CN110791489B - Efficient and stable alpha-galactosidase and coding gene and application thereof - Google Patents

Abstract

The invention discloses efficient and stable alpha-galactosidase, and a coding gene and application thereof. The protein provided by the invention is as follows: a protein consisting of amino acid residues 20 to 437 from the N-terminus of the sequence 1; a protein consisting of an amino acid sequence shown in sequence 1; protein consisting of 90 th to 513 th amino acid residues in a sequence 3 of a sequence table; a protein consisting of the amino acid sequence shown in the sequence 3. The invention also protects the application of the protein, which comprises the following steps: as an alpha-galactosidase; degrading the alpha-galactose glycosidic bond-containing material. The protein provided by the invention can meet the requirements on thermal stability, pH stability and protease resistance of alpha-galactosidase in industries such as feed, food and the like, has wider industrial application, and provides a material for further construction of industrial high-yield engineering strains. The invention has very good research prospect and commercial application value.

Description

Efficient and stable alpha-galactosidase and coding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and relates to efficient and stable alpha-galactosidase, and a coding gene and application thereof.

Background

Alpha-galactosidase (EC 3.2.1.22), also known as melibiase, is capable of specifically hydrolyzing alpha-galactoside linkages at the non-reducing end of oligosaccharides or polysaccharides and is therefore used in a large number of applications in the food, sugar, paper, feed and medical fields.

In the field of food and feed processing, alpha-galactosidase can be used as a food and feed additive to hydrolyze alpha-galactooligosaccharides such as raffinose, stachyose, melibiose and the like in bean products and bean pulp, so that the phenomena of diarrhea, abdominal distension, stomachache and the like caused by the anti-nutritional factors are relieved, the bean products are promoted to be better absorbed and utilized by human bodies, the food intake of monogastric animals is improved, and the production performance of the animals is improved. In addition, alpha-galactosidase also has a better therapeutic effect on the abdominal distension phenomenon caused by some oligosaccharides in other high-fiber foods.

In the sugar industry, the alpha-galactosidase can hydrolyze raffinose in molasses, reduce the viscosity of molasses, promote the precipitation of sucrose crystals, and improve the utilization rate of raw materials and the quality of sucrose. The reduction of the viscosity can also reduce the cost caused by reheating in the sugar making process, save energy and greatly improve the processing capacity and turnover rate of equipment.

In the paper industry, the use of alpha-galactosidase allows the hydrolysis of galactomannan from pulp, removing the alpha-galactose from its backbone. Thus, the bleaching of softwood pulp can be enhanced by the combined treatment of the pulp with enzyme preparations such as alpha-galactosidase, mannanase and xylanase.

In the medical field, alpha-galactosidase enzymes are used for the treatment of Fabry disease (Fabry disease) and blood group switch. The loss of lysosomal α -galactosidase in the human body causes accumulation of glycophospholipid and ultimately affects pericardial, renal, and central nervous systems as well as gastrointestinal functions, whereas exogenous ingestion of α -galactosidase effectively removes the α -galactose residue at the end of glycophospholipid, thereby alleviating Fabry disease. The outermost end of the sugar chain on the surface of the B-type blood erythrocyte has one more galactose residue connected by alpha-1, 3 glycosidic bonds compared with the O-type blood, and the conversion between the B-type blood and the O-type blood can be realized by removing the alpha-galactose residue by alpha-galactosidase.

Alpha-galactosidase is widely present in animals, plants and microorganisms, especially in microorganisms with the highest yield. The plant-derived alpha-galactosidase has low yield and unstable enzyme activity, the animal-derived alpha-galactosidase is mostly derived from pancreas, the yield is limited by the source of the animal-derived alpha-galactosidase, and the microorganism used as a carrier for producing the alpha-galactosidase has the advantages of high yield, stable quality, strong production controllability, suitability for industrialization and the like, and is considered as a main way for modern development of alpha-galactosidase preparations. There are many microorganisms that have been reported to produce alpha-galactosidase, including bacteria (Bacillus stearothermophilus, Escherichia coli, thermophilic bacteria, Lactobacillus fermentum, Bifidobacterium, Streptomyces) and fungi (Aspergillus oryzae, Rhizopus, Trichoderma, Phanerochaete chrysosporium, Ganoderma lucidum, Coriolus versicolor, Pleurotus ostreatus), as well as some archaea. However, among some commonly used food-grade safe strains, there are very few strains that secrete α -galactosidase, and the activity is low. Therefore, cloning of the alpha-galactosidase gene of other microorganisms and heterologous expression in yeast and other food-safe strains using molecular biology techniques are the main means for producing alpha-galactosidase preparations.

The optimum action conditions and pH and temperature stability of alpha-galactosidase determine the range of application of the enzyme in practical production and its commercial value. The poor thermal stability and pH stability of common alpha-galactosidase limits the application of the common alpha-galactosidase in food and feed processing, and the research on the alpha-galactosidase with thermal stability and pH stability is not much. The currently reported alpha-galactosidase can show higher activity on a model substrate p-nitrophenyl-alpha-D-galactopyranoside (pNPG), but has not high hydrolysis activity on natural substrates such as stachyose, raffinose and melibiose. In addition, glycoside hydrolases are often combined with the addition of proteases in food and feed additives, improving both the digestibility and the nutritional value of food, and thus the protease resistance of α -galactosidase is also an important parameter for assessing its stability.

Disclosure of Invention

The invention aims to provide efficient and stable alpha-galactosidase, and a coding gene and application thereof.

The protein provided by the invention is obtained from Rapexlateus leucadendrus (Irpexlateus) and is named as ILgalA protein, and is (a), (b), (c), (d), (e) or (f) as follows:

(a) protein consisting of 20 th to 437 th amino acid residues from the N terminal of a sequence 1 in a sequence table;

(b) a protein consisting of an amino acid sequence shown in a sequence 1 in a sequence table;

(c) protein consisting of 90 th-513 th amino acid residues in a sequence 3 in a sequence table;

(d) a protein consisting of an amino acid sequence shown in a sequence 3 in a sequence table;

(e) the amino acid sequence of (a) or (b) or (c) or (d) is substituted and/or deleted by one or more amino acid residues and/or added with protein which has alpha-galactosidase activity and is derived from the amino acid sequence;

(f) and (C) a fusion protein obtained by connecting a tag to the N-terminus or/and the C-terminus of (a), (b), (C), (d) or (e).

The labels may be as shown in table 1.

TABLE 1

Label (R)	Residue of	Sequence of
			Poly-Arg	5-6 (usually 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG
	8	DYKDDDDK
			Strep-tagⅡ	8	WSHPQFEK
c-myc	10	EQKLISEEDL

The protein can be artificially synthesized, or can be obtained by synthesizing the coding gene and performing biological expression. The coding gene of the protein can be obtained by deleting one or more codons of amino acid residues in a DNA sequence shown in a sequence 2 or a sequence 4 in a sequence table, and/or carrying out missense mutation of one or more base pairs, and/or connecting a coding sequence of a label shown in the table 1 at the 5 'end and/or the 3' end.

Nucleic acid molecules encoding such proteins are also within the scope of the invention.

The nucleic acid molecule is a DNA molecule as described in any one of (1) to (6) below:

(1) the coding region is shown as the DNA molecule from the 58 th to 1311 st nucleotides at the 5' end of the sequence 2 in the sequence table;

(2) the coding region is a DNA molecule shown as a sequence 2 in a sequence table;

(3) the coding region is DNA molecule shown as 268 th to 1539 th nucleotides from 5' end of sequence 4 in the sequence table;

(4) the coding region is a DNA molecule shown as a sequence 4 in the sequence table;

(5) a DNA molecule which hybridizes with the DNA sequence defined in (1) or (2) or (3) or (4) under stringent conditions and encodes the protein;

(6) a DNA molecule which is derived from the rakanka albicans, has more than 90% homology with the DNA sequence defined in (1) or 2) and encodes the protein.

The stringent conditions can be hybridization and washing with 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS solution at 65 ℃ in DNA or RNA hybridization experiments.

The DNA molecule may be produced by natural variation or artificial mutation.

The expression cassette, the recombinant expression vector or the recombinant bacterium containing the nucleic acid molecule all belong to the protection scope of the invention.

The recombinant expression vector may be a plasmid, cosmid, phage, or viral vector.

The recombinant expression vector can be specifically a recombinant plasmid pPICZ alpha A-ILgalA, namely a recombinant plasmid obtained by inserting a DNA molecule shown by nucleotides 250 to 1542 from the 5' end of the sequence 4 in the sequence table between XhoI and NotI enzyme cutting sites of the pPICZ alpha A vector.

The recombinant strain can be specifically a recombinant yeast x-33-pPICZ alpha A-ILgalA obtained by introducing a linearized recombinant plasmid pPICZ alpha A-ILgalA into Pichia pastoris x-33. The linearized recombinant plasmid pPICZ alpha A-ILgalA can be specifically a linearized plasmid obtained by digesting the recombinant plasmid pPICZ alpha A-ILgalA with restriction enzyme SacI.

Primer pairs for amplifying the full length or any fragment of the nucleic acid molecule are within the scope of the invention.

The invention also provides a method for preparing the protein, which comprises the following steps: and fermenting the recombinant bacteria to express the nucleic acid molecule for encoding the protein to obtain the protein.

The method specifically comprises the following steps: culturing the recombinant bacteria, performing methanol induction in the culture process, and then centrifuging to collect supernatant.

The method specifically comprises the following steps: culturing the recombinant bacteria to OD by adopting BMMY culture medium_600nmAfter that, the mixture was cultured at 30 ℃ with shaking at 250rpm (methanol was added to the system every 24 hours so that the concentration in the system was 1%), and then centrifuged for 10min to collect the supernatant.

The method specifically comprises the following steps: culturing the recombinant bacteria to OD by adopting BMMY culture medium_600nmAfter that, the mixture was cultured at 30 ℃ for 144 hours with shaking at 250rpm (methanol was added to the system every 24 hours so that the concentration in the system was 1%), and then centrifuged at 12000rpm for 10 minutes, and the supernatant was collected.

The method further comprises the steps of: and (4) dialyzing the supernatant to remove salt, and then performing Ni column affinity chromatography purification.

The invention also protects the application of the protein, which is (I), (II), (III) or (IV) as follows:

as alpha-galactosidase;

(II) preparing a product with alpha-galactosidase function;

(III) degrading substances containing alpha-galactoside bonds;

(IV) preparing a product with the function of degrading substances containing alpha-galactoside bonds.

The invention also protects the application of the gene, the expression cassette, the recombinant expression vector or the recombinant bacterium, which is (i), (ii) or (iii) as follows:

preparing said protein;

(ii) preparing a product having alpha-galactosidase function;

(iii) preparing a product having a function of degrading the alpha-galactoside bond-containing substance.

The alpha-galactose glycosidic bond-containing substance is oligosaccharide containing alpha-galactose glycosidic bond.

The oligosaccharide is melibiose, raffinose or stachyose.

The specific activity of the protein provided by the invention as alpha-galactosidase is 1012U/mg. The reaction temperature may be 22 to 90 deg.C, preferably 60 to 70 deg.C, and most preferably 70 deg.C. Has excellent temperature stability, and the enzyme activity can still be kept above 90 percent when the temperature is kept at 50 ℃ or 60 ℃ for 10 hours. The reaction pH may be 3.2 to 7.5, preferably 4.0 to 5.5, most preferably 4.8. Has excellent pH stability, the enzyme activity can be kept above 60% when the temperature is kept for 2h under the condition of pH 3-11, and the enzyme activity can be kept above 80% when the temperature is kept for 2h under the condition of pH 7-11. The activities of melibiose, raffinose and stachyose for three natural substrates can reach 644, 755 and 833U/mg respectively, wherein the activity on the stachyose is the highest among the currently reported alpha-galactosidase. The protease can keep more than 90% of activity after being respectively incubated with 1.0mg/mL pepsin, trypsin and chymotrypsin for 1h at 37 ℃, and can also keep more than 60% of activity after being incubated with proteinase K for 1 h. Under the condition that the dosage of the enzyme is 2.7U/mL, the alpha-galactosidase can completely hydrolyze raffinose and stachyose in the soybean milk into sucrose and alpha-galactose within 30 min.

The alpha-galactosidase prepared by the invention has better pH stability, thermal stability and protease resistance. The protein provided by the invention can meet the requirements on thermal stability, pH stability and protease resistance of alpha-galactosidase in industries such as feed, food and the like, has wider industrial application, and provides a material for further construction of industrial high-yield engineering strains. The invention has very good research prospect and commercial application value.

Drawings

FIG. 1 is an electrophoretogram in example 2.

FIG. 2 shows the results of the optimum pH measurement in example 4.

FIG. 3 shows the results of pH stability measurement in example 4.

FIG. 4 shows the results of the optimum reaction temperature in example 4.

FIG. 5 shows the results of temperature stability in example 4.

FIG. 6 shows the results of protease resistance in example 4.

FIG. 7 shows the results of example 5.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Ralstonia bainieri (Irpexliteus): CGMCC No. 5.809. pPICZ α A vector: invitrogen corporation, product number 69909. Pichia pastoris (Pichia pastoris) X-33, Pichia pastoris X-33 for short: invitrogen corporation, product number C18000.

Melibiose: SIGMA company, product code: 63630. raffinose: SIGMA, product coding: r0250. stachyose: TCI company, product code: s0397.

BMGY medium: peptone 2g/100ml, yeast extract1g/100ml YNB, 1.34g/100ml glycerol, 4X 10^-5g/100ml Biotin, the balance being phosphate buffer (pH6.0, 0.1 mol/L); sterilizing at 121 deg.C for 20 min.

BMMY medium: peptone 2g/100ml, yeast extract 1g/100ml, 1.34g/100ml YNB, 1% (volume ratio) methanol, 4X 10^-5g/100ml Biotin, the balance being phosphate buffer (pH6.0, 0.1 mol/L); sterilizing at 121 deg.C for 20 min.

pNPG, all known as 4-nitrophenyl-alpha-D-galactopyranoside.

Example 1 discovery of ILgalA protein and Gene encoding the same

Inoculating the raking tooth fungus hypha into 50mL liquid culture medium (corn starch 20g/L, soybean meal 7g/L, yeast extract 5g/L, K)₂HPO₄·3H₂O 1g/L,MgSO₄·7H₂O5 g/L), culturing for 7 days, collecting mycelium, grinding with liquid nitrogen, and respectively using

Total DNA and RNA were extracted by the genomic DNA extraction kit (Promega) and Trizol (GenStar, China) methods. The culture supernatant was separated by 12.5% SDS-PAGE, and the protein with a band size of 60kD was excised and identified by liquid chromatography-tandem mass spectrometry (LC-MS/MS). The resulting MS data were aligned using a mascot2.5.1 search for peptide fragments that could be aligned with existing α -galactosidase enzymes.

3 degenerate primers DPF1, DPR1, and DPR2 were designed based on conserved amino acid residues of α -galactosidase, respectively. Genome DNA is used as a template, DPF1 and DPR1 are respectively used as forward and reverse primers, the 5 'end of the alpha-galactosidase gene is amplified by touchdown-PCR, PCR products are recovered and purified by cutting glue, and are connected with pGEM-T vectors for sequencing and identification, and the DNA sequence of the 5' end part is determined by the result.

Genome DNA is used as a template, SPF1 and DPR2 are respectively used as forward and reverse primers, the 3 'end of the alpha-galactosidase gene is amplified by touchdown-PCR, PCR products are recovered and purified by cutting gel, and are connected with pGEM-T vectors and then are sequenced and identified, and the result determines the DNA sequence of the 3' end part.

The 5 ' end and the 3 ' end obtained by two rounds of touchdown-PCR are not complete, and the 5 ' end flanking sequence of the alpha-galactosidase gene is continuously identified by thermal asymmetric alternating-PCR (TAIL-PCR), wherein the specific method comprises the following steps: first round of PCR amplification was performed using genomic DNA as template, ADPF as upstream primer, and SPR1 as downstream primer. Second round of PCR amplification was performed using the first round of PCR products as template, ADPF as upstream primer, and SPR2 as downstream primer. And performing third round PCR amplification by using the second round PCR product as a template, ADPF as an upstream primer and SPR3 as a downstream primer. And judging a target sequence according to the difference of the sizes of the bands among the PCR products of each round, carrying out sequencing identification on the target band after gel cutting, recycling and purifying, and obtaining a 5' end flanking DNA sequence.

The flanking sequence of the 3 'end is identified by a 3' RACE reaction, and the specific method comprises the following steps: PCR was performed using cDNA as template and SPF2 and UPM (supplied by the company) as upstream and downstream primers, respectively. The obtained PCR product was used as a template for the second round of PCR amplification, and the second round of PCR amplification was performed using SPF3 and NUP (supplied by the company) as upstream and downstream primers, respectively, to obtain flanking DNA sequences at the 3' end.

Based on the sequencing and splicing results, forward and reverse primers GalF1 and GalR1 are designed, and cDNA is used as a template to amplify the full-length cDNA sequence.

The ILgalA protein is shown as a sequence 1 in a sequence table. In the sequence 1 of the sequence table, the 1 st-19 th amino acid residues form a signal peptide. The ILgalA gene is shown as a sequence 2 in a sequence table.

The primer sequences involved in this step are shown in Table 2.

TABLE 2

Primer and method for producing the same	5’→3’	Length (bp)
			DPF1	ACICCNCAKATGGGITGGAA		20
DPR1	AAICCNGGIAGYTTRCARTC						20
			SPF1	CGCTGCCCATGTACCTCTGTGATC	24
DPR2	GGNACNGCYTTCCAIACYTTIGT	23
			ADPF	CATCGNCNGANACGAA	16
SPR1	CGAAGTTCCACGGGCCGTCCTCACCCCAG	29
			SPR2	GGGGTTCCAGCACGGCCTTCGTTGTTG	27
SPR3	GTAGGGTCTGCAACTGGCGCCCCAG	25
			SPF2	TCGCCGCACCCGTTGGTCAGAAAGC	25
SPF3	CCAAGCGATCATCGACGTCAATCAG	25
			GalF1	TCGAAGATACCTGTACCAACCTATTC	26
GalR1	GATATATTGAACATATATTCATCGTGG	27
			GalF2	CCGCTCGAGAAAAGAGAGGCTGAAGCTGCGGATAATGGCCTTGCGATCACACC	53
GalR2	ATTTGCGGCCGCCTAGTGGTGGTGGTGGTGGTGCAATTCATGTGCTATATGCCTCTTAC	59

Note: n ═ a/G/C/T, K ═ G/T, Y ═ C/T, R ═ a/G, I ═ deoxyhypoxanthine

Example 2 preparation of ILgalA protein

Construction of recombinant plasmid

1. The total RNA of the raking tooth fungus of the white capsule is extracted and is reversely transcribed into cDNA.

2. And (3) taking the cDNA obtained in the step (1) as a template, carrying out PCR amplification by adopting a primer pair consisting of GalF2 and GalR2, and recovering a PCR amplification product.

GalF2：

GalR2：5’-ATTTGCGGCCGCCTAGTGGTGGTGGTGGTGGTGCAATTCATGTGCTATATGCCTCTTAC-3’。

3. And (3) taking the PCR amplification product obtained in the step (2), carrying out double enzyme digestion by using restriction enzymes XhoI and NotI, and recovering the enzyme digestion product.

4. Taking a pPICZ alpha A vector, carrying out double enzyme digestion by using restriction enzymes XhoI and NotI, and recovering a vector skeleton.

5. And (4) connecting the enzyme digestion product in the step (3) with the vector skeleton in the step (4) to obtain the recombinant plasmid pPICZ alpha A-ILgalA.

According to the sequencing results, the structure of the recombinant plasmid pPICZ alpha A-ILgalA is described as follows: has an open reading frame shown in a sequence 4 of a sequence table. The DNA molecule shown in the sequence 4 of the sequence table codes the protein shown in the sequence 3 of the sequence table. The protein shown in the sequence 3 of the sequence table is a precursor protein, and the precursor protein is broken between the 89 th amino acid residue and the 90 th amino acid residue to form a mature protein consisting of the 90 th-513 th amino acid residues of the sequence 3 of the sequence table.

Second, construction of recombinant bacteria

The recombinant plasmid pPICZ alpha A-ILgalA is digested by restriction enzyme SacI to obtain a linearized plasmid, and the linearized plasmid is introduced into pichia pastoris x-33 to obtain recombinant yeast which is named as x-33-pPICZ alpha A-ILgalA.

The vector pPICZ alpha A is digested by restriction enzyme SacI to obtain a linearized plasmid, and the linearized plasmid is introduced into pichia pastoris x-33 to obtain recombinant yeast, namely x-33-pPICZ alpha A.

Expression and purification of ILgalA protein

1. Inoculating x-33-pPICZ alpha A-ILgalA into 20mL BMGY medium, shaking culturing at 30 deg.C and 250rpm to OD_600nmCentrifuging at 5000rpm for 5min to 4.0-6.0, and collecting thallus; the cells were resuspended in 100mL fresh BMMY medium and OD was adjusted_600nmAfter that, the mixture was cultured at 30 ℃ for 144 hours with shaking at 250rpm (methanol was added to the system every 24 hours so that the volume percentage of the mixture in the system was 1%), and then centrifuged at 12000rpm for 10 minutes, and the supernatant was collected.

2. The procedure is as described in step 1, except that x-33-pPICZ α A-ILgalA is replaced by x-33-pPICZ α A.

3. Obtained in the step 1The supernatant was filled into a dialysis bag, dialysis was performed in PBS buffer to remove salts, and then the liquid phase in the dialysis bag was collected. PBS buffer: NaHPO at pH7.5, 20mmol/L₄-NaH₂PO₄And (4) a buffer solution.

4. And (4) taking the liquid phase obtained in the step (3) and carrying out Ni column affinity chromatography purification.

A purification step: and (3) loading 10mL of liquid phase, washing with 10mL of washing solution to remove impure protein, eluting with 7mL of eluent to collect target protein, and collecting the solution after passing through the column when eluting with the eluent, namely the solution containing the target protein, which is named as ILgalA solution.

Washing liquid: PBS buffer containing 500mmol/L NaCl and 20mmol/L imidazole.

Eluent: PBS buffer containing 500mmol/L NaCl and 120mmol/L imidazole.

5. The supernatant obtained in step 1, the supernatant obtained in step 2 and the ILgalA solution obtained in step 4 were subjected to 12.5% SDS-PAGE. The supernatant obtained in step 1 had the desired molecular weight of the target protein (64kDa), and the supernatant obtained in step 2 did not have the target protein. The ILgalA solution showed a single band and was the protein of interest. The electrophoretogram is shown in FIG. 1. Recovering the target band of ILgalA solution electrophoresis, and sequencing 15 amino acid residues at the N end, wherein the amino acid residues are shown as 90 th-104 th amino acid residues in a sequence 3 of a sequence table.

Example 3 enzymatic Activity of ILgalA protein as alpha-galactosidase

This example demonstrates the enzymatic activity of the ILgalA protein as an alpha-galactosidase using the model substrate pNPG.

The buffers used in this example were all 100mM sodium acetate buffer, pH 4.8.

The test solution was the ILgalA solution prepared in example 2.

1. The pNPG is dissolved in the buffer solution to make the concentration of the pNPG 8mM, namely the pNPG solution.

2. And (3) taking the solution to be detected, and diluting the solution with a buffer solution to obtain a protein diluent.

3. Mixing 100 μ L protein diluent with 100 μ L pNPG solution, shaking, incubating at 60 deg.C for 10min, and adding 800 μ L500mMNa₂CO₃The reaction was terminated with an aqueous solution, and OD was measured_405nmThe absorbance value of (c). An equal volume of buffer was used as a negative control instead of protein diluent.

4. Preparing p-nitrophenol standard solutions with different concentrations by using buffer solution as a solvent, and detecting the OD of the standard solution_405nmThe absorbance of the complex (OD) is measured in terms of the concentration of p-nitrophenol (pNP) as the abscissa_405nmA standard curve was made for the ordinate.

5. The protein concentration in the protein dilution was measured.

6. And (4) comparing the result of the step (3) with the standard curve obtained in the step (4), and calculating to obtain an enzyme activity result by combining the protein concentration obtained in the step (5).

The amount of enzyme required to release 1. mu. mol pNP per minute was defined as 1 unit of enzyme activity.

The enzyme activity of the protein in the ILgalA solution was 1012U/mg.

The enzyme activity of the supernatant prepared in step three, step 2, of example 2 as α -galactosidase was measured to be 0 according to the above procedure.

EXAMPLE 4 Properties of alpha-galactosidase ILgalA

First, optimum pH measurement

The test solution was the ILgalA solution prepared in example 2.

The buffer solutions were: 50mM sodium acetate buffer solution with pH of 3.2-6.0, 50mM NaHPO with pH of 5.8-8.0₄-NaH₂PO₄And (4) a buffer solution.

The rest is the same as example 3.

The highest enzyme activity is achieved by adopting a sodium acetate buffer solution with the pH value of 4.8. The highest enzyme activity was taken as 100%, and the relative enzyme activities at other pHs were calculated, and the results are shown in FIG. 2. In FIG. 2, ABS represents sodium acetate buffer, PBS represents NaHPO₄-NaH₂PO₄And (4) a buffer solution.

II, measuring pH stability

The ILgalA solution prepared in example 2 was pretreated as follows to obtain a solution to be tested: dilutions were made with different pretreatment buffers to a protein concentration of 50. mu.g/mL, followed by incubation at room temperature for 2 hours. The pretreatment buffers were: p is a radical ofH2.2-3.0 glycine-hydrochloric acid buffer 100mM, pH4.0-5.0 sodium acetate buffer 100mM, pH6.0-8.0 100mM NaHPO₄-NaH₂PO₄Buffer, 100mM glycine-sodium hydroxide buffer solution with pH of 9.0-10.0, 100mM NaH with pH of 11.0-12.0₂PO₄-NaOH buffer.

The enzyme activity of the solution to be tested was determined in the same manner as in example 3.

The ILgalA protein is stable over a wide pH range (3.0-11.0). The enzyme activity results of the proteins of the ILgalA solution without pretreatment were taken as 100%, and the relative enzyme activity of the proteins of each solution to be tested was calculated, and the results are shown in FIG. 3.

Third, optimum reaction temperature

The test solution was the ILgalA solution prepared in example 2.

The method for detecting the enzyme activity of the solution to be detected is basically the same as the example 3. The only difference from example 3 is that the following temperatures were used in step 3: 22 deg.C, 30 deg.C, 40 deg.C, 50 deg.C, 60 deg.C, 65 deg.C, 70 deg.C, 75 deg.C, 80 deg.C and 90 deg.C.

The enzyme activity is highest at 70 ℃. The highest enzyme activity was taken as 100%, and the relative enzyme activities at other temperatures were calculated, and the results are shown in FIG. 4.

Fourthly, measuring the temperature stability

The ILgalA solution prepared in example 2 was pretreated as follows to obtain a solution to be tested: incubate at different temperatures (50 ℃, 60 ℃ or 70 ℃) for 1, 2, 4, 6 or 10 hours.

The enzyme activity of the solution to be tested was determined in the same manner as in example 3.

The enzyme activity of ILgalA protein is almost unchanged after incubation for 10h at 50 ℃ and 60 ℃, and the ILgalA protein shows excellent temperature stability. The enzyme activity results of the proteins of the ILgalA solution without pretreatment were taken as 100%, and the relative enzyme activity of the proteins of each solution to be tested was calculated, and the results are shown in FIG. 5.

Fifthly, the hydrolytic capability of natural galacto-oligosaccharide

The amount of enzyme required to release 1. mu. mol of alpha-galactose per minute was defined as 1 unit of enzyme activity.

The buffers adopted in the step are all sodium acetate buffers with pH4.8 and 100 mM.

1. Detection of hydrolysis Capacity for raffinose or stachyose (DNS method)

(1) Dissolving raffinose or stachyose in buffer solution to make its concentration be 80mM, so that it is oligosaccharide solution.

(2) The ILgalA solution prepared in example 2 was diluted with a buffer as appropriate to obtain a protein dilution.

(3) Mixing 50 μ L protein diluent and 50 μ L oligosaccharide solution, shaking, incubating at 60 deg.C for 10min, adding 300 μ L DNS solution, reacting in boiling water bath for 5min, rapidly cooling in ice bath, and adding 900 μ L H₂O, then detecting the OD_540nmThe absorbance value of (c).

(4) Dissolving alpha-galactose in a buffer solution to prepare alpha-galactose solutions with different concentrations; mixing 100 μ L alpha-galactose solution with 300 μ L DNS solution, shaking, reacting in boiling water bath for 5min, rapidly cooling in ice bath, and adding 900 μ L H₂O, then detecting the OD_540nmThe absorbance value of (d); the concentration of alpha-galactose was plotted as the abscissa, OD_540nmA standard curve was made for the ordinate.

(5) And (3) calculating the hydrolysis capacity of the ILgalA to the raffinose or the stachyose according to the absorbance value obtained in the step (3), the dilution times in the step (2) and the standard curve in the step (4).

The protein of the ILgalA solution had a hydrolysis power to raffinose of 755U/mg.

The hydrolysis capacity of the ILgalA solution protein for stachyose was 833U/mg.

2. Detection of hydrolysis Capacity to melibiose

(1) And dissolving the melibiose in the buffer solution to ensure that the concentration of the melibiose is 80mM, thus obtaining the melibiose solution.

(2) The ILgalA solution prepared in example 2 was diluted with a buffer as appropriate to obtain a protein dilution.

(3) Mixing 50 μ L of the protein diluent with 50 μ L of the melibiose solution, shaking, incubating at 60 ℃ for 10min, boiling, and detecting the peak area of alpha-galactose by HPLC.

High performance liquid chromatography: SHIMADZU LC-15C;

and (3) analyzing the column: MARS MOA (300 mm. times.7.58 mm); protection of the column: MARS MOA (50 mm. times.7.58 mm);

mobile phase: 2.5mM sulfuric acid;

flow rate: 0.6 mL/min;

a detector: SHNIMADZU RID-10A;

column temperature: at 60 ℃.

(4) Dissolving alpha-galactose in a buffer solution to prepare alpha-galactose solutions with different concentrations; detecting peak areas corresponding to the alpha-galactose with different concentrations by using HPLC, wherein the parameters are the same as in the step (3); and (3) taking the concentration of the alpha-galactose as an abscissa and the corresponding peak area as an ordinate to prepare a standard curve.

(5) And (4) calculating the hydrolysis capacity of the ILgalA to the melibiose according to the peak area obtained in the step (3), the dilution factor in the step (2) and the standard curve in the step (4).

The hydrolysis capacity of the protein of the ILgalA solution for melibiose was 644U/mg.

Sixthly, protease resistance

The ILgalA solution prepared in example 2 was pretreated as follows to obtain solutions to be tested: incubating at 37 ℃ for 1 hour in 1.0mg/mL pepsin solution (glycine-hydrochloric acid buffer solution, pH3.0); ② incubating for 1 hour at 37 ℃ in 10.0mg/mL pepsin solution (the system is glycine-hydrochloric acid buffer solution, pH3.0); ③ 1.0mg/mL of trypsin solution (the system is NaHPO)₄-NaH₂PO₄Buffer, pH8.0) at 37 ℃ for 1 hour; fourthly, in 10.0mg/mL trypsin solution (the system is NaHPO)₄-NaH₂PO₄Buffer, pH8.0) at 37 ℃ for 1 hour; fifthly, the solution is 1.0mg/mL chymotrypsin solution (the system is NaHPO)₄-NaH₂PO₄Buffer, pH8.0) at 37 ℃ for 1 hour; sixthly, under the condition of 10.0mg/mL chymotrypsin solution (the system is NaHPO)₄-NaH₂PO₄Buffer, pH8.0) at 37 ℃ for 1 hour; seventhly, in 1.0mg/mL proteinase K solution (system is NaHPO)₄-NaH₂PO₄Buffer, pH7.5) at 37 ℃ for 1 hour; is in 10.0mg/mL proteinase K solution (the system is NaHPO)₄-NaH₂PO₄Buffer, pH7.5) at 37 ℃ for 1 hour; the ILgalA concentration was 50. mu.g/mL.

The enzyme activity of the solution to be tested was determined in the same manner as in example 3.

The enzyme activity results of the proteins of the ILgalA solution without pretreatment were taken as 100%, and the relative enzyme activity of the proteins of each solution to be tested was calculated, and the results are shown in FIG. 6. The activity of the recombinant protein ILgalA can be kept above 92% after being treated by 1.0mg/mL pepsin, trypsin and chymotrypsin, the activity can be kept above 85% after being treated by 10.0mg/mL pepsin, trypsin and chymotrypsin, and the enzyme activity can be kept above 44% after being treated by 10.0mg/mL proteinase K.

Example 5 degradation of oligosaccharides in Bean flour by alpha-galactosidase ILgalA

Preparation of bean powder solution

Defatted soy flour and sodium acetate buffer (ph4.8, 50mM) were mixed at a ratio of 1 g: mixing 10ml, boiling water bath for 30min, centrifuging at 10000rpm for 15min, and collecting supernatant.

Second, hydrolysis test

1. The supernatant obtained in step one was added to the ILgalA solution prepared in example 2 to a protein concentration of 2.7U/mL (the calculation of U is shown in example 3), incubated at 60 deg.C (10min, 20min, 30min, 60min or 90min), and then quenched in a boiling water bath for 5 min.

2. After completion of step 1, centrifugation was carried out at 12000rpm for 15min, and the supernatant was collected, filtered through a 0.45 μm filter membrane, and the filtrate was collected.

3. And (3) detecting the concentrations of raffinose, stachyose, sucrose and alpha-galactose in the filtrate by HPAEC.

HPAEC assay conditions were as follows:

ion chromatography: dionex ICS-3000;

and (3) analyzing the column: CarboPac PA10(250 mm. times.4 mm); protection of the column: CarboPac PA10(50 mm. times.4 mm);

mobile phase: a phase is 250mM of NaOH aqueous solution, and B phase is pure water;

flow rate: 1.0 mL/min;

sample introduction amount: 25 mu L of the solution; column temperature: 30 ℃;

a detector: ED 3000 pulse ampere detection, Au working electrode, Ag/AgCl reference working electrode mode, and four-potential waveform detection;

the gradient elution conditions are shown in Table 3.

TABLE 3

Time	Phase A (%)	Phase B (%)
			0-14min (including 14min)	7.5	92.5
14-22min (including 22min)	80	20
			22-30min	7.5	92.5

And judging the substances in the filtrate according to the peak positions of the standard substance, and calculating the substance content by using the standard curve of the standard substance.

The concentrations of raffinose, stachyose, sucrose and alpha-galactose in the filtrate are shown in FIG. 7. The protein of the ILgalA solution is effective to hydrolyze raffinose and stachyose in defatted soybean flour within 30min to produce sucrose and alpha-galactose.

SEQUENCE LISTING

<110> university of agriculture in China

<120> efficient and stable alpha-galactosidase, and coding gene and application thereof

<130> GNCYX181488

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 437

<212> PRT

<213> Rapex lacteus (Irpex lacteus)

<400> 1

Met Ala Ala Leu Arg Tyr Leu Leu Thr Ile Thr Val Ser Ala Trp Tyr

1 5 10 15

Ala His Ala Ala Asp Asn Gly Leu Ala Ile Thr Pro Gln Met Gly Trp

20 25 30

Asn Thr Trp Asn His Phe Gly Cys Asp Ile Ser Glu Asp Thr Ile Met

35 40 45

Ser Ala Ala Gln Ala Ile Val Asn Tyr Asn Leu Thr Gln Phe Gly Tyr

50 55 60

Glu Tyr Val Ile Met Asp Asp Cys Trp His Ala Ala Ser Arg Asp Asn

65 70 75 80

Ala Thr Gly Ala Pro Val Ala Asp Pro Thr Lys Phe Pro Asn Gly Ile

85 90 95

Lys Ala Leu Ser Asp Lys Val His Ala Leu Gly Leu Lys Phe Gly Ile

100 105 110

Tyr Ser Ser Ala Gly Thr Tyr Thr Cys Gly Gly Arg Phe Gly Ser Leu

115 120 125

Gly Tyr Glu Glu Ile Asp Ala Lys Thr Tyr Ala Asp Trp Gly Val Asp

130 135 140

Tyr Leu Lys Tyr Asp Asn Cys Asn Asn Glu Gly Arg Ala Gly Thr Pro

145 150 155 160

Leu Ile Ser Tyr Glu Arg Tyr Ala Asn Met Ser Arg Ala Leu Asn Ala

165 170 175

Thr Gly Arg Pro Ile Leu Tyr Ser Met Cys Asn Trp Gly Glu Asp Gly

180 185 190

Pro Trp Asn Phe Ala Pro Asn Ile Ala Asn Ser Trp Arg Ile Ser Gly

195 200 205

Asp Ile Met Asp Asn Phe Asp Arg Phe Asp Asp Arg Cys Pro Cys Thr

210 215 220

Ser Val Ile Asp Cys Lys Leu Pro Gly Tyr His Cys Ala Met Ala Arg

225 230 235 240

Ile Ile Asp Phe Ala Ala Pro Val Gly Gln Lys Ala Gly His Gly His

245 250 255

Trp Asn Asp Leu Asp Met Leu Glu Val Gly Asn Gly Gly Met Thr Phe

260 265 270

Asp Glu Tyr Val Thr His Phe Ser Met Trp Ser Ile Leu Lys Ser Pro

275 280 285

Leu Ile Leu Gly Asn Asp Val Thr Asn Met Thr Asn Glu Thr Leu Gly

290 295 300

Ile Ile Thr Asn Gln Ala Ile Ile Asp Val Asn Gln Asp Ala Asn Gly

305 310 315 320

Ser Pro Ala Asn Arg Leu Trp Lys His Ser Val Asp Gly Gly Asp Leu

325 330 335

Ser Leu Trp Ala Gly Gly Leu Val Asn Asn Ser Tyr Val Val Ala Leu

340 345 350

Leu Asn Thr Ser Pro Ser Asn Gln Thr Val Asp Val Glu Phe Ser Asp

355 360 365

Val Phe Phe Asp Gln Gly Lys Glu Ala Gln Thr Gln Ser Tyr Thr Ile

370 375 380

Tyr Asp Leu Trp Gln Lys Asp Asp Ser Gly Ser Trp Gly Lys Ser Leu

385 390 395 400

Gly Thr Val Gln Gly Ser Ile Gly Asn Val Ser Val Gly Ala His Gln

405 410 415

Thr Lys Val Trp Lys Leu Val Pro Val Ser Ser Ala Ser Lys Arg His

420 425 430

Ile Ala His Glu Leu

435

<210> 2

<211> 1314

<212> DNA

<213> Rapex lacteus (Irpex lacteus)

<400> 2

atggcggctc tgcgatatct gcttaccatc acggtgtccg cctggtatgc gcatgcggcg 60

gataatggcc ttgcgatcac accacagatg ggctggaata cctggaacca cttcggatgc 120

gatatcagtg aagacacgat tatgagtgct gctcaagcta tagtgaatta caacctaact 180

cagtttggtt acgagtatgt cataatggac gactgttggc atgctgcctc tcgcgataat 240

gcaactgggg cgccagttgc agaccctacc aagtttccaa acggcatcaa agctctctca 300

gacaaggtcc acgctttagg attgaagttt ggtatctaca gtagcgcagg gacatatacc 360

tgcggaggtc gctttggctc cctaggatac gaagaaattg atgcgaagac gtacgcagac 420

tggggcgttg actacttgaa atatgataat tgcaacaacg aaggccgtgc tggaacccca 480

cttatatcgt acgaaagata cgccaacatg tcgagagctt taaacgcaac cggacgaccg 540

attctgtatt cgatgtgcaa ctggggtgag gacggcccgt ggaacttcgc gccaaacatt 600

gcaaacagct ggcgtatatc cggagacatc atggataatt tcgatcgctt cgacgaccgc 660

tgcccatgta cctctgtgat cgactgtaaa ctccctggct accactgcgc tatggcacga 720

atcatcgact tcgccgcacc cgttggtcag aaagctggcc atggccattg gaacgatctc 780

gacatgctgg aagtcggaaa cggaggaatg acattcgatg aatatgtgac gcatttctcg 840

atgtggagta tccttaaaag ccctcttatt ctcggtaacg acgtgacgaa catgacgaac 900

gagacattgg gcattattac gaaccaagcg atcatcgacg tcaatcagga cgcaaacggc 960

tcgcccgcga atcgcttatg gaagcactcc gtcgacggag gggacctgtc gttgtgggcc 1020

ggcggcctcg tgaataactc ctacgtcgtt gcactattga acacctcacc atcaaaccaa 1080

accgtcgatg tcgagttcag tgatgttttc tttgaccagg ggaaggaagc acaaactcaa 1140

tcatacacta tctatgatct ctggcagaag gatgactcag ggagctgggg gaagagcttg 1200

gggactgtgc aggggtctat tggtaatgtt agtgtgggtg ctcatcagac aaaggtgtgg 1260

aagcttgtgc ctgtttcttc tgctagtaag aggcatatag cacatgaatt gtag 1314

<210> 3

<211> 513

<212> PRT

<213> Artificial sequence

<400> 3

Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala Ser Ser

1 5 10 15

Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln

20 25 30

Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe

35 40 45

Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu

50 55 60

Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val

65 70 75 80

Ser Leu Glu Lys Arg Glu Ala Glu Ala Ala Asp Asn Gly Leu Ala Ile

85 90 95

Thr Pro Gln Met Gly Trp Asn Thr Trp Asn His Phe Gly Cys Asp Ile

100 105 110

Ser Glu Asp Thr Ile Met Ser Ala Ala Gln Ala Ile Val Asn Tyr Asn

115 120 125

Leu Thr Gln Phe Gly Tyr Glu Tyr Val Ile Met Asp Asp Cys Trp His

130 135 140

Ala Ala Ser Arg Asp Asn Ala Thr Gly Ala Pro Val Ala Asp Pro Thr

145 150 155 160

Lys Phe Pro Asn Gly Ile Lys Ala Leu Ser Asp Lys Val His Ala Leu

165 170 175

Gly Leu Lys Phe Gly Ile Tyr Ser Ser Ala Gly Thr Tyr Thr Cys Gly

180 185 190

Gly Arg Phe Gly Ser Leu Gly Tyr Glu Glu Ile Asp Ala Lys Thr Tyr

195 200 205

Ala Asp Trp Gly Val Asp Tyr Leu Lys Tyr Asp Asn Cys Asn Asn Glu

210 215 220

Gly Arg Ala Gly Thr Pro Leu Ile Ser Tyr Glu Arg Tyr Ala Asn Met

225 230 235 240

Ser Arg Ala Leu Asn Ala Thr Gly Arg Pro Ile Leu Tyr Ser Met Cys

245 250 255

Asn Trp Gly Glu Asp Gly Pro Trp Asn Phe Ala Pro Asn Ile Ala Asn

260 265 270

Ser Trp Arg Ile Ser Gly Asp Ile Met Asp Asn Phe Asp Arg Phe Asp

275 280 285

Asp Arg Cys Pro Cys Thr Ser Val Ile Asp Cys Lys Leu Pro Gly Tyr

290 295 300

His Cys Ala Met Ala Arg Ile Ile Asp Phe Ala Ala Pro Val Gly Gln

305 310 315 320

Lys Ala Gly His Gly His Trp Asn Asp Leu Asp Met Leu Glu Val Gly

325 330 335

Asn Gly Gly Met Thr Phe Asp Glu Tyr Val Thr His Phe Ser Met Trp

340 345 350

Ser Ile Leu Lys Ser Pro Leu Ile Leu Gly Asn Asp Val Thr Asn Met

355 360 365

Thr Asn Glu Thr Leu Gly Ile Ile Thr Asn Gln Ala Ile Ile Asp Val

370 375 380

Asn Gln Asp Ala Asn Gly Ser Pro Ala Asn Arg Leu Trp Lys His Ser

385 390 395 400

Val Asp Gly Gly Asp Leu Ser Leu Trp Ala Gly Gly Leu Val Asn Asn

405 410 415

Ser Tyr Val Val Ala Leu Leu Asn Thr Ser Pro Ser Asn Gln Thr Val

420 425 430

Asp Val Glu Phe Ser Asp Val Phe Phe Asp Gln Gly Lys Glu Ala Gln

435 440 445

Thr Gln Ser Tyr Thr Ile Tyr Asp Leu Trp Gln Lys Asp Asp Ser Gly

450 455 460

Ser Trp Gly Lys Ser Leu Gly Thr Val Gln Gly Ser Ile Gly Asn Val

465 470 475 480

Ser Val Gly Ala His Gln Thr Lys Val Trp Lys Leu Val Pro Val Ser

485 490 495

Ser Ala Ser Lys Arg His Ile Ala His Glu Leu His His His His His

500 505 510

His

<210> 4

<211> 1542

<212> DNA

<213> Artificial sequence

<400> 4

atgagatttc cttcaatttt tactgctgtt ttattcgcag catcctccgc attagctgct 60

ccagtcaaca ctacaacaga agatgaaacg gcacaaattc cggctgaagc tgtcatcggt 120

tactcagatt tagaagggga tttcgatgtt gctgttttgc cattttccaa cagcacaaat 180

aacgggttat tgtttataaa tactactatt gccagcattg ctgctaaaga agaaggggta 240

tctctcgaga aaagagaggc tgaagctgcg gataatggcc ttgcgatcac accacagatg 300

ggctggaata cctggaacca cttcggatgc gatatcagtg aagacacgat tatgagtgct 360

gctcaagcta tagtgaatta caacctaact cagtttggtt acgagtatgt cataatggac 420

gactgttggc atgctgcctc tcgcgataat gcaactgggg cgccagttgc agaccctacc 480

aagtttccaa acggcatcaa agctctctca gacaaggtcc acgctttagg attgaagttt 540

ggtatctaca gtagcgcagg gacatatacc tgcggaggtc gctttggctc cctaggatac 600

gaagaaattg atgcgaagac gtacgcagac tggggcgttg actacttgaa atatgataat 660

tgcaacaacg aaggccgtgc tggaacccca cttatatcgt acgaaagata cgccaacatg 720

tcgagagctt taaacgcaac cggacgaccg attctgtatt cgatgtgcaa ctggggtgag 780

gacggcccgt ggaacttcgc gccaaacatt gcaaacagct ggcgtatatc cggagacatc 840

atggataatt tcgatcgctt cgacgaccgc tgcccatgta cctctgtgat cgactgtaaa 900

ctccctggct accactgcgc tatggcacga atcatcgact tcgccgcacc cgttggtcag 960

aaagctggcc atggccattg gaacgatctc gacatgctgg aagtcggaaa cggaggaatg 1020

acattcgatg aatatgtgac gcatttctcg atgtggagta tccttaaaag ccctcttatt 1080

ctcggtaacg acgtgacgaa catgacgaac gagacattgg gcattattac gaaccaagcg 1140

atcatcgacg tcaatcagga cgcaaacggc tcgcccgcga atcgcttatg gaagcactcc 1200

gtcgacggag gggacctgtc gttgtgggcc ggcggcctcg tgaataactc ctacgtcgtt 1260

gcactattga acacctcacc atcaaaccaa accgtcgatg tcgagttcag tgatgttttc 1320

tttgaccagg ggaaggaagc acaaactcaa tcatacacta tctatgatct ctggcagaag 1380

gatgactcag ggagctgggg gaagagcttg gggactgtgc aggggtctat tggtaatgtt 1440

agtgtgggtg ctcatcagac aaaggtgtgg aagcttgtgc ctgtttcttc tgctagtaag 1500

aggcatatag cacatgaatt gcaccaccac caccaccact ag 1542

Claims (11)

1. A protein which is (a) or (b) or (c) or (d) below:

(a) protein with an amino acid sequence shown as 20 th to 437 th positions in a sequence 1 in a sequence table;

(b) protein with an amino acid sequence shown as a sequence 1 in a sequence table;

(c) the amino acid sequence is as shown in the 90 th to 513 th sites in the sequence 3 in the sequence table;

(d) the protein with the amino acid sequence shown as the sequence 3 in the sequence table.

2. A nucleic acid molecule encoding the protein of claim 1.

3. The nucleic acid molecule of claim 2, wherein: the nucleic acid molecule is a DNA molecule as described in any one of (1) to (4) below:

(1) the coding region is shown as the DNA molecule from the 58 th to 1311 st nucleotides at the 5' end of the sequence 2 in the sequence table;

(2) the coding region is a DNA molecule shown as a sequence 2 in a sequence table;

(3) the coding region is DNA molecule shown as 268 th to 1539 th nucleotides from 5' end of sequence 4 in the sequence table;

(4) the coding region is shown as a DNA molecule in a sequence 4 in a sequence table.

4. An expression cassette, recombinant expression vector or recombinant bacterium comprising the nucleic acid molecule of claim 2 or 3.

5. A method of producing the protein of claim 1, comprising: fermenting the recombinant bacterium according to claim 4 to express a nucleic acid molecule encoding the protein according to claim 1, thereby obtaining the protein according to claim 1.

6. The use of the protein of claim 1 in the following (I), (II), (III) or (IV):

as alpha-galactosidase;

(II) preparing a product with alpha-galactosidase function;

(III) degrading substances containing alpha-galactoside bonds;

(IV) preparing a product with the function of degrading substances containing alpha-galactoside bonds;

the use is for non-disease diagnosis and treatment.

7. The use of claim 6, wherein: the alpha-galactose glycosidic bond-containing substance is oligosaccharide containing alpha-galactose glycosidic bond.

8. The use of claim 7, wherein: the oligosaccharide is melibiose, raffinose or stachyose.

9. Use of the nucleic acid molecule of claim 2 or 3, the expression cassette of claim 4, the recombinant expression vector or the recombinant bacterium as (i), (ii) or (iii) below:

preparing the protein of claim 1;

(ii) preparing a product having alpha-galactosidase function;

(iii) preparing a product having a function of degrading the alpha-galactoside bond-containing substance.

10. The use of claim 9, wherein: the alpha-galactose glycosidic bond-containing substance is oligosaccharide containing alpha-galactose glycosidic bond.

11. The use of claim 10, wherein: the oligosaccharide is melibiose, raffinose or stachyose.

Images