porpoise individuals | |
| CN111363843A (en) | PCR/LDR molecular marker and method for identifying genotype of nitrate transporter gene NRT1.1B of rice | |
| CN105838821B (en) | Method for detecting recessive lethal mutation of bovine APAF1 gene | |
| CN107574167B (en) | Hyriopsis cumingii microsatellite marker and application thereof | |
| CN112680530B (en) | Highly-degraded test material detection kit based on 18 multiple insertion deletion genetic markers | |
| CN116377112B (en) | Universal polymorphism microsatellite molecular marker for twelve kinds of armillaria parasitica, and primers and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |