CN110791559A - Double-row eyelash screening kit - Google Patents
Double-row eyelash screening kit Download PDFInfo
- Publication number
- CN110791559A CN110791559A CN201910686563.3A CN201910686563A CN110791559A CN 110791559 A CN110791559 A CN 110791559A CN 201910686563 A CN201910686563 A CN 201910686563A CN 110791559 A CN110791559 A CN 110791559A
- Authority
- CN
- China
- Prior art keywords
- pro
- ala
- gly
- reagent
- ser
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention relates to the field of in-vitro diagnostic kits, in particular to a double-row ciliary screening kit. The invention provides a biomarker related to bilinear ciliary, which is DNA obtained by inserting a GCCGCCT sequence into the 937 th-938 th base of a coding region on the basis of a human FOXC2 gene sequence. The invention also provides a double-row ciliary screening kit which consists of the reagents for amplifying and detecting the DNA. The method can effectively screen the double-row eyelash, and has good application prospect.
Description
Technical Field
The invention relates to the field of in-vitro diagnostic kits, in particular to a double-row ciliary screening kit.
Background
The double-row eyelash is that the back of the root of the positive eyelash is equivalent to the opening of the meibomian gland to grow another row of redundant eyelash, also called as the auxiliary eyelash; can irritate conjunctiva and cornea and cause damage. Double row eyelash is caused by congenital eyelash dysplasia.
Sometimes double-row ciliary symptoms are atypical and ophthalmic examinations may miss such atypical cases. Symptoms may not typically affect the life of the patient himself, but their offspring may be plagued by double rows. In this case, in vitro molecular diagnostics are often required to aid diagnosis.
However, no screening kit aiming at the double-row ciliary is available on the market at present.
Disclosure of Invention
In order to solve the problems, the invention provides a biomarker related to bilinear ciliary muscle, which is DNA obtained by inserting a GCCGCCT sequence into bases 937-938 (C.937-938) of a coding region on the basis of the sequence of a human FOXC2 gene.
The invention also provides the application of the reagent of the biomarker in the preparation of a double-row ciliary screening kit.
The invention also provides another biomarker related to trichiasis, which is mRNA or protein obtained by transcription or translation of the DNA.
The invention also provides the application of the reagent of the biomarker (mRNA or protein) in the preparation of a double-row eyelash screening kit.
The invention also provides a double-row ciliary screening kit, which contains the reagent for detecting the DNA.
Such as the aforementioned kit, which further comprises a reagent for amplifying the aforementioned DNA.
The kit as described above, wherein the reagent for detecting the DNA is a sequencing reagent.
The kit as described above, wherein the reagent for detecting the DNA is a fluorescent quantitative PCR reagent.
The kit as described above, wherein the reagent for detecting DNA is a reagent for a restriction fragment length polymorphism method.
The reagent for detecting DNA as described above in the kit described above is a reagent for single strand conformation polymorphism analysis.
The invention has the following beneficial effects:
1) the invention provides gene sequence polymorphism sites for double-row ciliary screening, and DNA, mRNA and protein of the site which are changed can be used as biomarkers for double-row ciliary screening, early intervention and treatment, and the application prospect is wide.
2) The kit provided by the invention can simply and effectively screen double-row eyelashes.
Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.
The foregoing aspects of the present invention are explained in further detail below with reference to specific embodiments. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.
Drawings
FIG. 1: family atlas of double-row eyelash 2355 family; oblique-bar table is faulty, solid circle or solid square table indicates patient, arrow indicates probation.
FIG. 2: and (3) directly sequencing a PCR product to detect a mutant sequence map of the C.937-938 inserted into GCCGCCT base.
FIG. 3: FOXC2 gene expression was detected in human embryonic tissue (Placenta), human lung tissue (H-lung), human kidney epithelial cells (HEK293), retina (Retain).
Detailed Description
Example 1 sample Collection and extraction of genomic DNA
The family and case samples were obtained from samples collected from the national natural science gene fund (course No.: 81570888, 81870683) borne by the national laboratory for the genetic study of human diseases in the national hospital of people's hospital of Sichuan province, Sichuan province. The members of the two-line ciliary family (2355) are 4 persons in total, and 2 patients with the two-line ciliary are shown in the family (figure 1). All subjects were Han's and signed informed consent, and the study was approved by the ethical Committee.
Each person collects 5ml of EDTA anticoagulated peripheral blood sample, and extracts genome DNA by salting out method, which comprises the following steps: centrifuging 5ml EDTA anticoagulated blood sample at 3000rpm for 10min, sucking the middle leucocyte layer with Pasteur pipette, adding 10ml erythrocyte lysate (formula: 1g HCO)3、8.3gNH4Cl and 0.037g EDTA-Na2Dissolving in 1L sterile water in 15ml centrifuge tube), reversing for 6-8 times, and standing at room temperature for 10 min; centrifuging at room temperature at 3000rpm for 10min, removing supernatant, and performing vortex oscillation for 15 s; adding 4ml of erythrocyte lysate, oscillating for 15 seconds in a vortex, centrifuging for 10min at the room temperature of 3000rpm, removing supernatant, and leaving leukocyte clusters at the bottom of the tube; vortex oscillating for 30 s to fully disperse the leukocyte clusters, adding 4ml of leukocyte lysate (formula:) and 40ul of proteinase K, vortex oscillating for 5 s, water bathing at 65 ℃ for 30-60min until the leukocyte clusters disappear, and vortex oscillating for 5 s; cooling to room temperature, adding 1.5ml saturated sodium chloride solution (formula:), vortex oscillating for 15 s, centrifuging at room temperature 3000rpm for 10min, and transferring the supernatant to another centrifuge tube; adding 4ml of isopropanol into the supernatant, reversing and uniformly mixing for 10-15 times, centrifuging at room temperature of 3000rpm for 15min, and removing the supernatant; adding 2ml of 75% anhydrous ethanol, shaking gently, centrifuging at 3000rpm for 15min, removing supernatant, drying at room temperature for 1-2 hr, adding 200ul of DEPC water, dissolving, and storing at-80 deg.C.
Example 2 detection of variation of insertion of the FOXC2 Gene at position C.937-938 into GCCGCCT
Detection method
1. Extraction of blood genomic DNA of members of the Birowan Mascara 2355 family
2. Detection of mutation site of FOXC2 gene C.937-938 inserted into GCCGCCT base
(1) And (3) PCR amplification:
PCR amplification was performed using 2X PCR mix produced by Kangji as a template and the primer set A (the upstream primer (SEQ ID NO. 1): AAGGTGGTGATCAAGAGCGA; the downstream primer (SEQ ID NO. 2): GAGGTGGTTCAGGTCCCC).
The method comprises the following steps: 2 XPCRmix 10ul, 1ul (10umol/ul) of each of the upstream and downstream primers, 1ul of template DNA (25ng/ul), ddH2O 7ul。
The procedure is as follows: pre-denaturation at 95 ℃ for 5min, annealing at 95 ℃ for 30 sec, annealing at 54 ℃ for 30 sec, extension at 72 ℃ for 45 sec, 35 cycles; extension at 72 ℃ for 7 minutes and incubation at 12 ℃.
The amplification product has the following sequence (SEQ ID NO.3, 678 bp):
(2) and (3) PCR product purification: 1.5ul of the PCR product obtained in step (1) was added with 3.5ul of an Exco-SAP purified enzyme (manufactured by Thermo Co.).
The procedure is as follows: 30 minutes at 37 ℃, 15 minutes at 80 ℃ and heat preservation at 12 ℃.
(3) Sequencing reaction: sequencing with the DNA fragment sequencing kit from ABI using the product of step (2) as a template and the upstream primer (sequence: AAGGTGGTGATCAAGAGCGA) of primer pair A as a primer.
Reaction system: 2ul of purified PCR product, 0.3ul of 5 XBuffer, 0.3ul of upstream primer (10umol/ul) of primer pair A, 0.3ul of Bigdye, 7.1ul of ddH2O。
The procedure is as follows: at 96 deg.C for 15 seconds, at 50 deg.C for 10 seconds, at 60 deg.C for 4 minutes, for 29 cycles, and at 12 deg.C for heat preservation.
(4) And (3) purifying sequencing reaction products: adding 50u of 175% ethanol into each reaction, centrifuging for 30 minutes at 4000 rpm, removing supernatant, standing for 30 minutes at room temperature, air drying ethanol, and adding 10ul ddH2And O, sequencing on the computer.
(5) Sequencing and analyzing on a computer: sequencing analysis was performed using an ABI 3730 sequencer.
Second, the detection result
Sequencing diagrams of the FOXC2 gene C.937-938 insertion GCCGCCT base mutation are shown in FIG. 2, and Table 2 is drawn according to the sequencing diagrams and the basic situation of the two-line lash 2355 family member.
TABLE 2 Baseline of two-line Masa 2355 family members and FOXC2 Gene sequencing results
Members of the family 2355 of cilia bilinearica total 4, 2 of the cilia bilinearica patients, and FIG. 1 shows that among the cilia bilinearica 2355 family members, the cilia bilinearica patients all have the base mutation of FOXC2 gene C.937-938 inserting GCCGCCT, and the FOXC2 gene C.938 is A/A genotype, i.e., the members without A/GCCGCCTA variation do not have cilia bilinearica.
Experiments prove that the existence of FOXC2 gene mutation is closely related to the risk of double-row ciliary diseases. Furthermore, the protein change caused by the mutation of the gene is often closely related to the risk of the double-row ciliary disease.
Example 4 detection of FOXC2 Gene C.937-938insGCCGCCT genotype in a non-two-line Mascara population
Detection method
1. The genomic DNA of blood was extracted from 300 non-double-row ciliary patients, respectively.
2. Mutation detection
The same as in section 2 of the first part of example 2.
Second, the detection result
The detected genotypes of the 937 th to 938 th bases of the FOXC2 gene coding region of 300 non-double-row ciliary patients are all wild homozygotes.
Example 5 analysis of the Gene sequence of FOXC2 Gene and its expression in human tissues
1. The FOXC2 gene has the size of 2900bp, and the gene sequence (SEQ ID NO.4) is as follows:
the bold italic base in the sequence indicates the position and variation of the mutated base, and the C.937-938 inserts GCCGCCT base, and the two mutations can cause frame shift mutation, which are respectively: tyr → Arg (alanine → arginine) position 313, a frameshift mutation, terminating early at position 464; tyr → Cys (alanine → cysteine) position 313, a frameshift mutation, terminating early at position 464.
2. The FOXC2 gene encodes a protein molecule of 501 amino acids, and the amino acid sequence (SEQ ID NO.5) of the FOXC2 gene is shown as follows:
after the FOXC2 gene C.937-938 is inserted into GCCGCCT alkali base mutation, the amino acid sequence (SEQ ID NO.6) is as follows:
bold italics in the sequence indicate that a frame shift mutation begins at position 313 of the amino acid residue sequence.
3. The expression condition of FOXC2 gene in human embryo tissue, human lung tissue, human kidney epithelial cell and retina is detected by RT-PCR method. The RNA was extracted using Trizol RNA extraction kit from Trans Gene Biotech, according to the built-in instructions. RT-PCR was performed using a kit from Thermo company, housekeeping gene-GAPDH as an internal reference, and the results are shown in FIG. 3, according to the instructions.
As can be seen from FIG. 3, the FOXC2 gene is expressed in human embryonic tissue, human lung tissue, human kidney epithelial cells, and retina, and the risk of developing trichiasis in the sample to be tested can be determined by detecting mRNA or protein of FOXC2 in these tissues.
Example 6 detection kit
The kit comprises the following components in parts by weight and a using method:
composition of kit
PCR amplification reagent (50 persons)
Purifying reagent (50 persons)
Sequencing reagent (50 persons)
Standard DNA sample (50 persons)
Second, kit using method
(1) DNA extraction
Collecting patient peripheral blood (EDTA pit coagulation) 2m1, and extracting its genome DNA
(2) Amplifying DNA fragment in which SNP site is located by PCR
PCR amplification (20ul System)
Reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min, annealing at 95 ℃ for 30 sec, annealing at 54 ℃ for 30 sec, extension at 72 ℃ for 45 sec, 35 cycles; extension at 72 ℃ for 7 minutes and incubation at 12 ℃.
And (3) detecting a PCR product: the quality of the PCR product was preliminarily judged by 2% agarose gel electrophoresis with reference to DNA marker.
(3) Purification of PCR product
Reaction conditions are as follows: 30 minutes at 37 ℃, 15 minutes at 80 ℃ and heat preservation at 12 ℃.
(4) Sequencing and detecting
Reaction conditions are as follows: at 96 deg.C for 15 seconds, at 50 deg.C for 10 seconds, at 60 deg.C for 4 minutes, for 29 cycles, and at 12 deg.C for heat preservation.
1. And (3) purifying sequencing reaction products: adding 50u of 175% ethanol into each reaction, centrifuging for 30 minutes at 4000 rpm, removing supernatant, standing for 30 minutes at room temperature, air drying ethanol, and adding 10ul ddH2And O, sequencing on the computer.
2. Sequencing and analyzing on a computer: sequencing analysis was performed using an ABI-3730 sequencer.
The kit is used for: two-line reference for genetic diagnosis and genotyping of ciliary patients.
In conclusion, the polymorphism of the SNP site 938 of the FOXC2 gene is obviously related to the suffering of the double-row lash, and the polymorphism can be determined to be used for the double-row lash screening. The kit for polymorphic sites and the use instruction provided by the invention can sensitively and efficiently detect whether a patient has gene variation, find a target for further accurate gene therapy and have good application market prospect.
SEQUENCE LISTING
<110> affiliated Hospital of electronic technology university, people Hospital of Sichuan province
<120> double-row eyelash screening kit
<130>GYKH1182-2019P017603CC
<160>6
<170>PatentIn version 3.5
<210>1
<211>20
<212>DNA
<213> Artificial sequence (artificial seq.)
<400>1
aaggtggtga tcaagagcga 20
<210>2
<211>18
<212>DNA
<213> Artificial sequence (artificial seq.)
<400>2
gaggtggttc aggtcccc 18
<210>3
<211>678
<212>DNA
<213> human (homo sapiens)
<400>3
aaggtggtga tcaagagcga ggcggcgtcc ccggcgctgc cggtcatcac caaggtggag 60
acgctgagcc ccgagagcgc gctgcagggc agcccgcgca gcgcggcctc cacgcccgcc 120
ggctcccccg acggctcgct gccggagcac cacgccgcgg cgcccaacgg gctgcctggc 180
ttcagcgtgg agaacatcat gaccctgcga acgtcgccgc cgggcggaga gctgagcccg 240
ggggccggac gcgcgggcct ggtggtgccg ccgctggcgc tgccctacgc cgccgcgccg 300
cccgccgcct acggccagcc gtgcgctcag ggcctggagg ccggggccgc cgggggctac 360
cagtgcagca tgcgagcgat gagcctgtac accggggccg agcggccggc gcacatgtgc 420
gtcccgcccg ccctggacga ggccctctcg gaccacccga gcggccccac gtcgcccctg 480
agcgctctca acctcgccgc cggccaggag ggcgcgctcg ccgccacggg ccaccaccac 540
cagcaccacg gccaccacca cccgcaggcg ccgccgcccc cgccggctcc ccagccccag 600
ccgacgccgc agcccggggc cgccgcggcg caggcggcct cctggtatct caaccacagc 660
ggggacctga accacctc 678
<210>4
<211>2907
<212>DNA
<213> human (homo sapiens)
<400>4
gaaacttttc ccaatcccta aaagggactt ggcctctttt tctgggctca gcggggcagc 60
cgctcggacc ccggcgcgct gaccctcggg gctgccgatt cgctgggggc ttggagagcc 120
tcctgcgccc ctcctcgcgc gggccgaggg tccacctggg tccccaggcc gcggcgtctc 180
cgctgggtcc gcggccgccc gcctgcccgc gctgccgccg ccgggtcctg gagccagcga 240
ggagcggggc cggcgctgcg cttgcccggg gcgcgccctc caggatgccg atccgcccgg 300
tccgctgaaa gcgcgcgccc ctgctcggcc cgagcgccgc cgcccgcgca ccctcgcccc 360
ggaggctgcc aggagcccgg ggccgcccct cccgctcccc tcctctcccc ctctggctct 420
ctcgcgctct ctcgctctca gggcccccct cgctcccccg gccgcagtcc gtgcgcgagg 480
gcgccggcga gccgtctcgg aagcagcatg caggcgcgct actccgtgtc cgaccccaac 540
gccctgggag tggtgcccta cctgagcgag cagaattact accgggctgc gggcagctac 600
ggcggcatgg ccagccccat gggcgtctat tccggccacc cggagcagta cagcgcgggg 660
atgggccgct cctacgcgcc ctaccaccac caccagcccg cggcgcctaa ggacctggtg 720
aagccgccct acagctacat cgcgctcatc accatggcca tccagaacgc gcccgagaag 780
aagatcacct tgaacggcat ctaccagttc atcatggacc gcttcccctt ctaccgggag 840
aacaagcagg gctggcagaa cagcatccgc cacaacctct cgctcaacga gtgcttcgtc 900
aaggtgcccc gcgacgacaa gaagcccggc aagggcagtt actggaccct ggacccggac 960
tcctacaaca tgttcgagaa cggcagcttc ctgcggcgcc ggcggcgctt caaaaagaag 1020
gacgtgtcca aggagaagga ggagcgggcc cacctcaagg agccgccccc ggcggcgtcc 1080
aagggcgccc cggccacccc ccacctagcg gacgccccca aggaggccga gaagaaggtg 1140
gtgatcaaga gcgaggcggc gtccccggcg ctgccggtca tcaccaaggt ggagacgctg 1200
agccccgaga gcgcgctgca gggcagcccg cgcagcgcgg cctccacgcc cgccggctcc 1260
cccgacggct cgctgccgga gcaccacgcc gcggcgccca acgggctgcc tggcttcagc 1320
gtggagaaca tcatgaccct gcgaacgtcg ccgccgggcg gagagctgag cccgggggcc 1380
ggacgcgcgg gcctggtggt gccgccgctg gcgctgccct acgccgccgc gccgcccgcc 1440
gcctgccgcc tacggccagc cgtgcgctca gggcctggag gccggggccg ccgggggcta 1500
ccagtgcagc atgcgagcga tgagcctgta caccggggcc gagcggccgg cgcacatgtg 1560
cgtcccgccc gccctggacg aggccctctc ggaccacccg agcggcccca cgtcgcccct 1620
gagcgctctc aacctcgccg ccggccagga gggcgcgctc gccgccacgg gccaccacca 1680
ccagcaccac ggccaccacc acccgcaggc gccgccgccc ccgccggctc cccagcccca 1740
gccgacgccg cagcccgggg ccgccgcggc gcaggcggcc tcctggtatc tcaaccacag 1800
cggggacctg aaccacctcc ccggccacac gttcgcggcc cagcagcaaa ctttccccaa 1860
cgtgcgggag atgttcaact cccaccggct ggggattgag aactcgaccc tcggggagtc 1920
ccaggtgagt ggcaatgcca gctgccagct gccctacaga tccacgccgc ctctctatcg 1980
ccacgcagcc ccctactcct acgactgcac gaaatactga cgtgtcccgg gacctcccct 2040
ccccggcccg ctccggcttc gcttcccagc cccgacccaa ccagacaatt aaggggctgc 2100
agagacgcaa aaaagaaaca aaacatgtcc accaaccttt tctcagaccc gggagcagag 2160
agcgggcacg ctagccccca gccgtctgtg aagagcgcag gtaactttaa ttcgccgccc 2220
cgtttctggg atcccaggaa acccctccaa agggacgcag cccaacaaaa tgagtattga 2280
tcttaaaatc cccctcccct accaggacgg ctgtgctgtg ctcgacctga gctttcaaaa 2340
gttaagttat ggaccaaatc ccatagcgag cccctagtga ctttctgtag gggtccccat 2400
aggtgtatgg gggtctctat agataatata tgtgctgtgt gtaattttaa atttctccaa 2460
ccgtgctgta caaatgtgtg gatttgtaat caggctattt tgttgttgtt gttgttgttc 2520
agagccatta atataatatt taaagttgag ttcactggat aagtttttca tcttgcccaa 2580
ccatttctaa ctgccaaatt gaattcaaga aaccgatgtg ggttttgttt cctgtacaat 2640
tatgagatat aattcttttt cccattgtag gtcttttaca aaacaagaaa ataatttatt 2700
tttttgttgg tggataaaga agtcaagtat ctgatacttt ttatttacaa agtgtgatgg 2760
ttttgtatag taggttccac cctgagtatt cctaaaagaa aaaaaaaaaa aaagcttaaa 2820
aactctaact tcatctgtgt ttgtcttacg tggtcttaat cgttgtactt accttaaaat 2880
aaacccatgt tgttttttct gcccaaa 2907
<210>5
<211>501
<212>PRT
<213> human (homo sapiens)
<400>5
Met Gln Ala Arg Tyr Ser Val Ser Asp Pro Asn Ala Leu Gly Val Val
15 10 15
Pro Tyr Leu Ser Glu Gln Asn Tyr Tyr Arg Ala Ala Gly Ser Tyr Gly
20 25 30
Gly Met Ala Ser Pro Met Gly Val Tyr Ser Gly His Pro Glu Gln Tyr
35 40 45
Ser Ala Gly Met Gly Arg Ser Tyr Ala Pro Tyr His His His Gln Pro
50 55 60
Ala Ala Pro Lys Asp Leu Val Lys Pro Pro Tyr Ser Tyr Ile Ala Leu
65 70 75 80
Ile Thr Met Ala Ile Gln Asn Ala Pro Glu Lys Lys Ile Thr Leu Asn
85 90 95
Gly Ile Tyr Gln Phe Ile Met Asp Arg Phe Pro Phe Tyr Arg Glu Asn
100 105 110
Lys Gln Gly Trp Gln Asn Ser Ile Arg His Asn Leu Ser Leu Asn Glu
115 120 125
Cys Phe Val Lys Val Pro Arg Asp Asp Lys Lys Pro Gly Lys Gly Ser
130 135 140
Tyr Trp Thr Leu Asp Pro Asp Ser Tyr Asn Met Phe Glu Asn Gly Ser
145 150 155 160
Phe Leu Arg Arg Arg Arg Arg Phe Lys Lys Lys Asp Val Ser Lys Glu
165170 175
Lys Glu Glu Arg Ala His Leu Lys Glu Pro Pro Pro Ala Ala Ser Lys
180 185 190
Gly Ala Pro Ala Thr Pro His Leu Ala Asp Ala Pro Lys Glu Ala Glu
195 200 205
Lys Lys Val Val Ile Lys Ser Glu Ala Ala Ser Pro Ala Leu Pro Val
210 215 220
Ile Thr Lys Val Glu Thr Leu Ser Pro Glu Ser Ala Leu Gln Gly Ser
225 230 235 240
Pro Arg Ser Ala Ala Ser Thr Pro Ala Gly Ser Pro Asp Gly Ser Leu
245 250 255
Pro Glu His His Ala Ala Ala Pro Asn Gly Leu Pro Gly Phe Ser Val
260 265 270
Glu Asn Ile Met Thr Leu Arg Thr Ser Pro Pro Gly Gly Glu Leu Ser
275 280 285
Pro Gly Ala Gly Arg Ala Gly Leu Val Val Pro Pro Leu Ala Leu Pro
290 295 300
Tyr Ala Ala Ala Pro Pro Ala Ala Tyr Gly Gln Pro Cys Ala Gln Gly
305 310 315 320
Leu Glu Ala Gly Ala Ala Gly Gly Tyr Gln Cys Ser Met Arg Ala Met
325330 335
Ser Leu Tyr Thr Gly Ala Glu Arg Pro Ala His Met Cys Val Pro Pro
340 345 350
Ala Leu Asp Glu Ala Leu Ser Asp His Pro Ser Gly Pro Thr Ser Pro
355 360 365
Leu Ser Ala Leu Asn Leu Ala Ala Gly Gln Glu Gly Thr Tyr Arg Ala
370 375 380
Thr Gly His His His Gln His His Gly His His His Pro Gln Ala Pro
385 390 395 400
Pro Pro Pro Pro Ala Pro Gln Pro Gln Pro Thr Pro Gln Pro Gly Ala
405 410 415
Ala Ala Ala Gln Ala Ala Ser Trp Tyr Leu Asn His Ser Gly Asp Leu
420 425 430
Asn His Leu Pro Gly His Thr Phe Ala Ala Gln Gln Gln Thr Phe Pro
435 440 445
Asn Val Arg Glu Met Phe Asn Ser His Arg Leu Gly Ile Glu Asn Ser
450 455 460
Thr Leu Gly Glu Ser Gln Val Ser Gly Asn Ala Ser Cys Gln Leu Pro
465 470 475 480
Tyr Arg Ser Thr Pro Pro Leu Tyr Arg His Ala Ala Pro Tyr Ser Tyr
485490 495
Asp Cys Thr Lys Tyr
500
<210>6
<211>463
<212>PRT
<213> human (homo sapiens)
<400>6
Met Gln Ala Arg Tyr Ser Val Ser Asp Pro Asn Ala Leu Gly Val Val
1 5 10 15
Pro Tyr Leu Ser Glu Gln Asn Tyr Tyr Arg Ala Ala Gly Ser Tyr Gly
20 25 30
Gly Met Ala Ser Pro Met Gly Val Tyr Ser Gly His Pro Glu Gln Tyr
35 40 45
Ser Ala Gly Met Gly Arg Ser Tyr Ala Pro Tyr His His His Gln Pro
50 55 60
Ala Ala Pro Lys Asp Leu Val Lys Pro Pro Tyr Ser Tyr Ile Ala Leu
65 70 75 80
Ile Thr Met Ala Ile Gln Asn Ala Pro Glu Lys Lys Ile Thr Leu Asn
85 90 95
Gly Ile Tyr Gln Phe Ile Met Asp Arg Phe Pro Phe Tyr Arg Glu Asn
100 105 110
Lys Gln Gly Trp Gln Asn Ser Ile Arg His Asn Leu Ser Leu Asn Glu
115 120 125
Cys Phe Val Lys Val Pro Arg Asp Asp Lys Lys Pro Gly Lys Gly Ser
130 135 140
Tyr Trp Thr Leu Asp Pro Asp Ser Tyr Asn Met Phe Glu Asn Gly Ser
145 150 155 160
Phe Leu Arg Arg Arg Arg Arg Phe Lys Lys Lys Asp Val Ser Lys Glu
165 170 175
Lys Glu Glu Arg Ala His Leu Lys Glu Pro Pro Pro Ala Ala Ser Lys
180 185 190
Gly Ala Pro Ala Thr Pro His Leu Ala Asp Ala Pro Lys Glu Ala Glu
195 200 205
Lys Lys Val Val Ile Lys Ser Glu Ala Ala Ser Pro Ala Leu Pro Val
210 215 220
Ile Thr Lys Val Glu Thr Leu Ser Pro Glu Ser Ala Leu Gln Gly Ser
225 230 235 240
Pro Arg Ser Ala Ala Ser Thr Pro Ala Gly Ser Pro Asp Gly Ser Leu
245 250 255
Pro Glu His His Ala Ala Ala Pro Asn Gly Leu Pro Gly Phe Ser Val
260 265 270
Glu Asn Ile Met Thr Leu Arg Thr Ser Pro Pro Gly Gly Glu Leu Ser
275 280285
Pro Gly Ala Gly Arg Ala Gly Leu Val Val Pro Pro Leu Ala Leu Pro
290 295 300
Tyr Ala Ala Ala Pro Pro Ala Ala Cys Arg Leu Arg Pro Ala Val Arg
305 310 315 320
Ser Gly Pro Gly Gly Arg Gly Arg Arg Gly Leu Pro Val Gln His Ala
325 330 335
Ser Asp Glu Pro Val His Arg Gly Arg Ala Ala Gly Ala His Val Arg
340 345 350
Pro Ala Arg Pro Gly Arg Gly Pro Leu Gly Pro Pro Glu Arg Pro His
355 360 365
Val Ala Pro Glu Arg Ser Gln Pro Arg Arg Arg Pro Gly Gly Arg Ala
370 375 380
Arg Arg His Gly Pro Pro Pro Pro Ala Pro Arg Pro Pro Pro Pro Ala
385 390 395 400
Gly Ala Ala Ala Pro Ala Gly Ser Pro Ala Pro Ala Asp Ala Ala Ala
405 410 415
Arg Gly Arg Arg Gly Ala Gly Gly Leu Leu Val Ser Gln Pro Gln Arg
420 425 430
Gly Pro Glu Pro Pro Pro Arg Pro His Val Arg Gly Pro Ala Ala Asn
435 440445
Phe Pro Gln Arg Ala Gly Asp Val Gln Leu Pro Pro Ala Gly Asp
450 455 460
Claims (10)
1. A biomarker associated with double-row ciliary muscle, comprising: the DNA is obtained by inserting a GCCGCCT sequence into the 937 th to 938 th bases of a coding region on the basis of a human FOXC2 gene sequence.
2. Use of a reagent for detecting the biomarker of claim 1 in the preparation of a two-line ciliary screening kit.
3. A biomarker associated with double-row ciliary muscle, comprising: it is mRNA or protein obtained by transcription or translation of the DNA according to claim 1.
4. Use of a reagent for detecting a biomarker according to claim 3 in the preparation of a two-line ciliary screening kit.
5. A two-line ciliary screening kit, comprising: it contains a reagent for detecting the DNA according to claim 1.
6. The kit of claim 5, wherein: it further comprises a reagent for amplifying the DNA according to claim 1.
7. The kit of claim 5, wherein: the reagent for detecting the DNA is a sequencing reagent.
8. The kit of claim 5, wherein: the reagent for detecting DNA is a fluorescent quantitative PCR reagent.
9. The kit of claim 5, wherein: the reagent for detecting DNA is a reagent for a restriction fragment length polymorphism method.
10. The kit of claim 5, wherein: the reagent for detecting DNA is a reagent for analyzing single-strand conformation polymorphism.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2019104603960 | 2019-05-29 | ||
| CN201910460396 | 2019-05-29 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110791559A true CN110791559A (en) | 2020-02-14 |
| CN110791559B CN110791559B (en) | 2021-04-16 |
Family
ID=69426954
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910686563.3A Active CN110791559B (en) | 2019-05-29 | 2019-07-26 | Double-row eyelash screening kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110791559B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013085998A1 (en) * | 2011-12-05 | 2013-06-13 | Verastem, Inc. | Therapeutic compositions and related methods of use |
| CN103993096A (en) * | 2014-06-09 | 2014-08-20 | 中国医学科学院血液病医院（血液学研究所） | Kit for diagnosing congenital bone marrow failure diseases |
| CN105803054A (en) * | 2014-12-31 | 2016-07-27 | 天津华大基因科技有限公司 | Kit and use thereof in detection of orofacial clefts related genes |
| CN106868104A (en) * | 2015-12-10 | 2017-06-20 | 益善生物技术股份有限公司 | Lung cancer circulating tumor cell Classification Identification kit |
-
2019
- 2019-07-26 CN CN201910686563.3A patent/CN110791559B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013085998A1 (en) * | 2011-12-05 | 2013-06-13 | Verastem, Inc. | Therapeutic compositions and related methods of use |
| CN103993096A (en) * | 2014-06-09 | 2014-08-20 | 中国医学科学院血液病医院（血液学研究所） | Kit for diagnosing congenital bone marrow failure diseases |
| CN105803054A (en) * | 2014-12-31 | 2016-07-27 | 天津华大基因科技有限公司 | Kit and use thereof in detection of orofacial clefts related genes |
| CN106868104A (en) * | 2015-12-10 | 2017-06-20 | 益善生物技术股份有限公司 | Lung cancer circulating tumor cell Classification Identification kit |
Non-Patent Citations (1)
| Title |
|---|
| YE ZIMENG 等: ""A novel FOXC2 frameshift mutation found in a Chinese family with Lymphedema- Distichiasis"", 《中华医学会第十五次全国医学遗传学学术会议暨中国医师协会医学遗传医师分会第一届全国学术会议暨2016年浙江省医学遗传学年会论文汇编》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110791559B (en) | 2021-04-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109576367B (en) | Primers, kit and method for detecting BCOR gene mutation | |
| CN111004849B (en) | Primer, method and kit for detecting multiple site mutations of CDH1 gene | |
| CN104745592B (en) | CYP4V2 gene mutant and application thereof | |
| CN110791559B (en) | Double-row eyelash screening kit | |
| CN111621563A (en) | Primer group for detecting human SERPINF1 gene mutation and kit thereof | |
| CN110551728B (en) | FOXC1 gene mutant and application thereof | |
| RU2393772C1 (en) | Method of predicting development of recurrent invasive urinary bladder cancer | |
| CN108410990B (en) | Application of IGFBP3 in preparation of product for diagnosing I-type neurofibroma combined with spinal malformation disease | |
| CN110951862A (en) | Method, primer and kit for detecting CYP21A2 gene mutation | |
| WO2016070550A1 (en) | Detection primers, method and kit for dystonia vps16 gene | |
| CN115216533A (en) | Biomarker for diagnosing Wilson's disease, amplification primer set, detection reagent and application | |
| CN112626203A (en) | Primer and method for detecting mutations of C.55C > G and C.238C > T sites of ATP8B1 gene | |
| CN108504660A (en) | ADCY10 gene mutation bodies and its application | |
| CN113201588B (en) | SNP (single nucleotide polymorphism) locus for detecting congenital irideless glaucoma disease, application and product | |
| CN115216477A (en) | Pathogenic gene mutant, protein, primer pair, reagent, kit and application of familial hypercholesterolemia | |
| CN114032303A (en) | Oligonucleotide and method for detecting new mutation of gene ABCB11 | |
| CN108866067B (en) | Pathogenic mutation of Leber congenital amaurosis and detection reagent thereof | |
| CN116024333A (en) | Retinal pigment degeneration screening kit | |
| CN110904216A (en) | Primers and method for detecting mutation of c.1670-98 and c.2375+49 sites of CHD7 gene | |
| CN110408690A (en) | Distichia kit for screening | |
| CN106498051B (en) | Application of the ZNF800 gene in preparation osteoporosis early screening product | |
| CN115141884B (en) | Novel ATP7B mutant gene and diagnostic reagent thereof | |
| CN110484623A (en) | A kind of RB1 mutated gene, primer, detection method, kit and application | |
| CN112626204B (en) | Primers and method for detecting HLA-B1502 typing useful for guiding administration of carbamazepine | |
| CN115927354B (en) | SH3TC2 gene pathogenic mutant and application thereof in preparation of fibula muscular atrophy 4C type diagnostic kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Jiang Lingxi Inventor after: Shi Yi Inventor after: Zhang Jianbo Inventor after: Gong Bo Inventor after: Luo Dongyan Inventor after: Wang Tingting Inventor after: Zheng Rui Inventor before: Shi Yi Inventor before: Zhang Jianbo Inventor before: Jiang Lingxi Inventor before: Gong Bo Inventor before: Luo Dongyan Inventor before: Wang Tingting Inventor before: Zheng Rui |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |