CN110790833A

CN110790833A - Tick autophagy-related protein molecule ATG5 and application thereof

Info

Publication number: CN110790833A
Application number: CN201810862304.7A
Authority: CN
Inventors: 周金林; 王亚楠; 龚海燕; 张厚双; 曹杰; 周勇志
Original assignee: Shanghai Veteromaru Research Institute Caas China Animal Health And Epidemiology Center Shanghan Branch Center
Current assignee: Shanghai Veteromaru Research Institute Caas China Animal Health And Epidemiology Center Shanghan Branch Center
Priority date: 2018-08-01
Filing date: 2018-08-01
Publication date: 2020-02-14
Anticipated expiration: 2038-08-01
Also published as: CN110790833B

Abstract

The invention discloses a tick autophagy-related protein molecule ATG5, which has an amino acid sequence shown in SEQ ID NO. 1. The invention also discloses a gene of the tick autophagy-related protein molecule ATG5, which comprises the following components: a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 1. The tick autophagy-related protein molecule ATG5 and the gene thereof can obviously influence the blood suction of ticks after gene silencing, are expected to become candidate molecules for tick-borne disease control, and have wide application prospects.

Description

Tick autophagy-related protein molecule ATG5 and application thereof

Technical Field

The invention relates to the technical field of bioengineering, in particular to a tick autophagy-related protein molecule ATG5 and application thereof.

Background

Ticks are obligate blood-sucking (blood-feeding) arthropods widely distributed around the world. Ticks can infect almost all terrestrial vertebrates, including mammals, birds, various reptiles and amphibians, and are also transmission vehicles for many diseases. All ticks had 4 stages: eggs and three active stages (young ticks, young ticks and adult ticks). Rhipicephalus luphaemaphysoides is one of the tick species widely distributed in south China, belongs to the hard tick family, and is a three-host tick, and the host needs to be replaced at each stage in the life history of the hard tick. The salivary gland of the tick plays an important role in the process of blood sucking of the tick, the salivary gland is a main medium organ for transmitting tick-borne pathogens, the tick usually needs 7-14 days from the upper part of the body to the full blood, male ticks can suck blood intermittently and repeatedly, and female ticks cannot suck blood intermittently.

The salivary glands of female ticks undergo rapid degeneration at the end of the tick's blood draw and after satiety. Research shows that the tissue of the salivary gland is damaged to a certain extent within a few days after the tick is full of blood, and the ultrastructural observation can find that a large number of autophagic vacuoles appear in the salivary gland after the tick is full of blood, but the autophagic vacuoles do not appear in the salivary gland of the tick which does not suck blood or is half full of blood. The research on the salivary gland degeneration mechanism of the tick has important significance for researching the reason that the female tick can not repeat the blood sucking of the upper body, the biological control of the tick and the transmission mechanism of tick-borne pathogens. Autophagy and apoptosis are thought to be two major causes of the induction of tick salivary gland degeneration, and the autophagy-related protein ATG5 has been shown to be a molecular switch in the conversion of autophagy to apoptosis in mammals and arthropods, but there is no report on this molecule in ticks.

Disclosure of Invention

The invention aims to solve the technical problem of providing a tick autophagy-related protein molecule ATG5 and a gene thereof, wherein the tick autophagy-related protein molecule ATG5 can be used as a candidate molecule for tick-borne disease control.

In order to solve the technical problems, the invention is realized by the following technical scheme:

in one aspect of the invention, a tick autophagy-related protein molecule ATG5 is provided having an amino acid sequence shown in SEQ ID No. 1.

In another aspect of the present invention, there is provided a gene of tick autophagy-related protein molecule ATG5, comprising: a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 1.

Preferably, the gene of the tick autophagy-related protein molecule ATG5 comprises a nucleotide sequence shown in SEQ ID NO. 2.

In another aspect of the present invention, there is also provided a recombinant vector comprising the nucleotide sequence of the ATG5 gene of the tick autophagy-related protein molecule described above.

The recombinant vector includes a recombinant cloning vector or a recombinant expression vector.

In another aspect of the present invention, there is also provided a host cell comprising the above recombinant vector.

In another aspect of the present invention, there is also provided a substance for inhibiting or increasing the activity of the above tick autophagy-related protein molecule ATG5, which includes various protein activity inhibitors, activators and the like.

In another aspect of the present invention, there is also provided a substance that inhibits or increases the expression of the above-mentioned tick autophagy-related protein molecule ATG5 gene. The substance inhibiting the expression of the ATG5 gene comprises: dsRNA for inhibiting the expression of the ATG5 gene of the tick autophagy-related protein molecule.

Preferably, the dsRNA is double-stranded RNA consisting of the nucleotide sequence shown in SEQ ID NO.14 and a reverse complementary sequence thereof.

In another aspect of the present invention, there is also provided a product comprising a substance that inhibits or increases the activity of a tick autophagy-related protein molecule ATG5, or that inhibits or increases the expression of a tick autophagy-related protein molecule ATG5 gene, which has any one of the following functions (1) to (3): (1) preventing and treating tick-borne diseases; (2) preventing the bite of ticks; (3) inhibiting the development of tick salivary glands.

In another aspect of the invention, the application of the tick autophagy-related protein molecule ATG5or the gene thereof is also provided, and the application is used for preparing a biological insecticide for preventing and treating tick-borne diseases.

In another aspect of the invention, the substance for inhibiting or improving the activity of the tick autophagy-related protein molecule ATG5 and the application of the substance for inhibiting or improving the gene expression of the tick autophagy-related protein molecule ATG5 are also provided, and the substance is used for preparing the biological pesticide for preventing and treating tick-borne diseases.

The ATG5 gene RNA interference experiment proves that ATG5 gene silencing can obviously influence the blood sucking of the tick, and the ATG5 gene is expected to become a candidate molecule for tick borne disease control, so that the tick autophagy-related protein molecule ATG5 has a wide application prospect.

Drawings

The present invention will be described in further detail with reference to the accompanying drawings and specific embodiments.

FIG. 1 is a diagram showing the result of recombinant expression of Rhipicephalus falciparus autophagy-related protein ATG5 in example 2 of the present invention;

FIG. 2 is a graph showing the results of measuring the change in the expression level of the native protein RhATG5 in the salivary glands of ticks at different blood-sucking times in example 3 of the present invention;

FIG. 3 is a graph showing the results of RNA interference experiments with Rhipicephalus falciparus autophagy-related protein ATG5 in example 4 of the present invention.

Detailed Description

In order to find candidate molecules for resisting tick vaccines or preventing and controlling tick-borne diseases, the autophagy-related protein molecule ATG5 is obtained from Rhipicephalus falciparus for the first time, and the results of cloning, recombinant expression, in-vivo and in-vitro RNAi experiments on the Rhipicephalus falciparus ATG5 gene show that after the ATG5 gene is silenced, ticks cannot normally suck blood and obvious blood sucking disorder occurs, so that the ATG5 protein gene plays an important role in connection paths of tick autophagy and apoptosis and is suitable for serving as the candidate molecules for preventing and controlling tick-borne diseases.

Example 1 Gene cloning and sequence analysis of Rhipicephalus falciparum autophagy-related protein ATG5(RhATG5)

1. Materials and methods

1.1. Tick and laboratory animal

Rhipicephalus falciparum is collected from Wuchang Hubei and artificially bred and stored in rabbit bodies in the laboratory. Male kunming-line mice at 6 weeks of age were purchased from shanghai slaike laboratory animals ltd. New Zealand white rabbits were purchased from the center of the laboratory animals at the university of Zealand.

1.2. Bacteria and plasmids

The plasmid construction and protein expression used were E.coli DH5 α and BL21(DE3) competent cells (Transgen). the gene cloning vector was pMD-18T (Takara), and the expression vectors used were pET30a vector (Novagen) and pCMV-HA (Takara).

1.3 molecular cloning of Rh ATG5

Salivary gland RNA of saturated blood ticks after microdissection was extracted by the TRIzol reagent (Invitrogen) method. Genomic cDNA was obtained from total RNA of the worm by using a genome-free reverse transcription kit, and experimental methods were referred to the reverse transcription kit PrimeScript^TMRT reagent Kit with gDNA Eraser (TaKaRa, Dalian, China) instructions for operation. The sequence of ATG5 homologous gene predicted by transcriptome sequencing was used to design the amplification primers of Rh ATG5, F: 5'-GCTTGTGACAGCTCGTGCAGTC-3' (SEQ ID NO.3) and R: 5'-GCCGTAGAGTTTGAGAAATATCACTGGT-3' (SEQ ID NO.4), and the purified PCR amplification product was ligated into cloning vector pMD-18T (Takara) for sequencing.

2. Results

The full length of the RhATG5ORF is 840bp (SEQ ID NO.2), 280 amino acids are coded (SEQ ID NO.1), the predicted isoelectric point of the protein is 6.09, the relative molecular mass is about 32.5kDa, the amino acid sequence analysis shows that the 81-276 amino acid region of the protein is a structural domain of a typical ATG5 family, the evolutionary tree analysis shows that compared with mammals and nematodes, the RhATG5 is closer to the relationship of the fruit fly, silkworm and mosquito in arthropoda class, the protein tertiary structure of the RhATG5 is predicted to have 11 α helices, 8 β folds and some irregular curls, the cleavage site of the RhATG5 is predicted through sequence alignment, and the nonapeptide sequence at the position YMPDGSLIQ of 192-.

EXAMPLE 2 expression and purification of recombinant proteins

In order to achieve a higher purification level, an expression vector is constructed, and the N end of the target protein is provided with a His tag.

A fragment In which BamHI and Hind III sites and a partial vector sequence were introduced by primer design based on the pET30a vector sequence and Rh ATG5 full-length gene was subcloned into the double-digested expression vector pET-30a (Novagen) according to the In-Fusion HD Cloning kit (Clontech, Takara Bio) kit instructions and sequenced to ensure the accuracy of the sequence. Coli BL21(DE3) into competent cells for expression. The expression strain was induced with 1mM IPTG, incubated at 37 ℃ for about 10 hours, and then the strain was collected and stored at-80 ℃. The recombinant protein was purified by Ni-NTA His Bind Resin (Novagen), the collected induced bacterial pellet was resuspended in biningbuffer (NI-NTA Buffer Kit, Novagen), then sonicated, centrifuged at 12,000 Xg for 10min at 4 ℃, the pellet was collected and dissolved in urea, and the inclusion body was purified and then analyzed and quantified by SDS-PAGE gel electrophoresis.

As a result: the recombinant protein was successfully expressed with a molecular weight of approximately 35kDa, consistent with the predicted size (FIG. 1). The protein was expressed in an insoluble form, and the expression strain was induced with 1mM IPTG for 10 hours at 37 ℃ and then subjected to inclusion body purification. In FIG. 1, M is the whole strain of IPTG-induced empty vector pET-30 a; 2-5 is IPTG induced pET-30a-ATG5 whole strain.

Example 3 detection of native protein RhATG5 in salivary glands of ticks at different time of blood sucking

1. Preparation of antiserum of recombinant protein RhATG5 and western blotting detection

The purified recombinant protein was emulsified after mixing with an equal volume of Freund's complete adjuvant, and mice were immunized by subcutaneous injection (about 100. mu.g each of the recombinant protein) and then boosted twice a week, and the recombinant protein required to be emulsified with an equal volume of incomplete adjuvant. One week after the third immunization, blood samples were collected from the mice by orbital bleeding and antibody titers were determined by ELISA.

Tick salivary gland samples at different blood sucking times were quantified by brandford and adjusted to the same concentration, mixed in a2 x SDS gel-loading buffer, and then the proteins were denatured at 100 ℃ for 10 min. After gel electrophoresis in 12% SDS-PAGE, the gel was transferred to PVDF membrane and blocked with 5% skim milk at room temperature for two hours. The blocked PVDF membrane and recombinant protein antiserum (1:100 dilution) 4 degrees C were incubated overnight, then TBST (1% Tween-20) every 10 minutes to wash, total 3 times. After incubation with HRP-labeled goat anti-mouse IgG (1:2000 dilution) for 1 hour at room temperature, the membrane was washed with the same antibody. And finally performing ECL color development.

2. Indirect immunofluorescence assay

To examine the recognition of the native protein by the antiserum against the recombinant protein Rh ATG 5. Paraffin embedding of tick salivary gland at different blood sucking time, slicing, performing antigen retrieval after tissue circling out by dewaxing and rehydration and an immunohistochemical pen, performing membrane penetration treatment of 0.1% TritonX-100 for 20min, sealing at 37 ℃ with 3% BSA for 30min, and washing with PBS for three times, 5min each time. The cells were incubated overnight at 4 ℃ with recombinant protein antiserum as the primary antibody and washed three times with PBS for 5min each. The secondary antibody was incubated with goat anti-mouse IgG for 1h at 37 ℃ and washed three times with PBS for 5min each. Finally, the slide was stained with DAPI (1:500, Thermo) for 20min, washed clean with PBS, and mounted after dropping an anti-fluorescence quencher (Sigma). The fluorescence signal was detected by confocal laser microscopy.

3. Results

The purified recombinant protein RhATG5 is used for immunizing mice to obtain polyclonal antibodies, and changes of the expression level of RhATG5 in salivary glands of ticks at different blood sucking times are detected. As a result, as shown in FIG. 2, the expression level of RhATG5 was significantly increased at the late stage of the tick feeding, and a clear cleavage band was observed. The recombinant protein is shown to have immunogenicity, antiserum obtained after immunization can recognize the natural protein RhATG5, and the occurrence of a cleavage zone possibly indicates that the conversion from autophagy to apoptosis occurs in the late stage of tick blood sucking and after blood saturation.

Example 4 Synthesis of Rhipicephalus falciparum RhATG5dsRNA and RNA interference

In vivo RNA interference assay for Rh ATG5

Based on the base sequence of Rh ATG5, primers synthesized by dsATG5 and dsLuciferase were designed:

dsATG5-S1:GGATCCTAATACGACTCACTATAGGTTACGGGAGATTTGGGATGGGCG(SEQ IDNO.5)；

dsATG5-A1:ACTCATCCATTGAAGCGGTGTGTCC(SEQ ID NO.6)；

dsATG5-S2:TTACGGGAGATTTGGGATGGGCG(SEQ ID NO.7)；

dsATG5-A2:GGATCCTAATACGACTCACTATAGGACTCATCCATTGAAGCGGTGTGTCC(SEQ IDNO.8)；

dsLuciferase S1:5′-GGATCCTAATACGACTCACTATAGGGCTTCCATCTTCCAGGGATAC-3′(SEQ ID NO.9)；

dsLuciferase A1:5′–CGTCCACAAACACAACTCCTCC-3′(SEQ ID NO.10)；

dsLuciferase S2:5′-GCTTCCATCTTCCAGGGATACG-3′(SEQ ID NO.11)；

dsLuciferaseA2:5′-GGATCCTAATACGACTCACTATAGGCGTCCACAAACACAACTCCTC(SEQID NO.12)。

using the pMD-18T plasmid containing RhATG5 obtained in example 1 (RNAi sequence length 765bp as template, dsATG5-S1, dsATG5-A1, dsATG5-S2, dsATG5-A2 as primers (T7 promoter sequence in italics bold part), PCR amplification of RhATG5 sequence containing T7 promoter sequence, and gel recovery and purification of PCR product, wherein RNAi uses luciferase gene RNAi (RNAi sequence length 600bp or so) as control group, then, RhATG5 sequence containing T7 promoter sequence obtained by the above PCR amplification as template (DNA sequence shown in SEQ ID No. 13), T7RiboMAX 5 is used^TMExpress RNAi System (Promega) kit for in vitro transcription to generate double-stranded RNA (dsRNA) of RhATG5, abbreviated as dsATG5, the double-stranded RNA consists of a sense strand and an antisense strand, the nucleotide sequence of the sense strand is shown as SEQ ID No.14, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of SEQ ID No. 14. 160 female ticks which are not subjected to blood sucking are selected, dsATG5 is injected into an experimental group in a microinjection mode, each dsATG is 1 mu g (80), each tick in a control group is injected with the same amount of dsLuciferase (80), after the state of the dsATG is observed after 24 hours, the ticks are inoculated to New Zealand white rabbits, and salivary glands of the ticks in the experimental group and the control group at different blood sucking time are collected for western blot detection and immunofluorescence detection.

In vitro RNA interference assay of Rh ATG5

20 ticks on day 5 of blood draw and day 1 of full blood were collected, salivary glands were collected after microdissection, cultured in a 24-well plate with L15 medium (1% penicilin), 10 ticks per well were added to dsATG5 in the experimental groups on day 5 of blood draw and day 1 of full blood draw, respectively, to give a final concentration of 1 μ g/mL, and an equivalent amount of dsLuciferase was added to the control group. After in vitro stimulation is carried out for 48h, different groups of salivary gland samples are collected to carry out western blot detection and immunofluorescence detection.

3. Results

The results of the in vivo RNA interference experiments are shown in fig. 3A, compared with the Luciferase group of the control group, the ticks injected with dsATG5 with the same amount could not normally suck blood, and had blood sucking disorder, but did not significantly affect the upper body rate of the ticks, and it is presumed that after ATG5 interference, the development of the tick salivary gland in the early stage of blood sucking was inhibited, and the blood sucking disorder was caused.

After in vitro RNA interference of RhATG5, western blot, TEM and Tunel staining detection show that compared with a control group, after dsATG5 is added, the expression level of RhATG5 and a cutting zone thereof in a tick salivary gland can be obviously reduced, meanwhile, the expression level of autophagy related molecule negative feedback molecule p62 in an experimental group is obviously increased, the expression level of autophagy marker molecule LC3 is obviously reduced, and the expression level of apoptosis related molecule caspase3 is also obviously reduced. TEM examination found that the number of autophagosomes and autophagic vacuoles in the dsATG5 experimental group was significantly less than that in the control group, and Tunel staining results showed that the positive rate in the dsATG5 group was significantly lower than that in the control group (see FIG. 3B). In conclusion, after the ATG5 is interfered, the level of autophagy and apoptosis in the salivary gland of the tick can be reduced simultaneously, and the degeneration process of the salivary gland of the tick is inhibited to a certain extent.

The results show that the RhATG5 gene can obviously affect the blood sucking of ticks after being silenced, and the RhATG5 gene can be used as a candidate molecule for tick borne disease control.

The above-mentioned embodiments only express the embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Shanghai animal doctor institute of Chinese academy of agricultural sciences (Shanghai center of Chinese centers of animal health and epidemiology)

<120> tick autophagy-related protein molecule ATG5 and application thereof

<160>14

<170>PatentIn version 3.3

<210>1

<211>280

<212>PRT

<213> Fusarium fancifolium (Rhipicephalus haemaphysioides)

<400>1

Met Ala Glu Asp Arg Glu Val Leu Arg Glu Ile Trp Asp Gly Arg Leu

1 5 10 15

Pro Val Cys Phe Lys Leu Ala Glu Glu Glu Val Tyr Thr Met Gln Gln

20 2530

Pro Glu Pro Tyr Tyr Leu Met Ile Ser Arg Ile Ser Tyr Phe Pro Leu

35 40 45

Val Val Asp Lys Val His Lys His Phe Ser Arg His Val Asp Glu Arg

50 55 60

Tyr His Gly Asn Glu Met Trp Leu Glu Tyr Asn Gly Gln Pro Leu Lys

65 70 75 80

Trp His Leu Pro Ile Gly Val Leu Tyr Asp Cys Asn Ala Ser Asp Ser

85 90 95

Ile Leu Pro Trp Gly Ile Thr Val His Phe Gln Asp Phe Pro Glu Lys

100 105 110

Gln Ile Leu His Cys Gly Ser Arg Ala Val Val Glu Ser His Phe Met

115 120 125

Ser Ala Ile Lys Glu Ala Asp Met Leu Lys His Arg Ser Gln Val Val

130 135 140

Ser Thr Met Gln Lys Lys Asp His Asn Gln Leu Trp Val Gly Leu Leu

145 150 155 160

Asn Ser Lys Phe Asp Gln Phe Trp Ala Ile Asn Lys Lys Phe Met Glu

165 170 175

Arg Ile Gly Gly Glu Cys Phe Lys His Ile Pro Phe Arg Leu Tyr Met

180 185 190

Pro Asp Gly Ser Leu Ile Gln Arg Leu Val Thr Pro Leu Thr Pro Ser

195 200 205

Gly Asp Lys Ala Thr Leu Glu Thr Leu Leu Gln Gln Val Val Pro Gln

210 215 220

Ala Leu Val Gly Gly Asp Val Ala Ser Phe Leu Ile Ser Ser Asp Gly

225 230 235 240

Ala Lys His Ser Ile Ile Thr His Gly Ile Gln Val Pro Leu Asp Thr

245 250 255

Pro Leu Gln Trp Met Ser Glu His Leu Ser Tyr Pro Asp Asn Phe Leu

260 265 270

His Leu Cys Val Met Pro Cys Ser

275 280

<210>2

<211>843

<212>DNA

<213> Fusarium fancifolium (Rhipicephalus haemaphysioides)

<400>2

atggcggaag atcgtgaagt cttacgggag atttgggatg ggcgccttcc ggtgtgcttc 60

aagctcgccg aagaggaagt atacacgatg cagcagcctg aaccttatta tctgatgatt 120

tcgaggataa gctactttcc cctagtggtt gacaaggtcc ataagcactt ctccaggcat 180

gtcgatgagc gataccatgg taatgaaatg tggcttgaat acaatggtca acctttgaaa 240

tggcatttac ccattggtgt actttatgac tgtaatgcta gtgattccat tttaccatgg 300

ggtatcacag ttcactttca ggattttccc gagaagcaaa tattacactg cggaagtcga 360

gccgtggttg aatcgcactt catgtctgcc atcaaggaag cagacatgct gaagcatcgc 420

agccaagtgg tcagcactat gcagaagaaa gaccacaatc agctttgggt aggactactt 480

aactcaaagt ttgaccagtt ctgggccatc aacaagaaat tcatggaacg cattggtgga 540

gagtgcttca agcacatacc ttttcgcctg tatatgcctg atggcagtct tatccaaagg 600

ctagtcacgc cattgacacc ctctggcgac aaggcaactc tagagaccct attgcagcaa 660

gtagtccctc aggctcttgt aggaggtgac gtggcgagtt ttctgatatc ttcagatgga 720

gccaaacaca gcatcatcac acatgggata caggtccctc tggacacacc gcttcaatgg 780

atgagtgaac acctcagtta cccagacaac tttctgcact tgtgtgtcat gccgtgctca 840

tag 843

<210>3

<211>22

<212>DNA

<213> Artificial sequence (Artificial)

<400>3

gcttgtgaca gctcgtgcag tc 22

<210>4

<211>28

<212>DNA

<213> Artificial sequence (Artificial)

<400>4

gccgtagagt ttgagaaata tcactggt 28

<210>5

<211>48

<212>DNA

<213> Artificial sequence (Artificial)

<400>5

ggatcctaat acgactcact ataggttacg ggagatttgg gatgggcg 48

<210>6

<211>25

<212>DNA

<213> Artificial sequence (Artificial)

<400>6

actcatccat tgaagcggtg tgtcc 25

<210>7

<211>23

<212>DNA

<213> Artificial sequence (Artificial)

<400>7

ttacgggaga tttgggatgg gcg 23

<210>8

<211>50

<212>DNA

<213> Artificial sequence (Artificial)

<400>8

ggatcctaat acgactcact ataggactca tccattgaag cggtgtgtcc 50

<210>9

<211>46

<212>DNA

<213> Artificial sequence (Artificial)

<400>9

ggatcctaat acgactcact atagggcttc catcttccag ggatac 46

<210>10

<211>22

<212>DNA

<213> Artificial sequence (Artificial)

<400>10

cgtccacaaa cacaactcct cc 22

<210>11

<211>22

<212>DNA

<213> Artificial sequence (Artificial)

<400>11

gcttccatct tccagggata cg 22

<210>12

<211>46

<212>DNA

<213> Artificial sequence (Artificial)

<400>12

ggatcctaat acgactcact ataggcgtcc acaaacacaa ctcctc 46

<210>13

<211>765

<212>DNA

<213> Artificial sequence (Artificial)

<400>13

ttacgggaga tttgggatgg gcgccttccg gtgtgcttca agctcgccga agaggaagta 60

tacacgatgc agcagcctga accttattat ctgatgattt cgaggataag ctactttccc 120

ctagtggttg acaaggtcca taagcacttc tccaggcatg tcgatgagcg ataccatggt 180

aatgaaatgt ggcttgaata caatggtcaa cctttgaaat ggcatttacc cattggtgta 240

ctttatgact gtaatgctag tgattccatt ttaccatggg gtatcacagt tcactttcag 300

gattttcccg agaagcaaat attacactgc ggaagtcgag ccgtggttga atcgcacttc 360

atgtctgcca tcaaggaagc agacatgctg aagcatcgca gccaagtggt cagcactatg 420

cagaagaaagaccacaatca gctttgggta ggactactta actcaaagtt tgaccagttc 480

tgggccatca acaagaaatt catggaacgc attggtggag agtgcttcaa gcacatacct 540

tttcgcctgt atatgcctga tggcagtctt atccaaaggc tagtcacgcc attgacaccc 600

tctggcgaca aggcaactct agagacccta ttgcagcaag tagtccctca ggctcttgta 660

ggaggtgacg tggcgagttt tctgatatct tcagatggag ccaaacatag catcatcaca 720

catggggtac aggtccctct ggacacaccg cttcaatgga tgagt 765

<210>14

<211>765

<212>RNA

<213> Artificial sequence (Artificial)

<400>14

uuacgggaga uuugggaugg gcgccuuccg gugugcuuca agcucgccga agaggaagua 60

uacacgaugc agcagccuga accuuauuau cugaugauuu cgaggauaag cuacuuuccc 120

cuagugguug acaaggucca uaagcacuuc uccaggcaug ucgaugagcg auaccauggu 180

aaugaaaugu ggcuugaaua caauggucaa ccuuugaaau ggcauuuacc cauuggugua 240

cuuuaugacu guaaugcuag ugauuccauu uuaccauggg guaucacagu ucacuuucag 300

gauuuucccg agaagcaaau auuacacugc ggaagucgag ccgugguuga aucgcacuuc 360

augucugcca ucaaggaagc agacaugcug aagcaucgca gccaaguggu cagcacuaug 420

cagaagaaag accacaauca gcuuugggua ggacuacuua acucaaaguu ugaccaguuc 480

ugggccauca acaagaaauu cauggaacgc auugguggag agugcuucaa gcacauaccu 540

uuucgccugu auaugccuga uggcagucuu auccaaaggc uagucacgcc auugacaccc 600

ucuggcgaca aggcaacucu agagacccua uugcagcaag uagucccuca ggcucuugua 660

ggaggugacg uggcgaguuu ucugauaucu ucagauggag ccaaacauag caucaucaca 720

caugggguac aggucccucu ggacacaccg cuucaaugga ugagu 765

Claims

1. A tick autophagy-related protein molecule ATG5 has an amino acid sequence shown in SEQ ID NO. 1.

2. A gene of tick autophagy-related protein molecule ATG5, comprising: a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 1.

3. The gene of the tick autophagy-related protein molecule ATG5 according to claim 2, characterized in that the gene comprises the nucleotide sequence shown in SEQ ID No. 2.

4. A substance that inhibits or increases the activity of the tick autophagy-related protein molecule ATG5 according to claim 1.

5. A substance that inhibits or increases the expression of the gene of the tick autophagy-related protein molecule ATG5 according to claim 2.

6. The agent according to claim 5, wherein the agent that inhibits the expression of ATG5 gene comprises: dsRNA for inhibiting the expression of the ATG5 gene of the tick autophagy-related protein molecule according to claim 2.

7. The substance of claim 6, wherein the dsRNA is a double-stranded RNA consisting of the nucleotide sequence shown in SEQ ID No.14 and the reverse complement thereof.

8. A product comprising the substance of claim 4 or 5, which has any one of the following functions (1) to (3):

(1) preventing and treating tick-borne diseases;

(2) preventing the bite of ticks;

(3) inhibiting the development of tick salivary glands.

9. Use of the gene ATG5 of the tick autophagy-related protein molecule according to claim 1 or ATG5 of the tick autophagy-related protein molecule according to claim 2 or the substance according to claim 4 or 5 for the preparation of a biopesticide for the control of tick-borne diseases.