CN110787181A - Group of miRNA and application thereof in biological targeted therapy of breast cancer - Google Patents

Group of miRNA and application thereof in biological targeted therapy of breast cancer Download PDF

Info

Publication number
CN110787181A
CN110787181A CN201911261380.3A CN201911261380A CN110787181A CN 110787181 A CN110787181 A CN 110787181A CN 201911261380 A CN201911261380 A CN 201911261380A CN 110787181 A CN110787181 A CN 110787181A
Authority
CN
China
Prior art keywords
mir
breast cancer
mirna
tnbc
inhibitor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201911261380.3A
Other languages
Chinese (zh)
Other versions
CN110787181B (en
Inventor
赵敏
昂琳
王瑾
胡红光
郑丽
黄金
孙斌
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Second Peoples Hospital of Hefei
Original Assignee
Second Peoples Hospital of Hefei
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Second Peoples Hospital of Hefei filed Critical Second Peoples Hospital of Hefei
Priority to CN201911261380.3A priority Critical patent/CN110787181B/en
Publication of CN110787181A publication Critical patent/CN110787181A/en
Application granted granted Critical
Publication of CN110787181B publication Critical patent/CN110787181B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10321Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Abstract

The invention relates to a group of miRNA and application thereof in biological targeted therapy of breast cancer. The miRNA comprises: miR-9-5p, miR-10b-5p, miR-21-5p, miR-23a-3p, miR-29a-3p, miR-155-5p, miR-222-3p, miR-301a-3p and miR-373-3 p. Interfering the expression and function of the miRNA, and inhibiting the proliferation and transfer activity of TNBC and non-TNBC cells; meanwhile, the function of the 9 miRNAs is interfered, the proliferation activity of TNBC and non-TNBC cancer cells can be obviously inhibited, and the tumor growth of a TNBC cell nude mouse transplantation tumor model is obviously inhibited. The invention provides a new candidate therapeutic strategy for breast cancer, particularly highly malignant refractory TNBC.

Description

Group of miRNA and application thereof in biological targeted therapy of breast cancer
Technical Field
The invention relates to the technical field of biomedicine and molecular biology, in particular to a group of miRNA and application thereof in biological targeted therapy of breast cancer.
Background
Breast cancer is a leading cause of cancer death in women. In the last decade, due to the combination of chemotherapy, endocrine therapy and the exploration and application of Her-2 targeted therapy, the curative effect of clinical treatment of breast cancer is obviously improved, and the death rate is reduced year by year. However, one type of breast cancer is very specific, accounting for about 15-20%, and is characterized by the fact that cancer cells do not express three markers, Estrogen Receptor (ER), Progesterone Receptor (PR), and human epidermal growth factor receptor 2 (HER-2), and is therefore called Triple Negative Breast Cancer (TNBC). TNBC is not sensitive to hormonal therapy and no targeted drugs are currently available, so cytotoxic chemotherapy is the only treatment option for TNBC. Overall, TNBC patients have poor clinical treatment efficacy and poor overall prognosis compared to other breast cancer subtypes, and there is a great need to develop effective treatment methods.
miRNAs have small molecules, large quantity and wide distribution and are important core components in a gene regulation network. A considerable number of human genes are regulated by miRNAs and are closely related to the occurrence and development of a plurality of major diseases (such as tumors, AIDS, cardiovascular system diseases, nervous system diseases and the like) of human beings.
At present, a large number of documents show that miRNAs promote or inhibit the growth and differentiation of tumor cells in breast cancer, and have certain clinical application potential in the aspects of gene diagnosis and treatment of breast cancer and guidance of breast cancer personalized medicine. For example: patent document CN109439748A, published Japanese 2019.03.08, discloses the application of miR-9-5p as a breast cancer distant metastasis monitoring marker. The invention proves that the expression level of miR-9-5p in a breast cancer patient is obviously increased and can be secreted into serum, the miR-9-5p level in the serum is closely related to the distant metastasis of the breast cancer, and the serum in the patient with the distant metastasis of the breast cancer is obviously increased compared with the serum in the patient with the non-distant metastasis of the breast cancer. In 2018, the university of south China university Master academic thesis, "screening and verification of early diagnosis microRNA markers for breast cancer based on big data", downloading high-throughput microRNA-seq data (including expression information of 2589 microRNAs in total) of 409 early breast cancer tissue samples with clinical pathology staging information and 7 paracancer samples serving as healthy controls from a TCGA cancer database, removing microRNAs with data deletion rates larger than 10%, and further preliminarily screening 20 candidate microRNAs capable of serving as early diagnosis markers according to expression difference analysis results, wherein p-value <0.05, expression change multiple | fold-change | >3.5 and average expression abundance mean _ C >100 of samples in a control group: miR-99a-5p, miR-486-5p, miR-451a, miR-378a-5p, miR-378a-3p, miR-375, miR-337-3p, miR-21-5p, miR-21-3p, miR-203a-3p, miR-200a-5p, miR-183-5p, miR-182-5p, miR-145-5p, miR-144-5p, miR-141-3p, miR-139-5p, miR-125b-5p and miR-10b-5 p. Si and the like (SI M L, ZHU S, WU H, et al, miR-21-mediated tumor growth [ J ]. Oncogene, 2007, 26(19):2799-2803.) designs that antisense oligonucleotides aiming at miRNA-21 are transferred into a breast cancer cell strain MCF-7, and the cell growth is obviously inhibited. However, determining the key miRNAs and constructing efficient miRNAs-based breast cancer drugs, particularly drugs aiming at refractory breast cancer TNBC, are in need of research.
Disclosure of Invention
The invention aims to provide a miRNA for biological targeted therapy of breast cancer and application thereof, aiming at the defects in the prior art.
In a first aspect, the present invention provides an application of a miRNA combination or an inhibitor of a miRNA combination in the preparation of a medicament for treating breast cancer, the miRNA combination comprising: miR-9-5p, miR-10b-5p, miR-21-5p, miR-23a-3p, miR-29a-3p, miR-155-5p, miR-222-3p, miR-301a-3p and miR-373-3 p.
As a preferred example, the inhibitor of the miRNA combination is a substance that decreases the expression level, activity, stability or effective duration of action of each miRNA in the miRNA combination.
More preferably, the inhibitor of the miRNA combination is selected from:
a) a nucleic acid inhibitor, protein inhibitor, nuclease or nucleic acid binding molecule;
b) a plasmid vector carrying or expressing any one of a); or
c) A host carrying or expressing any one of a).
More preferably, the inhibitor of the miRNA combination is selected from:
a) the method comprises the following steps of (1) interfering LncRNA, wherein a sequence for coding the interfering LncRNA is n copies of a sequence shown in 16-189bp in SEQ ID NO.10, and n is an integer more than or equal to 1;
b) expressing the plasmid vector of a); or
c) Carrying the virus of a).
As another preferred example, the breast cancer is a triple negative breast cancer.
In a second aspect, the invention provides an interfering LncRNA, wherein the sequence coding for the LncRNA is n copies of the sequence shown as 16-189bp in SEQ id No.10, and n is an integer greater than or equal to 1.
In a third aspect, the present invention provides a nucleic acid molecule encoding LncRNA as described above.
As a preferred example, the nucleic acid molecule comprises a sequence shown as 16-189bp in SEQ ID NO. 10.
In a fourth aspect, the present invention provides a virus having integrated into its genome an expression cassette expressing LncRNA as described above.
The invention has the advantages that:
1. according to the invention, through miRNA Microarray and qRT-PCR screening of breast cancer tissues and breast cancer cell lines, 9 high-expression Oncorirs (miR-9-5p, miR-10b-5p, miR-21-5p, miR-23a-3p, miR-29a-3p, miR-155-5p, miR-222-3p, miR-301a-3p and miR-373-3p) related to TNBC are determined in miRNA of breast cancer differential expression. Representative target genes (PTEN, PDCD4, FOXO3a, RhoA, TRPS1) were also predicted by the miRanda-mirSVR database, literature reports and mRNA Microarray analysis and confirmed in cytological experiments. Interfering the expression and function of the OncomiR can up-regulate the target gene to express the cancer suppressor and inhibit the proliferation and transfer activity of TNBC and non-TNBC cells.
2. The invention designs an interference lncRNA (lncRNAi9) artificially, expresses with high copy and high efficiency under the mediation of a tumor specific proliferation adenovirus vector, and can simultaneously interfere 9 OncoriR functions, thereby establishing a TNBC treatment strategy. The tumor specific proliferation adenovirus AdSVP-lncRNAi9 infects breast cancer cells and proliferates and replicates in the cells at high copy number, the maximum copy number can reach more than 5 ten thousand times, the expressed interference lncRNA (lncRNAi9) forms a spongy net frame structure in the cells, competitively combines a plurality of OncoriR to inhibit the function, protects all target genes, enables the target genes to express cancer suppressor factors, and plays a role in resisting cancer. Cell experiments prove that in TNBC and non-TNBC cancer cells infected by AdSVP-lncRNAi9, the expression levels of OncomiR target genes PTEN, PDCD4, FOXO3a, RhoA and TRPS1 are obviously up-regulated, the EMT of the cancer cells is reversed, and the proliferation activity of the cancer cells is obviously inhibited. The curative effect of the TNBC treatment strategy is verified by establishing a nude mouse transplantation tumor model of TNBC cells. As a result, the AdSVP-lncRNAi9 has obvious anticancer effect, and the tumor inhibition rate is 73.84% 35 days after the treatment of the transplanted tumor.
Drawings
FIG. 1. differences in expression of OncomiRs in TNBC and non-TNBC cell lines. .
FIGS. 2 and 3. inhibition of Oncorirs function to reverse the course of EMT in breast cancer cells.
FIG. 4 inhibition of Oncorirs function inhibits the proliferative activity of breast cancer cells.
FIG. 5 proliferation of AdSVP-lncRNAi9 virus interfering with Oncorirs function and its inhibition of proliferative activity in breast cancer cells.
Figure 6. TNBC treatment strategies interfering with OncomiRs function an observation of the efficacy of TNBC animal models.
FIG. 7.pENTR11dual shuttle vector map.
Detailed Description
The following detailed description of the present invention will be made with reference to the accompanying drawings.
Example 1
Materials and methods
1.MiRNA expression profile chip detection for breast cancer tissues
8 breast cancer tissue samples of clinical operation of a hospital in 11 months in 2014 1-2014 were taken, and 3 breast fibroadenoma samples of surgical excision were taken, and normal lobular tissue was taken as a control beside the tumor. Extracting total RNA from a part of fresh tissues, and preparing the total RNA as miRNA Microarray; the other part of the tissue is subjected to conventional fixing, embedding and flaking and is prepared for ER, PR and HER2 immunohistochemistry. All patients do not undergo radiotherapy, chemotherapy, endocrine treatment and targeted treatment before operation, and all cases have complete clinical pathological data.
2. qRT-PCR detection of breast cancer cell line miRNA expression
TNBC cell line MDA-MB-231[ ER-, PR-, HER2/Neu-, EGFR +, TGF- α receptor + and WNT7B oncogene + ], MDA-MB-468[ ER-, PR-, HER2/Neu-, EGFR + +, and p53mutant R2073H ], and MCF-7[ ER (+), PR (+), HER-2(-), WNT7B oncogene expressing, SK-BR-3[ HER2 overexpressing ], as well as normal mammary duct epithelial cell line MCF10A.Western Blotting identified ER, PR, HER2 expression, miRNA expression was detected using qRT-PCR (miR-9-5p, miR-10b-5p, miR-21-5p, miR-23a-3p, miR-29a-3p, miR-155-5p, miR-222-3p, miR-301a-3p, miR-373-3 p).
Western Blotting to detect the influence of Oncorirs inhibitor on the gene expression of breast cancer cells
MDA-MB-231, MDA-MB-468, MCF-7, SK-BR-3 and MCF10A cells were plated in 96-well plates at 1 × 10 per well4The cells were counted and allowed to adhere after 24h, the culture medium was changed, the OncomiR inhibitor (see Table 1, Shanghai GenecheCo., LTD.) was added to a final concentration of 20nM, and the culture was continued for 72 h. An inCtrl negative control group was set. Collecting cells, extracting total protein, and detecting the expression of Oncorirs target genes and EMT related markers by a Western Blotting method. And (3) analyzing and selecting representative target genes of Oncorirs according to a miRanda-mirSVR database, a literature report and miRNA Microarray experiment results.
TABLE 1 OncomiR inhibitors
Figure BDA0002311692190000041
CCK-8 detection of Breast cancer cell proliferative Activity
The experimental cell line was seeded in 96-well culture plates at 1X 10 per well4Cell number, after 24h incubation, the OncomiR inhibitor was added to a final concentration of 20nM per well, 8 replicate wells per group. Cell proliferation activity assays were performed at 24h, 48h, 72h, and 96h time points, respectively, as specified in the CellCounting Kit-8(CCK-8) Kit (Dojindo Molecular Technologies, Inc., Shanghai, China).
Transwell detection of metastatic Activity of Breast cancer cells
Transwell chambers (Corning, Tewksbury, USA) were placed in 24-well plates, the upper chamber was covered with 50. mu.l of 1:6diluted matrigel (BD Biosciences, San Jose, USA), and the experimental cell lines were added, 5X 10 per chamber4Cell count/100. mu.l, 500. mu.l of medium containing 10% fetal bovine serum was added to the lower chamber. After 24h incubation, OncomiR inhibitor was added to the upper chamber to a final concentration of 20nM per well. After further culturing for 48h, the cells were removed, wiped off the upper layer of the chamber, stained with 0.1% crystal violet for 15min, and counted and photographed under an optical microscope with 5 fields (x 200 times) at random.
6. Construction and cytological experiment of tumor specific proliferation virus interfering OncomiR function
We designed an open reading frame (SEQ ID NO: 10) encoding LncRNA, which contains the complementary sequence of 9 OncoriR seed sequences highly expressed in TNBC and repeats 10 copies in tandem (lncRNAi9), and inserted into EcoRI/SalI sites of pENTR11dual shuttle vector (vector map is shown in FIG. 7) of thermo Fisher company, and recombined with pAdSVPE3RC, which is an adenovirus backbone constructed by us, to obtain the required AdSVP-lncRNAi9 (the complete genome sequence of AdSVP-lncRNAi9 is shown in SEQ ID NO: 11). And simultaneously constructing a proliferative adenovirus AdSVP-EGFP and a non-proliferative adenovirus Ad5-EGFP which express a green fluorescent protein reporter gene (EGFP) gene as control viruses. All recombinant adenoviruses are amplified in HEK293 cells, the adenoviruses are purified by cesium chloride gradient centrifugation, and the virus titer is detected by a TCID50 method.
Experimental cells plated in 96-well plates, 1X 104A hole, after the cells are attached to the wall, the serum-free culture solution is replaced; the experimental and control viruses were added at MOI ═ 1 pfu/cell. Changing 5% serum culture solution after 2h of virus infection, continuously culturing for 0h, 24h, 48h and 72h, collecting cells, detecting virus titer by a TCID50 method, extracting protein, detecting protein expression by a WesternBlotting method, and detecting the proliferation activity of experimental cells by a CCK-8 method.
7. Animal experiments
20 healthy and pure BALB/C nude mice are 5 weeks old, female, provided by Shanghai Si Laike laboratory animal center in Chinese academy of sciences, and have the qualification number SCXK (Shanghai) 2018-. Injecting MDA-MB-231 cell suspension in logarithmic growth phase into the subcutaneous tissue of the right axilla of the nude mouse at 1 × 107The number of cells was 100. mu.l/cell. The tumor formation rate is 100% 14 days after inoculation, and the diameter of the transplanted tumor is about 0.5-0.8 cm. The groups were randomly divided into 4 groups (AdSVP-lncRNAi9, AdSVP-EGFP, Ad5-EGFP, blank control group) of 5 individuals each. The virus treatment group was given corresponding adenovirus intratumoral multiple injections, each at 2X 10 doses8pfu/100. mu.l once every other day for 5 times; the blank control group was injected with 100. mu.l each of virus stock solution simultaneously. After treatment, the tumor size is measured by regular observation and measurement, and the maximum diameter is multiplied by the minimum diameter2And (5) calculating the volume of the tumor body by a multiplied by 0.5' formula, and drawing a tumor growth curve.
After termination of the experimental observations, mice were euthanized, tumor bodies were fixed in 10% neutral buffered formalin, and paraffin-embedded sections were used for immunohistochemical detection of the expression of oncocomir representative target genes (PTEN, PDCD4), EMT markers (E-cadherin, Vimentin), and the expression level of EpCAM. The number of positive cells in 5 fields was counted under a 20-fold objective lens for each section and analyzed statistically.
Second, result in
1. Differential expression profiles of miRNAs in breast cancer tissue
8 breast cancer patients were identified by immunohistochemistry, 4 were TNBC, 2 were all positive for ER, PR, HER2, 1 was positive for ER, HER2, PR, and 1 was negative for ER, PR, and HER 2. By miRNA microarray profile detection, compared with normal breast tissues, 24 miRNA are highly expressed and 13 miRNA are lowly expressed in 8 breast cancer tissues. In 4 cases of TNBC, 7 miRNAs are highly expressed and 29 miRNAs are lowly expressed in TNBC compared with 4 cases of non-TNBC.
2. Expression of miRNAs in breast cancer cell lines
Western Blotting identified that MDA-MB-231 and MDA-MB-468 are confirmed to be TNBC, MCF-7 cell ER (+)/PR (+)/Her-2(-), SK-BR-3 cell ER (-)/PR (-)/Her-2(+), MCF10A cell ER (-)/PR (-)/Her-2 (+/-). According to qRT-PCR identification, 5 of miRNA (miR-10b-5p, miR-21-5p, miR-29a-3p, miR-222-3p and miR-301a-3p) are expressed in TNBC cell lines MDA-MB-231 and MDA-MB-468 higher than the expression levels of the miRNA in MCF-7 and SK-BR-3 (figure 1).
3. Inhibition of Oncorirs expression reverses the EMT process in TNBC cells
MDA-MB-231, MDA-MB-468, MCF-7, SK-BR-3, MCF10A cells were treated with 9 OncomiR inhibitors (negative controls inCtrl, inhibitor control), respectively, and it was found that miR-21-5p inhibitors increased PTEN and PDCD4 expression, miR-155-5p inhibitors increased FOXO3a, RhoA expression, miR-222-3p and miR-373-3p inhibitors increased TRPS1 expression, and miR-301a-3p and miR-10b-5p inhibitors increased PTEN expression (FIG. 2). All Oncorirs inhibitors were able to increase E-cadherin expression and decrease Vimentin expression (FIG. 3). All OncomiRs inhibitors had no significant effect on the expression of normal mammary duct epithelial cell MCF10A gene.
4. Interference with Oncomirs function in inhibiting proliferation of breast cancer cells
To verify the effect of multiple OncomiR inhibitors on breast cancer cell proliferative activity, we performed cell proliferative activity assays using the CCK-8 assay. Compared with the parental cells, 9 OncomiR inhibitors can reduce the survival rate of 4 breast cancer cell lines, but have no effect on MCF10A cells. Wherein the inhibition effect of the inhibitor of miR-10b-5p, miR-21-5p, miR-29a-3p, miR-301a-3p and miR-373-3p on the proliferation of TNBC cells is stronger than that of non-TNBC cells, and the inhibition effect of the inhibitor of miR-23a-3p and miR-155-5p on the non-TNBC cells is stronger than that of the inhibitor of the non-TNBC cells (figure 4). The control inCtrl had no effect on all cell proliferation activities.
5. TNBC treatment strategy that interferes with OncomiRs function
The function of 9 Oncorirs can be simultaneously interfered by constructing tumor-specific adenovirus AdSVP-lncRNAi9 and expressing artificially designed LncRNA (lncRNAi 9). After cells are infected by the AdSVP-lncRNAi9 and the control virus, virus titer detection shows that the AdSVP-lncRNAi9 and the AdSVP-EGFP are highly replicated in breast cancer cell lines, and the replication is up to more than 5 ten thousand times, but is below 50 times in MCF10A (A in FIG. 5). The proliferation activity of the AdSVP-lncRNAi 9-infected cancer cells is obviously inhibited, and the survival rate of the AdSVP-EGFP cancer cells is reduced to a certain extent (B in figure 5). AdSVP-lncRNAi9 and AdSVP-EGFP have no obvious influence on the survival rate of MCF10A, and Ad5-EGFP has no influence on the proliferation of all cells.
Anticancer therapy of AdSVP-lncRNAi9 against TNBC nude mouse transplanted tumor
After the nude mice MDA-MB-231 are transplanted with tumor and become tumor, experimental adenovirus and control adenovirus are given for treatment. The result of 28 days of observation shows that AdSVP-lncRNAi9 has obvious anticancer effect and the tumor inhibition rate reaches 81.6%. While AdSVP-EGFP also had some inhibitory effect, Ad5-EGFP had no effect on tumor growth (A in FIG. 6). Immunohistochemical detection revealed that AdSVP-lncRNAi9 treatment group E-cadherin up-regulated expression, Vimentin down-regulated expression (B in FIG. 6), and PTEN and PDCD4 all up-regulated expression (C in FIG. 6).
The above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, several modifications and additions can be made without departing from the method of the present invention, and these modifications and additions should also be regarded as the protection scope of the present invention.
SEQUENCE LISTING
<110> second people hospital in Hefei city
<120> a group of miRNA and application thereof in biological targeted therapy of breast cancer
<130>/
<160>11
<170>PatentIn version 3.3
<210>1
<211>23
<212>RNA
<213> Artificial sequence
<400>1
ucuuugguua ucuagcugua uga 23
<210>2
<211>21
<212>RNA
<213> Artificial sequence
<400>2
agcuacaucu ggcuacuggg u 21
<210>3
<211>23
<212>RNA
<213> Artificial sequence
<400>3
uacccuguag aaccgaauuu gug 23
<210>4
<211>22
<212>RNA
<213> Artificial sequence
<400>4
uagcuuauca gacugauguu ga 22
<210>5
<211>24
<212>RNA
<213> Artificial sequence
<400>5
uuaaugcuaa ucgugauagg gguu 24
<210>6
<211>21
<212>RNA
<213> Artificial sequence
<400>6
aucacauugc cagggauuuc c 21
<210>7
<211>22
<212>RNA
<213> Artificial sequence
<400>7
uagcaccauc ugaaaucggu ua 22
<210>8
<211>22
<212>RNA
<213> Artificial sequence
<400>8
uagcaccauc ugaaaucggu ua 22
<210>9
<211>23
<212>RNA
<213> Artificial sequence
<400>9
gaagugcuuc gauuuugggg ugu 23
<210>10
<211>1934
<212>DNA
<213> Artificial sequence
<400>10
gaattcgcca ccatgcgcta gataaccaaa gcgcagtagc cagatgtagc cagccctggc 60
aatgtgatat acaaattcgg ttctacaggg tcagcatttc agatggtgct atctcagtct 120
gataagcttt agctatcacg attagcatta tgcagacaat actattgcac tactaaaatc 180
gaagcacttc gctagataac caaagcgcag tagccagatg tagccagccc tggcaatgtg 240
atatacaaat tcggttctac agggtcagca tttcagatgg tgctatctca gtctgataag 300
ctttagctat cacgattagc attatgcaga caatactatt gcactactaa aatcgaagca 360
cttcgctaga taaccaaagc gcagtagcca gatgtagcca gccctggcaa tgtgatatac 420
aaattcggtt ctacagggtc agcatttcag atggtgctat ctcagtctga taagctttag 480
ctatcacgat tagcattatg cagacaatac tattgcacta ctaaaatcga agcacttcgc 540
tagataacca aagcgcagta gccagatgta gccagccctg gcaatgtgat atacaaattc 600
ggttctacag ggtcagcatt tcagatggtg ctatctcagt ctgataagct ttagctatca 660
cgattagcat tatgcagaca atactattgc actactaaaa tcgaagcact tcgctagata 720
accaaagcgc agtagccaga tgtagccagc cctggcaatg tgatatacaa attcggttct 780
acagggtcag catttcagat ggtgctatct cagtctgata agctttagct atcacgatta 840
gcattatgca gacaatacta ttgcactact aaaatcgaag cacttcgcta gataaccaaa 900
gcgcagtagc cagatgtagc cagccctggc aatgtgatat acaaattcgg ttctacaggg 960
tcagcatttc agatggtgct atctcagtct gataagcttt agctatcacg attagcatta 1020
tgcagacaat actattgcac tactaaaatc gaagcacttc gctagataac caaagcgcag 1080
tagccagatg tagccagccc tggcaatgtg atatacaaat tcggttctac agggtcagca 1140
tttcagatgg tgctatctca gtctgataag ctttagctat cacgattagc attatgcaga 1200
caatactatt gcactactaa aatcgaagca cttcgctaga taaccaaagc gcagtagcca 1260
gatgtagcca gccctggcaa tgtgatatac aaattcggtt ctacagggtc agcatttcag 1320
atggtgctat ctcagtctga taagctttag ctatcacgat tagcattatg cagacaatac 1380
tattgcacta ctaaaatcga agcacttcgc tagataacca aagcgcagta gccagatgta 1440
gccagccctg gcaatgtgat atacaaattc ggttctacag ggtcagcatt tcagatggtg 1500
ctatctcagt ctgataagct ttagctatca cgattagcat tatgcagaca atactattgc 1560
actactaaaa tcgaagcact tcgctagata accaaagcgc agtagccaga tgtagccagc 1620
cctggcaatg tgatatacaa attcggttct acagggtcag catttcagat ggtgctatct 1680
cagtctgata agctttagct atcacgatta gcattatgca gacaatacta ttgcactact 1740
aaaatcgaag cactttagta attcgagcaa cttgtttatt gcagcttata atggttacaa 1800
ataaagcaat agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg 1860
tggtttgtcc aaactcatca atgtatctta tcatgtctgg atcgtctagc atcgaagatc 1920
caaataaagt cgac 1934
<210>11
<211>34120
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<222>(454)..(454)
<223>n is a, c, g, or t
<400>11
ttcatcaata atatacctta ttttggattg aagccaatat gataatgagg gggtggagtt 60
tgtgacgtgg cgcggggcgt gggaacgggg cgggtgacgt agtagtgtgg cggaagtgtg 120
atgttgcaag tgtggcggaa cacatgtaag cgacggatgt ggcaaaagtg acgtttttgg 180
tgtgcgccgg tgtacacagg aagtgacaat tttcgcgcgg ttttaggcgg atgttgtagt 240
aaatttgggc gtaaccgagt aagatttggc cattttcgcg ggaaaactga ataagaggaa 300
gtgaaatctg aataattttg tgttactcat agcgcgtaat atttgtctag ggccgcgggg 360
actttgaccg tttacgtgga gactcgccca ggtgtttttc tcaggtgttt tccgcgttcc 420
gggtcaaagt tggcgtttta ttattatagt cagntctaga gatatactta ataggctgca 480
ggacttactg ttggtgggac gccctgcttt gcgaagggaa aggaggagtt tgccctgagc 540
acaggccccc accctccact gggctttccc cagctccctt gtcttcttat cacggtagtg 600
gcccagtccc tggcccctga ctccagaagg tggccctcct ggaaacccag gtcgtgcagt 660
caacgatgta ctcgccggga cagcgatgtc tgctgcactc catccctccc ctgttcattt 720
gtccttcatg cccgtctgga gtagatgctt tttgcagagg tggcaccctg taaagctctc 780
ctgtctgact tttttttttt ttttagactg agttttgctc ttgttgccta ggctggagtg 840
caatggcaca atctcagctc actgcaccct ctgcctcccg ggttcaagcg attctcctgc 900
ctcagcctcc cgagtagttg ggattacagg catgcaccac cacgcccagc taatttttgt 960
atttttagta gagacaaggt ttcaccgtga tggccaggct ggtcttgaac tccaggactc 1020
aagtgatgct cctgcctagg cctctcaaag tgttgggatt acaggcgtga gccactgcac 1080
ccggcctgca cgcgttcttt gaaagcagtc gagggggcgc taggtgtggg cagggacgag 1140
ctggcgcggc gtcgctgggt gcaccgcgac cacgggcaga gccacgcggc gggaggacta 1200
caactcccgg cacaccccgc gccgccccgc ctctactccc agaaggccgc ggggggtgga 1260
ccgcctaaga gggcgtgcgc tcccgacatg ccccgcggcg cgccattaac cgccagattt 1320
gaatcgcggc gaggatccac tagtgattta aatctcgaga attcggtacc gctagccatg 1380
gacgcgttaa ccggtgatat cgatagatct caccatgaga catattatct gccacggagg 1440
tgttattacc gaagaaatgg ccgccagtct tttggaccag ctgatcgaag aggtactggc 1500
tgataatctt ccacctccta gccattttga accacctacc cttcacgaac tgtatgattt 1560
agacgtgacg gcccccgaag atcccaacga ggaggcggtt tcgcagattt ttcccgactc 1620
tgtaatgttg gcggtgcagg aagggattga cttactcact tttccgccgg cgcccggttc 1680
tccggagccg cctcaccttt cccggcagcc cgagcagccg gagcagagag ccttgggtcc 1740
ggtttctatg ccaaaccttg taccggaggt gatcgatctt acctgccacg aggctggctt 1800
tccacccagt gacgacgagg atgaagaggg tgaggagttt gtgttagatt atgtggagca 1860
ccccgggcac ggttgcaggt cttgtcatta tcaccggagg aatacggggg acccagatat 1920
tatgtgttcg ctttgctata tgaggacctg tggcatgttt gtctacagta agtgaaaatt 1980
atgggcagtg ggtgatagag tggtgggttt ggtgtggtaa tttttttttt aatttttaca 2040
gttttgtggt ttaaagaatt ttgtattgtg atttttttaa aaggtcctgt gtctgaacct 2100
gagcctgagc ccgagccaga accggagcct gcaagaccta cccgccgtcc taaaatggcg 2160
cctgctatcc tgagacgccc gacatcacct gtgtctagag aatgcaatag tagtacggat 2220
agctgtgact ccggtccttc taacacacct cctgagatac acccggtggt cccgctgtgc 2280
cccattaaac cagttgccgt gagagttggt gggcgtcgcc aggctgtgga atgtatcgag 2340
gacttgctta acgagcctgg gcaacctttg gacttgagct gtaaacgccc caggccataa 2400
gtcgacgcgg ccgcaagctt ctagagttcg agcaacttgt ttattgcagc ttataatggt 2460
tacaaataaa gcaatagcat cacaaatttc acaaataaag catttttttc actgcattct 2520
agttgtggtt tgtccaaact catcaatgta tcttatcatg tctggatcgt ctagcatcga 2580
agatccaata acttcgtata gcatacatta tacgaagtta taagtactga attcggatct 2640
gggcgtggtt aagggtggga aagaatatat aaggtggggg tcttatgtag ttttgtatct 2700
gttttgcagc agccgccgcc gccatgagca ccaactcgtt tgatggaagc attgtgagct 2760
catatttgac aacgcgcatg cccccatggg ccggggtgcg tcagaatgtg atgggctcca 2820
gcattgatgg tcgccccgtc ctgcccgcaa actctactac cttgacctac gagaccgtgt 2880
ctggaacgcc gttggagact gcagcctccg ccgccgcttc agccgctgca gccaccgccc 2940
gcgggattgt gactgacttt gctttcctga gcccgcttgc aagcagtgca gcttcccgtt 3000
catccgcccg cgatgacaag ttgacggctc ttttggcaca attggattct ttgacccggg 3060
aacttaatgt cgtttctcag cagctgttgg atctgcgcca gcaggtttct gccctgaagg 3120
cttcctcccc tcccaatgcg gtttaaaaca taaataaaaa accagactct gtttggattt 3180
ggatcaagca agtgtcttgc tgtctttatt taggggtttt gcgcgcgcgg taggcccggg 3240
accagcggtc tcggtcgttg agggtcctgt gtattttttc caggacgtgg taaaggtgac 3300
tctggatgtt cagatacatg ggcataagcc cgtctctggg gtggaggtag caccactgca 3360
gagcttcatg ctgcggggtg gtgttgtaga tgatccagtc gtagcaggag cgctgggcgt 3420
ggtgcctaaa aatgtctttc agtagcaagc tgattgccag gggcaggccc ttggtgtaag 3480
tgtttacaaa gcggttaagc tgggatgggt gcatacgtgg ggatatgaga tgcatcttgg 3540
actgtatttt taggttggct atgttcccag ccatatccct ccggggattc atgttgtgca 3600
gaaccaccag cacagtgtat ccggtgcact tgggaaattt gtcatgtagc ttagaaggaa 3660
atgcgtggaa gaacttggag acgcccttgt gacctccaag attttccatg cattcgtcca 3720
taatgatggc aatgggccca cgggcggcgg cctgggcgaa gatatttctg ggatcactaa 3780
cgtcatagtt gtgttccagg atgagatcgt cataggccat ttttacaaag cgcgggcgga 3840
gggtgccaga ctgcggtata atggttccat ccggcccagg ggcgtagtta ccctcacaga 3900
tttgcatttc ccacgctttg agttcagatg gggggatcat gtctacctgc ggggcgatga 3960
agaaaacggt ttccggggta ggggagatca gctgggaaga aagcaggttc ctgagcagct 4020
gcgacttacc gcagccggtg ggcccgtaaa tcacacctat taccgggtgc aactggtagt 4080
taagagagct gcagctgccg tcatccctga gcaggggggc cacttcgtta agcatgtccc 4140
tgactcgcat gttttccctg accaaatccg ccagaaggcg ctcgccgccc agcgatagca 4200
gttcttgcaa ggaagcaaag tttttcaacg gtttgagacc gtccgccgta ggcatgcttt 4260
tgagcgtttg accaagcagt tccaggcggt cccacagctc ggtcacctgc tctacggcat 4320
ctcgatccag catatctcct cgtttcgcgg gttggggcgg ctttcgctgt acggcagtag 4380
tcggtgctcg tccagacggg ccagggtcat gtctttccac gggcgcaggg tcctcgtcag 4440
cgtagtctgg gtcacggtga aggggtgcgc tccgggctgc gcgctggcca gggtgcgctt 4500
gaggctggtc ctgctggtgc tgaagcgctg ccggtcttcg ccctgcgcgt cggccaggta 4560
gcatttgacc atggtgtcat agtccagccc ctccgcggcg tggcccttgg cgcgcagctt 4620
gcccttggag gaggcgccgc acgaggggca gtgcagactt ttgagggcgt agagcttggg 4680
cgcgagaaat accgattccg gggagtaggc atccgcgccg caggccccgc agacggtctc 4740
gcattccacg agccaggtga gctctggccg ttcggggtca aaaaccaggt ttcccccatg 4800
ctttttgatg cgtttcttac ctctggtttc catgagccgg tgtccacgct cggtgacgaa 4860
aaggctgtcc gtgtccccgt atacagactt gagaggcctg tcctcgagcg gtgttccgcg 4920
gtcctcctcg tatagaaact cggaccactc tgagacaaag gctcgcgtcc aggccagcac 4980
gaaggaggct aagtgggagg ggtagcggtc gttgtccact agggggtcca ctcgctccag 5040
ggtgtgaaga cacatgtcgc cctcttcggc atcaaggaag gtgattggtt tgtaggtgta 5100
ggccacgtga ccgggtgttc ctgaaggggg gctataaaag ggggtggggg cgcgttcgtc 5160
ctcactctct tccgcatcgc tgtctgcgag ggccagctgt tggggtgagt actccctctg 5220
aaaagcgggc atgacttctg cgctaagatt gtcagtttcc aaaaacgagg aggatttgat 5280
attcacctgg cccgcggtga tgcctttgag ggtggccgca tccatctggt cagaaaagac 5340
aatctttttg ttgtcaagct tggtggcaaa cgacccgtag agggcgttgg acagcaactt 5400
ggcgatggag cgcagggttt ggtttttgtc gcgatcggcg cgctccttgg ccgcgatgtt 5460
tagctgcacg tattcgcgcg caacgcaccg ccattcggga aagacggtgg tgcgctcgtc 5520
gggcaccagg tgcacgcgcc aaccgcggtt gtgcagggtg acaaggtcaa cgctggtggc 5580
tacctctccg cgtaggcgct cgttggtcca gcagaggcgg ccgcccttgc gcgagcagaa 5640
tggcggtagg gggtctagct gcgtctcgtc cggggggtct gcgtccacgg taaagacccc 5700
gggcagcagg cgcgcgtcga agtagtctat cttgcatcct tgcaagtcta gcgcctgctg 5760
ccatgcgcgg gcggcaagcg cgcgctcgta tgggttgagt gggggacccc atggcatggg 5820
gtgggtgagc gcggaggcgt acatgccgca aatgtcgtaa acgtagaggg gctctctgag 5880
tattccaaga tatgtagggt agcatcttcc accgcggatg ctggcgcgca cgtaatcgta 5940
tagttcgtgc gagggagcga ggaggtcggg accgaggttg ctacgggcgg gctgctctgc 6000
tcggaagact atctgcctga agatggcatg tgagttggat gatatggttg gacgctggaa 6060
gacgttgaag ctggcgtctg tgagacctac cgcgtcacgc acgaaggagg cgtaggagtc 6120
gcgcagcttg ttgaccagct cggcggtgac ctgcacgtct agggcgcagt agtccagggt 6180
ttccttgatg atgtcatact tatcctgtcc cttttttttc cacagctcgc ggttgaggac 6240
aaactcttcg cggtctttcc agtactcttg gatcggaaac ccgtcggcct ccgaacggta 6300
agagcctagc atgtagaact ggttgacggc ctggtaggcg cagcatccct tttctacggg 6360
tagcgcgtat gcctgcgcgg ccttccggag cgaggtgtgg gtgagcgcaa aggtgtccct 6420
gaccatgact ttgaggtact ggtatttgaa gtcagtgtcg tcgcatccgc cctgctccca 6480
gagcaaaaag tccgtgcgct ttttggaacg cggatttggc agggcgaagg tgacatcgtt 6540
gaagagtatc tttcccgcgc gaggcataaa gttgcgtgtg atgcggaagg gtcccggcac 6600
ctcggaacgg ttgttaatta cctgggcggc gagcacgatc tcgtcaaagc cgttgatgtt 6660
gtggcccaca atgtaaagtt ccaagaagcg cgggatgccc ttgatggaag gcaatttttt 6720
aagttcctcg taggtgagct cttcagggga gctgagcccg tgctctgaaa gggcccagtc 6780
tgcaagatga gggttggaag cgacgaatga gctccacagg tcacgggcca ttagcatttg 6840
caggtggtcg cgaaaggtcc taaactggcg acctatggcc attttttctg gggtgatgca 6900
gtagaaggta agcgggtctt gttcccagcg gtcccatcca aggttcgcgg ctaggtctcg 6960
cgcggcagtc actagaggct catctccgcc gaacttcatg accagcatga agggcacgag 7020
ctgcttccca aaggccccca tccaagtata ggtctctaca tcgtaggtga caaagagacg 7080
ctcggtgcga ggatgcgagc cgatcgggaa gaactggatc tcccgccacc aattggagga 7140
gtggctattg atgtggtgaa agtagaagtc cctgcgacgg gccgaacact cgtgctggct 7200
tttgtaaaaa cgtgcgcagt actggcagcg gtgcacgggc tgtacatcct gcacgaggtt 7260
gacctgacga ccgcgcacaa ggaagcagag tgggaatttg agcccctcgc ctggcgggtt 7320
tggctggtgg tcttctactt cggctgcttg tccttgaccg tctggctgct cgaggggagt 7380
tacggtggat cggaccacca cgccgcgcga gcccaaagtc cagatgtccg cgcgcggcgg 7440
tcggagcttg atgacaacat cgcgcagatg ggagctgtcc atggtctgga gctcccgcgg 7500
cgtcaggtca ggcgggagct cctgcaggtt tacctcgcat agacgggtca gggcgcgggc 7560
tagatccagg tgatacctaa tttccagggg ctggttggtg gcggcgtcga tggcttgcaa 7620
gaggccgcat ccccgcggcg cgactacggt accgcgcggc gggcggtggg ccgcgggggt 7680
gtccttggat gatgcatcta aaagcggtga cgcgggcgag cccccggagg tagggggggc 7740
tccggacccg ccgggagagg gggcaggggc acgtcggcgc cgcgcgcggg caggagctgg 7800
tgctgcgcgc gtaggttgct ggcgaacgcg acgacgcggc ggttgatctc ctgaatctgg 7860
cgcctctgcg tgaagacgac gggcccggtg agcttgagcc tgaaagagag ttcgacagaa 7920
tcaatttcgg tgtcgttgac ggcggcctgg cgcaaaatct cctgcacgtc tcctgagttg 7980
tcttgatagg cgatctcggc catgaactgc tcgatctctt cctcctggag atctccgcgt 8040
ccggctcgct ccacggtggc ggcgaggtcg ttggaaatgc gggccatgag ctgcgagaag 8100
gcgttgaggc ctccctcgtt ccagacgcgg ctgtagacca cgcccccttc ggcatcgcgg 8160
gcgcgcatga ccacctgcgc gagattgagc tccacgtgcc gggcgaagac ggcgtagttt 8220
cgcaggcgct gaaagaggta gttgagggtg gtggcggtgt gttctgccac gaagaagtac 8280
ataacccagc gtcgcaacgt ggattcgttg atatccccca aggcctcaag gcgctccatg 8340
gcctcgtaga agtccacggc gaagttgaaa aactgggagt tgcgcgccga cacggttaac 8400
tcctcctcca gaagacggat gagctcggcg acagtgtcgc gcacctcgcg ctcaaaggct 8460
acaggggcct cttcttcttc ttcaatctcc tcttccataa gggcctcccc ttcttcttct 8520
tctggcggcg gtgggggagg ggggacacgg cggcgacgac ggcgcaccgg gaggcggtcg 8580
acaaagcgct cgatcatctc cccgcggcga cggcgcatgg tctcggtgac ggcgcggccg 8640
ttctcgcggg ggcgcagttg gaagacgccg cccgtcatgt cccggttatg ggttggcggg 8700
gggctgccat gcggcaggga tacggcgcta acgatgcatc tcaacaattg ttgtgtaggt 8760
actccgccgc cgagggacct gagcgagtcc gcatcgaccg gatcggaaaa cctctcgaga 8820
aaggcgtcta accagtcaca gtcgcaaggt aggctgagca ccgtggcggg cggcagcggg 8880
cggcggtcgg ggttgtttct ggcggaggtg ctgctgatga tgtaattaaa gtaggcggtc 8940
ttgagacggc ggatggtcga cagaagcacc atgtccttgg gtccggcctg ctgaatgcgc 9000
aggcggtcgg ccatgcccca ggcttcgttt tgacatcggc gcaggtcttt gtagtagtct 9060
tgcatgagcc tttctaccgg cacttcttct tctccttcct cttgtcctgc atctcttgca 9120
tctatcgctg cggcggcggc ggagtttggc cgtaggtggc gccctcttcc tcccatgcgt 9180
gtgaccccga agcccctcat cggctgaagc agggctaggt cggcgacaac gcgctcggct 9240
aatatggcct gctgcacctg cgtgagggta gactggaagt catccatgtc cacaaagcgg 9300
tggtatgcgc ccgtgttgat ggtgtaagtg cagttggcca taacggacca gttaacggtc 9360
tggtgacccg gctgcgagag ctcggtgtac ctgagacgcg agtaagccct cgagtcaaat 9420
acgtagtcgt tgcaagtccg caccaggtac tggtatccca ccaaaaagtg cggcggcggc 9480
tggcggtaga ggggccagcg tagggtggcc ggggctccgg gggcgagatc ttccaacata 9540
aggcgatgat atccgtagat gtacctggac atccaggtga tgccggcggc ggtggtggag 9600
gcgcgcggaa agtcgcggac gcggttccag atgttgcgca gcggcaaaaa gtgctccatg 9660
gtcgggacgc tctggccggt caggcgcgcg caatcgttga cgctctaccg tgcaaaagga 9720
gagcctgtaa gcgggcactc ttccgtggtc tggtggataa attcgcaagg gtatcatggc 9780
ggacgaccgg ggttcgagcc ccgtatccgg ccgtccgccg tgatccatgc ggttaccgcc 9840
cgcgtgtcga acccaggtgt gcgacgtcag acaacggggg agtgctcctt ttggcttcct 9900
tccaggcgcg gcggctgctg cgctagcttt tttggccact ggccgcgcgc agcgtaagcg 9960
gttaggctgg aaagcgaaag cattaagtgg ctcgctccct gtagccggag ggttattttc 10020
caagggttga gtcgcgggac ccccggttcg agtctcggac cggccggact gcggcgaacg 10080
ggggtttgcc tccccgtcat gcaagacccc gcttgcaaat tcctccggaa acagggacga 10140
gccccttttt tgcttttccc agatgcatcc ggtgctgcgg cagatgcgcc cccctcctca 10200
gcagcggcaa gagcaagagc agcggcagac atgcagggca ccctcccctc ctcctaccgc 10260
gtcaggaggg gcgacatccg cggttgacgc ggcagcagat ggtgattacg aacccccgcg 10320
gcgccgggcc cggcactacc tggacttgga ggagggcgag ggcctggcgc ggctaggagc 10380
gccctctcct gagcggtacc caagggtgca gctgaagcgt gatacgcgtg aggcgtacgt 10440
gccgcggcag aacctgtttc gcgaccgcga gggagaggag cccgaggaga tgcgggatcg 10500
aaagttccac gcagggcgcg agctgcggca tggcctgaat cgcgagcggt tgctgcgcga 10560
ggaggacttt gagcccgacg cgcgaaccgg gattagtccc gcgcgcgcac acgtggcggc 10620
cgccgacctg gtaaccgcat acgagcagac ggtgaaccag gagattaact ttcaaaaaag 10680
ctttaacaac cacgtgcgta cgcttgtggc gcgcgaggag gtggctatag gactgatgca 10740
tctgtgggac tttgtaagcg cgctggagca aaacccaaat agcaagccgc tcatggcgca 10800
gctgttcctt atagtgcagc acagcaggga caacgaggca ttcagggatg cgctgctaaa 10860
catagtagag cccgagggcc gctggctgct cgatttgata aacatcctgc agagcatagt 10920
ggtgcaggag cgcagcttga gcctggctga caaggtggcc gccatcaact attccatgct 10980
tagcctgggc aagttttacg cccgcaagat ataccatacc ccttacgttc ccatagacaa 11040
ggaggtaaag atcgaggggt tctacatgcg catggcgctg aaggtgctta ccttgagcga 11100
cgacctgggc gtttatcgca acgagcgcat ccacaaggcc gtgagcgtga gccggcggcg 11160
cgagctcagc gaccgcgagc tgatgcacag cctgcaaagg gccctggctg gcacgggcag 11220
cggcgataga gaggccgagt cctactttga cgcgggcgct gacctgcgct gggccccaag 11280
ccgacgcgcc ctggaggcag ctggggccgg acctgggctg gcggtggcac ccgcgcgcgc 11340
tggcaacgtc ggcggcgtgg aggaatatga cgaggacgat gagtacgagc cagaggacgg 11400
cgagtactaa gcggtgatgt ttctgatcag atgatgcaag acgcaacgga cccggcggtg 11460
cgggcggcgc tgcagagcca gccgtccggc cttaactcca cggacgactg gcgccaggtc 11520
atggaccgca tcatgtcgct gactgcgcgc aatcctgacg cgttccggca gcagccgcag 11580
gccaaccggc tctccgcaat tctggaagcg gtggtcccgg cgcgcgcaaa ccccacgcac 11640
gagaaggtgc tggcgatcgt aaacgcgctg gccgaaaaca gggccatccg gcccgacgag 11700
gccggcctgg tctacgacgc gctgcttcag cgcgtggctc gttacaacag cggcaacgtg 11760
cagaccaacc tggaccggct ggtgggggat gtgcgcgagg ccgtggcgca gcgtgagcgc 11820
gcgcagcagc agggcaacct gggctccatg gttgcactaa acgccttcct gagtacacag 11880
cccgccaacg tgccgcgggg acaggaggac tacaccaact ttgtgagcgc actgcggcta 11940
atggtgactg agacaccgca aagtgaggtg taccagtctg ggccagacta ttttttccag 12000
accagtagac aaggcctgca gaccgtaaac ctgagccagg ctttcaaaaa cttgcagggg 12060
ctgtgggggg tgcgggctcc cacaggcgac cgcgcgaccg tgtctagctt gctgacgccc 12120
aactcgcgcc tgttgctgct gctaatagcg cccttcacgg acagtggcag cgtgtcccgg 12180
gacacatacc taggtcactt gctgacactg taccgcgagg ccataggtca ggcgcatgtg 12240
gacgagcata ctttccagga gattacaagt gtcagccgcg cgctggggca ggaggacacg 12300
ggcagcctgg aggcaaccct aaactacctg ctgaccaacc ggcggcagaa gatcccctcg 12360
ttgcacagtt taaacagcga ggaggagcgc attttgcgct acgtgcagca gagcgtgagc 12420
cttaacctga tgcgcgacgg ggtaacgccc agcgtggcgc tggacatgac cgcgcgcaac 12480
atggaaccgg gcatgtatgc ctcaaaccgg ccgtttatca accgcctaat ggactacttg 12540
catcgcgcgg ccgccgtgaa ccccgagtat ttcaccaatg ccatcttgaa cccgcactgg 12600
ctaccgcccc ctggtttcta caccggggga ttcgaggtgc ccgagggtaa cgatggattc 12660
ctctgggacg acatagacga cagcgtgttt tccccgcaac cgcagaccct gctagagttg 12720
caacagcgcg agcaggcaga ggcggcgctg cgaaaggaaa gcttccgcag gccaagcagc 12780
ttgtccgatc taggcgctgc ggccccgcgg tcagatgcta gtagcccatt tccaagcttg 12840
atagggtctc ttaccagcac tcgcaccacc cgcccgcgcc tgctgggcga ggaggagtac 12900
ctaaacaact cgctgctgca gccgcagcgc gaaaaaaacc tgcctccggc atttcccaac 12960
aacgggatag agagcctagt ggacaagatg agtagatgga agacgtacgc gcaggagcac 13020
agggacgtgc caggcccgcg cccgcccacc cgtcgtcaaa ggcacgaccg tcagcggggt 13080
ctggtgtggg aggacgatga ctcggcagac gacagcagcg tcctggattt gggagggagt 13140
ggcaacccgt ttgcgcacct tcgccccagg ctggggagaa tgttttaaaa aaaaaaaagc 13200
atgatgcaaa ataaaaaact caccaaggcc atggcaccga gcgttggttt tcttgtattc 13260
cccttagtat gcggcgcgcg gcgatgtatg aggaaggtcc tcctccctcc tacgagagtg 13320
tggtgagcgc ggcgccagtg gcggcggcgc tgggttctcc cttcgatgct cccctggacc 13380
cgccgtttgt gcctccgcgg tacctgcggc ctaccggggg gagaaacagc atccgttact 13440
ctgagttggc acccctattc gacaccaccc gtgtgtacct ggtggacaac aagtcaacgg 13500
atgtggcatc cctgaactac cagaacgacc acagcaactt tctgaccacg gtcattcaaa 13560
acaatgacta cagcccgggg gaggcaagca cacagaccat caatcttgac gaccggtcgc 13620
actggggcgg cgacctgaaa accatcctgc ataccaacat gccaaatgtg aacgagttca 13680
tgtttaccaa taagtttaag gcgcgggtga tggtgtcgcg cttgcctact aaggacaatc 13740
aggtggagct gaaatacgag tgggtggagt tcacgctgcc cgagggcaac tactccgaga 13800
ccatgaccat agaccttatg aacaacgcga tcgtggagca ctacttgaaa gtgggcagac 13860
agaacggggt tctggaaagc gacatcgggg taaagtttga cacccgcaac ttcagactgg 13920
ggtttgaccc cgtcactggt cttgtcatgc ctggggtata tacaaacgaa gccttccatc 13980
cagacatcat tttgctgcca ggatgcgggg tggacttcac ccacagccgc ctgagcaact 14040
tgttgggcat ccgcaagcgg caacccttcc aggagggctt taggatcacc tacgatgatc 14100
tggagggtgg taacattccc gcactgttgg atgtggacgc ctaccaggcg agcttgaaag 14160
atgacaccga acagggcggg ggtggcgcag gcggcagcaa cagcagtggc agcggcgcgg 14220
aagagaactc caacgcggca gccgcggcaa tgcagccggt ggaggacatg aacgatcatg 14280
ccattcgcgg cgacaccttt gccacacggg ctgaggagaa gcgcgctgag gccgaagcag 14340
cggccgaagc tgccgccccc gctgcgcaac ccgaggtcga gaagcctcag aagaaaccgg 14400
tgatcaaacc cctgacagag gacagcaaga aacgcagtta caacctaata agcaatgaca 14460
gcaccttcac ccagtaccgc agctggtacc ttgcatacaa ctacggcgac cctcagaccg 14520
gaatccgctc atggaccctg ctttgcactc ctgacgtaac ctgcggctcg gagcaggtct 14580
actggtcgtt gccagacatg atgcaagacc ccgtgacctt ccgctccacg cgccagatca 14640
gcaactttcc ggtggtgggc gccgagctgt tgcccgtgca ctccaagagc ttctacaacg 14700
accaggccgt ctactcccaa ctcatccgcc agtttacctc tctgacccac gtgttcaatc 14760
gctttcccga gaaccagatt ttggcgcgcc cgccagcccc caccatcacc accgtcagtg 14820
aaaacgttcc tgctctcaca gatcacggga cgctaccgct gcgcaacagc atcggaggag 14880
tccagcgagt gaccattact gacgccagac gccgcacctg cccctacgtt tacaaggccc 14940
tgggcatagt ctcgccgcgc gtcctatcga gccgcacttt ttgagcaagc atgtccatcc 15000
ttatatcgcc cagcaataac acaggctggg gcctgcgctt cccaagcaag atgtttggcg 15060
gggccaagaa gcgctccgac caacacccag tgcgcgtgcg cgggcactac cgcgcgccct 15120
ggggcgcgca caaacgcggc cgcactgggc gcaccaccgt cgatgacgcc atcgacgcgg 15180
tggtggagga ggcgcgcaac tacacgccca cgccgccacc agtgtccaca gtggacgcgg 15240
ccattcagac cgtggtgcgc ggagcccggc gctatgctaa aatgaagaga cggcggaggc 15300
gcgtagcacg tcgccaccgc cgccgacccg gcactgccgc ccaacgcgcg gcggcggccc 15360
tgcttaaccg cgcacgtcgc accggccgac gggcggccat gcgggccgct cgaaggctgg 15420
ccgcgggtat tgtcactgtg ccccccaggt ccaggcgacg agcggccgcc gcagcagccg 15480
cggccattag tgctatgact cagggtcgca ggggcaacgt gtattgggtg cgcgactcgg 15540
ttagcggcct gcgcgtgccc gtgcgcaccc gccccccgcg caactagatt gcaagaaaaa 15600
actacttaga ctcgtactgt tgtatgtatc cagcggcggc ggcgcgcaac gaagctatgt 15660
ccaagcgcaa aatcaaagaa gagatgctcc aggtcatcgc gccggagatc tatggccccc 15720
cgaagaagga agagcaggat tacaagcccc gaaagctaaa gcgggtcaaa aagaaaaaga 15780
aagatgatga tgatgaactt gacgacgagg tggaactgct gcacgctacc gcgcccaggc 15840
gacgggtaca gtggaaaggt cgacgcgtaa aacgtgtttt gcgacccggc accaccgtag 15900
tctttacgcc cggtgagcgc tccacccgca cctacaagcg cgtgtatgat gaggtgtacg 15960
gcgacgagga cctgcttgag caggccaacg agcgcctcgg ggagtttgcc tacggaaagc 16020
ggcataagga catgctggcg ttgccgctgg acgagggcaa cccaacacct agcctaaagc 16080
ccgtaacact gcagcaggtg ctgcccgcgc ttgcaccgtc cgaagaaaag cgcggcctaa 16140
agcgcgagtc tggtgacttg gcacccaccg tgcagctgat ggtacccaag cgccagcgac 16200
tggaagatgt cttggaaaaa atgaccgtgg aacctgggct ggagcccgag gtccgcgtgc 16260
ggccaatcaa gcaggtggcg ccgggactgg gcgtgcagac cgtggacgtt cagataccca 16320
ctaccagtag caccagtatt gccaccgcca cagagggcat ggagacacaa acgtccccgg 16380
ttgcctcagc ggtggcggat gccgcggtgc aggcggtcgc tgcggccgcg tccaagacct 16440
ctacggaggt gcaaacggac ccgtggatgt ttcgcgtttc agccccccgg cgcccgcgcg 16500
gttcgaggaa gtacggcgcc gccagcgcgc tactgcccga atatgcccta catccttcca 16560
ttgcgcctac ccccggctat cgtggctaca cctaccgccc cagaagacga gcaactaccc 16620
gacgccgaac caccactgga acccgccgcc gccgtcgccg tcgccagccc gtgctggccc 16680
cgatttccgt gcgcagggtg gctcgcgaag gaggcaggac cctggtgctg ccaacagcgc 16740
gctaccaccc cagcatcgtt taaaagccgg tctttgtggt tcttgcagat atggccctca 16800
cctgccgcct ccgtttcccg gtgccgggat tccgaggaag aatgcaccgt aggaggggca 16860
tggccggcca cggcctgacg ggcggcatgc gtcgtgcgca ccaccggcgg cggcgcgcgt 16920
cgcaccgtcg catgcgcggc ggtatcctgc ccctccttat tccactgatc gccgcggcga 16980
ttggcgccgt gcccggaatt gcatccgtgg ccttgcaggc gcagagacac tgattaaaaa 17040
caagttgcat gtggaaaaat caaaataaaa agtctggact ctcacgctcg cttggtcctg 17100
taactatttt gtagaatgga agacatcaac tttgcgtctc tggccccgcg acacggctcg 17160
cgcccgttca tgggaaactg gcaagatatc ggcaccagca atatgagcgg tggcgccttc 17220
agctggggct cgctgtggag cggcattaaa aatttcggtt ccaccgttaa gaactatggc 17280
agcaaggcct ggaacagcag cacaggccag atgctgaggg ataagttgaa agagcaaaat 17340
ttccaacaaa aggtggtaga tggcctggcc tctggcatta gcggggtggt ggacctggcc 17400
aaccaggcag tgcaaaataa gattaacagt aagcttgatc cccgccctcc cgtagaggag 17460
cctccaccgg ccgtggagac agtgtctcca gaggggcgtg gcgaaaagcg tccgcgcccc 17520
gacagggaag aaactctggt gacgcaaata gacgagcctc cctcgtacga ggaggcacta 17580
aagcaaggcc tgcccaccac ccgtcccatc gcgcccatgg ctaccggagt gctgggccag 17640
cacacacccg taacgctgga cctgcctccc cccgccgaca cccagcagaa acctgtgctg 17700
ccaggcccga ccgccgttgt tgtaacccgt cctagccgcg cgtccctgcg ccgcgccgcc 17760
agcggtccgc gatcgttgcg gcccgtagcc agtggcaact ggcaaagcac actgaacagc 17820
atcgtgggtc tgggggtgca atccctgaag cgccgacgat gcttctgaat agctaacgtg 17880
tcgtatgtgt gtcatgtatg cgtccatgtc gccgccagag gagctgctga gccgccgcgc 17940
gcccgctttc caagatggct accccttcga tgatgccgca gtggtcttac atgcacatct 18000
cgggccagga cgcctcggag tacctgagcc ccgggctggt gcagtttgcc cgcgccaccg 18060
agacgtactt cagcctgaat aacaagttta gaaaccccac ggtggcgcct acgcacgacg 18120
tgaccacaga ccggtcccag cgtttgacgc tgcggttcat ccctgtggac cgtgaggata 18180
ctgcgtactc gtacaaggcg cggttcaccc tagctgtggg tgataaccgt gtgctggaca 18240
tggcttccac gtactttgac atccgcggcg tgctggacag gggccctact tttaagccct 18300
actctggcac tgcctacaac gccctggctc ccaagggtgc cccaaatcct tgcgaatggg 18360
atgaagctgc tactgctctt gaaataaacc tagaagaaga ggacgatgac aacgaagacg 18420
aagtagacga gcaagctgag cagcaaaaaa ctcacgtatt tgggcaggcg ccttattctg 18480
gtataaatat tacaaaggag ggtattcaaa taggtgtcga aggtcaaaca cctaaatatg 18540
ccgataaaac atttcaacct gaacctcaaa taggagaatc tcagtggtac gaaactgaaa 18600
ttaatcatgc agctgggaga gtccttaaaa agactacccc aatgaaacca tgttacggtt 18660
catatgcaaa acccacaaat gaaaatggag ggcaaggcat tcttgtaaag caacaaaatg 18720
gaaagctaga aagtcaagtg gaaatgcaat ttttctcaac tactgaggcg accgcaggca 18780
atggtgataa cttgactcct aaagtggtat tgtacagtga agatgtagat atagaaaccc 18840
cagacactca tatttcttac atgcccacta ttaaggaagg taactcacga gaactaatgg 18900
gccaacaatc tatgcccaac aggcctaatt acattgcttt tagggacaat tttattggtc 18960
taatgtatta caacagcacg ggtaatatgg gtgttctggc gggccaagca tcgcagttga 19020
atgctgttgt agatttgcaa gacagaaaca cagagctttc ataccagctt ttgcttgatt 19080
ccattggtga tagaaccagg tacttttcta tgtggaatca ggctgttgac agctatgatc 19140
cagatgttag aattattgaa aatcatggaa ctgaagatga acttccaaat tactgctttc 19200
cactgggagg tgtgattaat acagagactc ttaccaaggt aaaacctaaa acaggtcagg 19260
aaaatggatg ggaaaaagat gctacagaat tttcagataa aaatgaaata agagttggaa 19320
ataattttgc catggaaatc aatctaaatg ccaacctgtg gagaaatttc ctgtactcca 19380
acatagcgct gtatttgccc gacaagctaa agtacagtcc ttccaacgta aaaatttctg 19440
ataacccaaa cacctacgac tacatgaaca agcgagtggt ggctcccggg ttagtggact 19500
gctacattaa ccttggagca cgctggtccc ttgactatat ggacaacgtc aacccattta 19560
accaccaccg caatgctggc ctgcgctacc gctcaatgtt gctgggcaat ggtcgctatg 19620
tgcccttcca catccaggtg cctcagaagt tctttgccat taaaaacctc cttctcctgc 19680
cgggctcata cacctacgag tggaacttca ggaaggatgt taacatggtt ctgcagagct 19740
ccctaggaaa tgacctaagg gttgacggag ccagcattaa gtttgatagc atttgccttt 19800
acgccacctt cttccccatg gcccacaaca ccgcctccac gcttgaggcc atgcttagaa 19860
acgacaccaa cgaccagtcc tttaacgact atctctccgc cgccaacatg ctctacccta 19920
tacccgccaa cgctaccaac gtgcccatat ccatcccctc ccgcaactgg gcggctttcc 19980
gcggctgggc cttcacgcgc cttaagacta aggaaacccc atcactgggc tcgggctacg 20040
acccttatta cacctactct ggctctatac cctacctaga tggaaccttt tacctcaacc 20100
acacctttaa gaaggtggcc attacctttg actcttctgt cagctggcct ggcaatgacc 20160
gcctgcttac ccccaacgag tttgaaatta agcgctcagt tgacggggag ggttacaacg 20220
ttgcccagtg taacatgacc aaagactggt tcctggtaca aatgctagct aactacaaca 20280
ttggctacca gggcttctat atcccagaga gctacaagga ccgcatgtac tccttcttta 20340
gaaacttcca gcccatgagc cgtcaggtgg tggatgatac taaatacaag gactaccaac 20400
aggtgggcat cctacaccaa cacaacaact ctggatttgt tggctacctt gcccccacca 20460
tgcgcgaagg acaggcctac cctgctaact tcccctatcc gcttataggc aagaccgcag 20520
ttgacagcat tacccagaaa aagtttcttt gcgatcgcac cctttggcgc atcccattct 20580
ccagtaactt tatgtccatg ggcgcactca cagacctggg ccaaaacctt ctctacgcca 20640
actccgccca cgcgctagac atgacttttg aggtggatcc catggacgag cccacccttc 20700
tttatgtttt gtttgaagtc tttgacgtgg tccgtgtgca ccggccgcac cgcggcgtca 20760
tcgaaaccgt gtacctgcgc acgcccttct cggccggcaa cgccacaaca taaagaagca 20820
agcaacatca acaacagctg ccgccatggg ctccagtgag caggaactga aagccattgt 20880
caaagatctt ggttgtgggc catatttttt gggcacctat gacaagcgct ttccaggctt 20940
tgtttctcca cacaagctcg cctgcgccat agtcaatacg gccggtcgcg agactggggg 21000
cgtacactgg atggcctttg cctggaaccc gcactcaaaa acatgctacc tctttgagcc 21060
ctttggcttt tctgaccagc gactcaagca ggtttaccag tttgagtacg agtcactcct 21120
gcgccgtagc gccattgctt cttcccccga ccgctgtata acgctggaaa agtccaccca 21180
aagcgtacag gggcccaact cggccgcctg tggactattc tgctgcatgt ttctccacgc 21240
ctttgccaac tggccccaaa ctcccatgga tcacaacccc accatgaacc ttattaccgg 21300
ggtacccaac tccatgctca acagtcccca ggtacagccc accctgcgtc gcaaccagga 21360
acagctctac agcttcctgg agcgccactc gccctacttc cgcagccaca gtgcgcagat 21420
taggagcgcc acttcttttt gtcacttgaa aaacatgtaa aaataatgta ctagagacac 21480
tttcaataaa ggcaaatgct tttatttgta cactctcggg tgattattta cccccaccct 21540
tgccgtctgc gccgtttaaa aatcaaaggg gttctgccgc gcatcgctat gcgccactgg 21600
cagggacacg ttgcgatact ggtgtttagt gctccactta aactcaggca caaccatccg 21660
cggcagctcg gtgaagtttt cactccacag gctgcgcacc atcaccaacg cgtttagcag 21720
gtcgggcgcc gatatcttga agtcgcagtt ggggcctccg ccctgcgcgc gcgagttgcg 21780
atacacaggg ttgcagcact ggaacactat cagcgccggg tggtgcacgc tggccagcac 21840
gctcttgtcg gagatcagat ccgcgtccag gtcctccgcg ttgctcaggg cgaacggagt 21900
caactttggt agctgccttc ccaaaaaggg cgcgtgccca ggctttgagt tgcactcgca 21960
ccgtagtggc atcaaaaggt gaccgtgccc ggtctgggcg ttaggataca gcgcctgcat 22020
aaaagccttg atctgcttaa aagccacctg agcctttgcg ccttcagaga agaacatgcc 22080
gcaagacttg ccggaaaact gattggccgg acaggccgcg tcgtgcacgc agcaccttgc 22140
gtcggtgttg gagatctgca ccacatttcg gccccaccgg ttcttcacga tcttggcctt 22200
gctagactgc tccttcagcg cgcgctgccc gttttcgctc gtcacatcca tttcaatcac 22260
gtgctcctta tttatcataa tgcttccgtg tagacactta agctcgcctt cgatctcagc 22320
gcagcggtgc agccacaacg cgcagcccgt gggctcgtga tgcttgtagg tcacctctgc 22380
aaacgactgc aggtacgcct gcaggaatcg ccccatcatc gtcacaaagg tcttgttgct 22440
ggtgaaggtc agctgcaacc cgcggtgctc ctcgttcagc caggtcttgc atacggccgc 22500
cagagcttcc acttggtcag gcagtagttt gaagttcgcc tttagatcgt tatccacgtg 22560
gtacttgtcc atcagcgcgc gcgcagcctc catgcccttc tcccacgcag acacgatcgg 22620
cacactcagc gggttcatca ccgtaatttc actttccgct tcgctgggct cttcctcttc 22680
ctcttgcgtc cgcataccac gcgccactgg gtcgtcttca ttcagccgcc gcactgtgcg 22740
cttacctcct ttgccatgct tgattagcac cggtgggttg ctgaaaccca ccatttgtag 22800
cgccacatct tctctttctt cctcgctgtc cacgattacc tctggtgatg gcgggcgctc 22860
gggcttggga gaagggcgct tctttttctt cttgggcgca atggccaaat ccgccgccga 22920
ggtcgatggc cgcgggctgg gtgtgcgcgg caccagcgcg tcttgtgatg agtcttcctc 22980
gtcctcggac tcgatacgcc gcctcatccg cttttttggg ggcgcccggg gaggcggcgg 23040
cgacggggac ggggacgaca cgtcctccat ggttggggga cgtcgcgccg caccgcgtcc 23100
gcgctcgggg gtggtttcgc gctgctcctc ttcccgactg gccatttcct tctcctatag 23160
gcagaaaaag atcatggagt cagtcgagaa gaaggacagc ctaaccgccc cctctgagtt 23220
cgccaccacc gcctccaccg atgccgccaa cgcgcctacc accttccccg tcgaggcacc 23280
cccgcttgag gaggaggaag tgattatcga gcaggaccca ggttttgtaa gcgaagacga 23340
cgaggaccgc tcagtaccaa cagaggataa aaagcaagac caggacaacg cagaggcaaa 23400
cgaggaacaa gtcgggcggg gggacgaaag gcatggcgac tacctagatg tgggagacga 23460
cgtgctgttg aagcatctgc agcgccagtg cgccattatc tgcgacgcgt tgcaagagcg 23520
cagcgatgtg cccctcgcca tagcggatgt cagccttgcc tacgaacgcc acctattctc 23580
accgcgcgta ccccccaaac gccaagaaaa cggcacatgc gagcccaacc cgcgcctcaa 23640
cttctacccc gtatttgccg tgccagaggt gcttgccacc tatcacatct ttttccaaaa 23700
ctgcaagata cccctatcct gccgtgccaa ccgcagccga gcggacaagc agctggcctt 23760
gcggcagggc gctgtcatac ctgatatcgc ctcgctcaac gaagtgccaa aaatctttga 23820
gggtcttgga cgcgacgaga agcgcgcggc aaacgctctg caacaggaaa acagcgaaaa 23880
tgaaagtcac tctggagtgt tggtggaact cgagggtgac aacgcgcgcc tagccgtact 23940
aaaacgcagc atcgaggtca cccactttgc ctacccggca cttaacctac cccccaaggt 24000
catgagcaca gtcatgagtg agctgatcgt gcgccgtgcg cagcccctgg agagggatgc 24060
aaatttgcaa gaacaaacag aggagggcct acccgcagtt ggcgacgagc agctagcgcg 24120
ctggcttcaa acgcgcgagc ctgccgactt ggaggagcga cgcaaactaa tgatggccgc 24180
agtgctcgtt accgtggagc ttgagtgcat gcagcggttc tttgctgacc cggagatgca 24240
gcgcaagcta gaggaaacat tgcactacac ctttcgacag ggctacgtac gccaggcctg 24300
caagatctcc aacgtggagc tctgcaacct ggtctcctac cttggaattt tgcacgaaaa 24360
ccgccttggg caaaacgtgc ttcattccac gctcaagggc gaggcgcgcc gcgactacgt 24420
ccgcgactgc gtttacttat ttctatgcta cacctggcag acggccatgg gcgtttggca 24480
gcagtgcttg gaggagtgca acctcaagga gctgcagaaa ctgctaaagc aaaacttgaa 24540
ggacctatgg acggccttca acgagcgctc cgtggccgcg cacctggcgg acatcatttt 24600
ccccgaacgc ctgcttaaaa ccctgcaaca gggtctgcca gacttcacca gtcaaagcat 24660
gttgcagaac tttaggaact ttatcctaga gcgctcagga atcttgcccg ccacctgctg 24720
tgcacttcct agcgactttg tgcccattaa gtaccgcgaa tgccctccgc cgctttgggg 24780
ccactgctac cttctgcagc tagccaacta ccttgcctac cactctgaca taatggaaga 24840
cgtgagcggt gacggtctac tggagtgtca ctgtcgctgc aacctatgca ccccgcaccg 24900
ctccctggtt tgcaattcgc agctgcttaa cgaaagtcaa attatcggta cctttgagct 24960
gcagggtccc tcgcctgacg aaaagtccgc ggctccgggg ttgaaactca ctccggggct 25020
gtggacgtcg gcttaccttc gcaaatttgt acctgaggac taccacgccc acgagattag 25080
gttctacgaa gaccaatccc gcccgccaaa tgcggagctt accgcctgcg tcattaccca 25140
gggccacatt cttggccaat tgcaagccat caacaaagcc cgccaagagt ttctgctacg 25200
aaagggacgg ggggtttact tggaccccca gtccggcgag gagctcaacc caatcccccc 25260
gccgccgcag ccctatcagc agcagccgcg ggcccttgct tcccaggatg gcacccaaaa 25320
agaagctgca gctgccgccg ccacccacgg acgaggagga atactgggac agtcaggcag 25380
aggaggtttt ggacgaggag gaggaggaca tgatggaaga ctgggagagc ctagacgagg 25440
aagcttccga ggtcgaagag gtgtcagacg aaacaccgtc accctcggtc gcattcccct 25500
cgccggcgcc ccagaaatcg gcaaccggtt ccagcatggc tacaacctcc gctcctcagg 25560
cgccgccggc actgcccgtt cgccgaccca accgtagatg ggacaccact ggaaccaggg 25620
ccggtaagtc caagcagccg ccgccgttag cccaagagca acaacagcgc caaggctacc 25680
gctcatggcg cgggcacaag aacgccatag ttgcttgctt gcaagactgt gggggcaaca 25740
tctccttcgc ccgccgcttt cttctctacc atcacggcgt ggccttcccc cgtaacatcc 25800
tgcattacta ccgtcatctc tacagcccat actgcaccgg cggcagcggc agcggcagca 25860
acagcagcgg ccacacagaa gcaaaggcga ccggatagca agactctgac aaagcccaag 25920
aaatccacag cggcggcagc agcaggagga ggagcgctgc gtctggcgcc caacgaaccc 25980
gtatcgaccc gcgagcttag aaacaggatt tttcccactc tgtatgctat atttcaacag 26040
agcaggggcc aagaacaaga gctgaaaata aaaaacaggt ctctgcgatc cctcacccgc 26100
agctgcctgt atcacaaaag cgaagatcag cttcggcgca cgctggaaga cgcggaggct 26160
ctcttcagta aatactgcgc gctgactctt aaggactagt ttcgcgccct ttctcaaatt 26220
taagcgcgaa aactacgtca tctccagcgg ccacacccgg cgccagcacc tgtcgtcagc 26280
gccattatga gcaaggaaat tcccacgccc tacatgtgga gttaccagcc acaaatggga 26340
cttgcggctg gagctgccca agactactca acccgaataa actacatgag cgcgggaccc 26400
cacatgatat cccgggtcaa cggaatccgc gcccaccgaa accgaattct cttggaacag 26460
gcggctatta ccaccacacc tcgtaataac cttaatcccc gtagttggcc cgctgccctg 26520
gtgtaccagg aaagtcccgc tcccaccact gtggtacttc ccagagacgc ccaggccgaa 26580
gttcagatga ctaactcagg ggcgcagctt gcgggcggct ttcgtcacag ggtgcggtcg 26640
cccgggcagg gtataactca cctgacaatc agagggcgag gtattcagct caacgacgag 26700
tcggtgagct cctcgcttgg tctccgtccg gacgggacat ttcagatcgg cggcgccggc 26760
cgtccttcat tcacgcctcg tcaggcaatc ctaactctgc agacctcgtc ctctgagccg 26820
cgctctggag gcattggaac tctgcaattt attgaggagt ttgtgccatc ggtctacttt 26880
aaccccttct cgggacctcc cggccactat ccggatcaat ttattcctaa ctttgacgcg 26940
gtaaaggact cggcggacgg ctacgactga acaagtttgt acaaaaaagc aggcttcgaa 27000
ggagatagaa ccaattctct aaggaaatac ttaaccatgg tcgactttat ttggatcttc 27060
gatgctagac gatccagaca tgataagata cattgatgag tttggacaaa ccacaactag 27120
aatgcagtga aaaaaatgct ttatttgtga aatttgtgat gctattgctt tatttgtaac 27180
cattataagc tgcaataaac aagttgctcg aattactaaa gtgcttcgat tttagtagtg 27240
caatagtatt gtctgcataa tgctaatcgt gatagctaaa gcttatcaga ctgagatagc 27300
accatctgaa atgctgaccc tgtagaaccg aatttgtata tcacattgcc agggctggct 27360
acatctggct actgcgcttt ggttatctag cgaagtgctt cgattttagt agtgcaatag 27420
tattgtctgc ataatgctaa tcgtgatagc taaagcttat cagactgaga tagcaccatc 27480
tgaaatgctg accctgtaga accgaatttg tatatcacat tgccagggct ggctacatct 27540
ggctactgcg ctttggttat ctagcgaagt gcttcgattttagtagtgca atagtattgt 27600
ctgcataatg ctaatcgtga tagctaaagc ttatcagact gagatagcac catctgaaat 27660
gctgaccctg tagaaccgaa tttgtatatc acattgccag ggctggctac atctggctac 27720
tgcgctttgg ttatctagcg aagtgcttcg attttagtag tgcaatagta ttgtctgcat 27780
aatgctaatc gtgatagcta aagcttatca gactgagata gcaccatctg aaatgctgac 27840
cctgtagaac cgaatttgta tatcacattg ccagggctgg ctacatctgg ctactgcgct 27900
ttggttatct agcgaagtgc ttcgatttta gtagtgcaat agtattgtct gcataatgct 27960
aatcgtgata gctaaagctt atcagactga gatagcacca tctgaaatgc tgaccctgta 28020
gaaccgaatt tgtatatcac attgccaggg ctggctacat ctggctactg cgctttggtt 28080
atctagcgaa gtgcttcgat tttagtagtg caatagtatt gtctgcataa tgctaatcgt 28140
gatagctaaa gcttatcaga ctgagatagc accatctgaa atgctgaccc tgtagaaccg 28200
aatttgtata tcacattgcc agggctggct acatctggct actgcgcttt ggttatctag 28260
cgaagtgctt cgattttagt agtgcaatag tattgtctgc ataatgctaa tcgtgatagc 28320
taaagcttat cagactgaga tagcaccatc tgaaatgctg accctgtaga accgaatttg 28380
tatatcacat tgccagggct ggctacatct ggctactgcg ctttggttat ctagcgaagt 28440
gcttcgattt tagtagtgca atagtattgt ctgcataatg ctaatcgtga tagctaaagc 28500
ttatcagact gagatagcac catctgaaat gctgaccctg tagaaccgaa tttgtatatc 28560
acattgccag ggctggctac atctggctac tgcgctttgg ttatctagcg aagtgcttcg 28620
attttagtag tgcaatagta ttgtctgcat aatgctaatc gtgatagcta aagcttatca 28680
gactgagata gcaccatctg aaatgctgac cctgtagaac cgaatttgta tatcacattg 28740
ccagggctgg ctacatctgg ctactgcgct ttggttatct agcgaagtgc ttcgatttta 28800
gtagtgcaat agtattgtct gcataatgct aatcgtgata gctaaagctt atcagactga 28860
gatagcacca tctgaaatgc tgaccctgta gaaccgaatt tgtatatcac attgccaggg 28920
ctggctacat ctggctactg cgctttggtt atctagcgca tggtggcgaa ttcgcggccg 28980
cactcgagat atctagaccc agctttcttg tacaaagtgg tctaataaaa aaaaataata 29040
aagcatcact tacttaaaat cagttagcaa atttctgtcc agtttattca gcagcacctc 29100
cttgccctcc tcccagctct ggtattgcag cttcctcctg gctgcaaact ttctccacaa 29160
tctaaatgga atgtcagttt cctcctgttc ctgtccatcc gcacccacta tcttcatgtt 29220
gttgcagatg aagcgcgcaa gaccgtctga agataccttc aaccccgtgt atccatatga 29280
cacggaaacc ggtcctccaa ctgtgccttt tcttactcct ccctttgtat cccccaatgg 29340
gtttcaagag agtccccctg gggtactctc tttgcgccta tccgaacctc tagttacctc 29400
caatggcatg cttgcgctca aaatgggcaa cggcctctct ctggacgagg ccggcaacct 29460
tacctcccaa aatgtaacca ctgtgagccc acctctcaaa aaaaccaagt caaacataaa 29520
cctggaaata tctgcacccc tcacagttac ctcagaagcc ctaactgtgg ctgccgccgc 29580
acctctaatg gtcgcgggca acacactcac catgcaatca caggccccgc taaccgtgca 29640
cgactccaaa cttagcattg ccacccaagg acccctcaca gtgtcagaag gaaagctagc 29700
cctgcaaaca tcaggccccc tcaccaccac cgatagcagt acccttacta tcactgcctc 29760
accccctcta actactgcca ctggtagctt gggcattgac ttgaaagagc ccatttatac 29820
acaaaatgga aaactaggac taaagtacgg ggctcctttg catgtaacag acgacctaaa 29880
cactttgacc gtagcaactg gtccaggtgt gactattaat aatacttcct tgcaaactaa 29940
agttactgga gccttgggtt ttgattcaca aggcaatatg caacttaatg tagcaggagg 30000
actaaggatt gattctcaaa acagacgcct tatacttgat gttagttatc cgtttgatgc 30060
tcaaaaccaa ctaaatctaa gactaggaca gggccctctt tttataaact cagcccacaa 30120
cttggatatt aactacaaca aaggccttta cttgtttaca gcttcaaaca attccaaaaa 30180
gcttgaggtt aacctaagca ctgccaaggg gttgatgttt gacgctacag ccatagccat 30240
taatgcagga gatgggcttg aatttggttc acctaatgca ccaaacacaa atcccctcaa 30300
aacaaaaatt ggccatggcc tagaatttga ttcaaacaag gctatggttc ctaaactagg 30360
aactggcctt agttttgaca gcacaggtgc cattacagta ggaaacaaaa ataatgataa 30420
gctaactttg tggaccacac cagctccatc tcctaactgt agactaaatg cagagaaaga 30480
tgctaaactc actttggtct taacaaaatg tggcagtcaa atacttgcta cagtttcagt 30540
tttggctgtt aaaggcagtt tggctccaat atctggaaca gttcaaagtg ctcatcttat 30600
tataagattt gacgaaaatg gagtgctact aaacaattcc ttcctggacc cagaatattg 30660
gaactttaga aatggagatc ttactgaagg cacagcctat acaaacgctg ttggatttat 30720
gcctaaccta tcagcttatc caaaatctca cggtaaaact gccaaaagta acattgtcag 30780
tcaagtttac ttaaacggag acaaaactaaacctgtaaca ctaaccatta cactaaacgg 30840
tacacaggaa acaggagaca caactccaag tgcatactct atgtcatttt catgggactg 30900
gtctggccac aactacatta atgaaatatt tgccacatcc tcttacactt tttcatacat 30960
tgcccaagaa taaagaatcg tttgtgttat gtttcaacgt gtttattttt caattgcaga 31020
aaatttcaag tcatttttca ttcagtagta tagccccacc accacatagc ttatacagat 31080
caccgtacct taatcaaact cacagaaccc tagtattcaa cctgccacct ccctcccaac 31140
acacagagta cacagtcctt tctccccggc tggccttaaa aagcatcata tcatgggtaa 31200
cagacatatt cttaggtgtt atattccaca cggtttcctg tcgagccaaa cgctcatcag 31260
tgatattaat aaactccccg ggcagctcac ttaagttcat gtcgctgtcc agctgctgag 31320
ccacaggctg ctgtccaact tgcggttgct taacgggcgg cgaaggagaa gtccacgcct 31380
acatgggggt agagtcataa tcgtgcatca ggatagggcg gtggtgctgc agcagcgcgc 31440
gaataaactg ctgccgccgc cgctccgtcc tgcaggaata caacatggca gtggtctcct 31500
cagcgatgat tcgcaccgcc cgcagcataa ggcgccttgt cctccgggca cagcagcgca 31560
ccctgatctc acttaaatca gcacagtaac tgcagcacag caccacaata ttgttcaaaa 31620
tcccacagtg caaggcgctg tatccaaagc tcatggcggg gaccacagaa cccacgtggc 31680
catcatacca caagcgcagg tagattaagt ggcgacccct cataaacacg ctggacataa 31740
acattacctc ttttggcatg ttgtaattca ccacctcccg gtaccatata aacctctgat 31800
taaacatggc gccatccacc accatcctaa accagctggc caaaacctgc ccgccggcta 31860
tacactgcag ggaaccggga ctggaacaat gacagtggag agcccaggac tcgtaaccat 31920
ggatcatcat gctcgtcatg atatcaatgt tggcacaaca caggcacacg tgcatacact 31980
tcctcaggat tacaagctcc tcccgcgtta gaaccatatc ccagggaaca acccattcct 32040
gaatcagcgt aaatcccaca ctgcagggaa gacctcgcac gtaactcacg ttgtgcattg 32100
tcaaagtgtt acattcgggc agcagcggat gatcctccag tatggtagcg cgggtttctg 32160
tctcaaaagg aggtagacga tccctactgt acggagtgcg ccgagacaac cgagatcgtg 32220
ttggtcgtag tgtcatgcca aatggaacgc cggacgtagt catatttcct gaagcaaaac 32280
caggtgcggg cgtgacaaac agatctgcgt ctccggtctc gccgcttaga tcgctctgtg 32340
tagtagttgt agtatatcca ctctctcaaa gcatccaggc gccccctggc ttcgggttct 32400
atgtaaactc cttcatgcgc cgctgccctg ataacatcca ccaccgcaga ataagccaca 32460
cccagccaac ctacacattc gttctgcgag tcacacacgg gaggagcggg aagagctgga 32520
agaaccatgt tttttttttt attccaaaag attatccaaa acctcaaaat gaagatctat 32580
taagtgaacg cgctcccctc cggtggcgtg gtcaaactct acagccaaag aacagataat 32640
ggcatttgta agatgttgca caatggcttc caaaaggcaa acggccctca cgtccaagtg 32700
gacgtaaagg ctaaaccctt cagggtgaat ctcctctata aacattccag caccttcaac 32760
catgcccaaa taattctcat ctcgccacct tctcaatata tctctaagca aatcccgaat 32820
attaagtccg gccattgtaa aaatctgctc cagagcgccc tccaccttca gcctcaagca 32880
gcgaatcatg attgcaaaaa ttcaggttcc tcacagacct gtataagatt caaaagcgga 32940
acattaacaa aaataccgcg atcccgtagg tcccttcgca gggccagctg aacataatcg 33000
tgcaggtctg cacggaccag cgcggccact tccccgccag gaaccttgac aaaagaaccc 33060
acactgatta tgacacgcat actcggagct atgctaacca gcgtagcccc gatgtaagct 33120
ttgttgcatg ggcggcgata taaaatgcaa ggtgctgctc aaaaaatcag gcaaagcctc 33180
gcgcaaaaaa gaaagcacat cgtagtcatg ctcatgcaga taaaggcagg taagctccgg 33240
aaccaccaca gaaaaagaca ccatttttct ctcaaacatg tctgcgggtt tctgcataaa 33300
cacaaaataa aataacaaaa aaacatttaa acattagaag cctgtcttac aacaggaaaa 33360
acaaccctta taagcataag acggactacg gccatgccgg cgtgaccgta aaaaaactgg 33420
tcaccgtgat taaaaagcac caccgacagc tcctcggtca tgtccggagt cataatgtaa 33480
gactcggtaa acacatcagg ttgattcatc ggtcagtgct aaaaagcgac cgaaatagcc 33540
cgggggaata catacccgca ggcgtagaga caacattaca gcccccatag gaggtataac 33600
aaaattaata ggagagaaaa acacataaac acctgaaaaa ccctcctgcc taggcaaaat 33660
agcaccctcc cgctccagaa caacatacag cgcttcacag cggcagccta acagtcagcc 33720
ttaccagtaa aaaagaaaac ctattaaaaa aacaccactc gacacggcac cagctcaatc 33780
agtcacagtg taaaaaaggg ccaagtgcag agcgagtata tataggacta aaaaatgacg 33840
taacggttaa agtccacaaa aaacacccag aaaaccgcac gcgaacctac gcccagaaac 33900
gaaagccaaa aaacccacaa cttcctcaaa tcgtcacttc cgttttccca cgttacgtaa 33960
cttcccattt taagaaaact acaattccca acacatacaa gttactccgc cctaaaacct 34020
acgtcacccg ccccgttccc acgccccgcg ccacgtcaca aactccaccc cctcattatc 34080
atattggctt caatccaaaa taaggtatat tattgatgat 34120

Claims (9)

  1. Use of a miRNA combination or an inhibitor of a miRNA combination for the preparation of a medicament for the treatment of breast cancer, wherein the miRNA combination consists of: miR-9-5p, miR-10b-5p, miR-21-5p, miR-23a-3p, miR-29a-3p, miR-155-5p, miR-222-3p, miR-301a-3p and miR-373-3 p.
  2. 2. The use of claim 1, wherein the inhibitor of the combination of mirnas is an agent that reduces the expression level, activity, stability or effective duration of action of each miRNA in the combination of mirnas.
  3. 3. The use according to claim 2, wherein the inhibitor of the combination of mirnas is selected from:
    a) a nucleic acid inhibitor, protein inhibitor, nuclease or nucleic acid binding molecule;
    b) a plasmid vector carrying or expressing any one of a); or
    c) A host carrying or expressing any one of a).
  4. 4. The use according to claim 3, wherein the inhibitor of the combination of miRNAs is selected from the group consisting of:
    a) the method comprises the following steps of (1) interfering LncRNA, wherein a sequence for coding the interfering LncRNA is n copies of a sequence shown in 16-189bp in SEQ ID NO.10, and n is an integer more than or equal to 1;
    b) expressing the plasmid vector of a); or
    c) Carrying the virus of a).
  5. 5. The use of claim 1, wherein the breast cancer is triple negative breast cancer.
  6. 6. An interfering LncRNA, characterized in that the sequence coding the LncRNA is n copies of the sequence shown as 16-189bp in SEQ ID NO.10, and n is an integer more than or equal to 1.
  7. 7. A nucleic acid molecule encoding the LncRNA of claim 6.
  8. 8. The nucleic acid molecule of claim 7, wherein the sequence of said nucleic acid molecule comprises the sequence shown as 16-189bp of SEQ id No. 10.
  9. 9. A virus having integrated into its genome an expression cassette for expressing LncRNA of claim 6.
CN201911261380.3A 2019-12-10 2019-12-10 Group of miRNA and application thereof in biological targeted therapy of breast cancer Active CN110787181B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911261380.3A CN110787181B (en) 2019-12-10 2019-12-10 Group of miRNA and application thereof in biological targeted therapy of breast cancer

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911261380.3A CN110787181B (en) 2019-12-10 2019-12-10 Group of miRNA and application thereof in biological targeted therapy of breast cancer

Publications (2)

Publication Number Publication Date
CN110787181A true CN110787181A (en) 2020-02-14
CN110787181B CN110787181B (en) 2022-11-15

Family

ID=69447926

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911261380.3A Active CN110787181B (en) 2019-12-10 2019-12-10 Group of miRNA and application thereof in biological targeted therapy of breast cancer

Country Status (1)

Country Link
CN (1) CN110787181B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130267575A1 (en) * 2012-03-07 2013-10-10 The Texas A&M University System Cancer treatment targeting non-coding rna overexpression
WO2016140552A1 (en) * 2015-03-04 2016-09-09 숙명여자대학교산학협력단 Biomarker composition for diagnosing sensitivity to anticancer agent in anticancer agent-resistant breast cancer
CN107429295A (en) * 2015-03-09 2017-12-01 新加坡科技研究局 The method of risk to suffer from breast cancer is determined by detecting the expression of Microrna (miRNA)
CN108251424A (en) * 2017-12-19 2018-07-06 天利康(天津)科技有限公司 A kind of single stranded circle RNA and DNA and its preparation method and application
CN110317872A (en) * 2019-07-15 2019-10-11 汕头大学医学院第一附属医院 It is used to prepare the molecular marked compound and kit of detection, prognosis and Diagnosis of Breast cancer product

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130267575A1 (en) * 2012-03-07 2013-10-10 The Texas A&M University System Cancer treatment targeting non-coding rna overexpression
WO2016140552A1 (en) * 2015-03-04 2016-09-09 숙명여자대학교산학협력단 Biomarker composition for diagnosing sensitivity to anticancer agent in anticancer agent-resistant breast cancer
CN107429295A (en) * 2015-03-09 2017-12-01 新加坡科技研究局 The method of risk to suffer from breast cancer is determined by detecting the expression of Microrna (miRNA)
CN108251424A (en) * 2017-12-19 2018-07-06 天利康(天津)科技有限公司 A kind of single stranded circle RNA and DNA and its preparation method and application
CN110317872A (en) * 2019-07-15 2019-10-11 汕头大学医学院第一附属医院 It is used to prepare the molecular marked compound and kit of detection, prognosis and Diagnosis of Breast cancer product

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KHAMISIPOUR G ET AL: "Knockdown of microRNA 29a regulates the expression of apoptosis related genes in MCF 7 breast carcinoma cells", 《MOL CLIN ONCOL》 *
刘翠翠 等: "长链非编码RNA调控乳腺癌增殖、转移、耐药性及乳腺癌干细胞", 《中华乳腺病杂志(电子版)》 *
赵晗婷 等: "lncRNAs在乳腺癌发生、发展中的作用及其潜在的临床意义", 《临床肿瘤学杂志》 *

Also Published As

Publication number Publication date
CN110787181B (en) 2022-11-15

Similar Documents

Publication Publication Date Title
Weiher et al. Multiple point mutations affecting the simian virus 40 enhancer
White et al. Polyomaviruses and human cancer: molecular mechanisms underlying patterns of tumorigenesis
Wang et al. Oncogenic HPV infection interrupts the expression of tumor-suppressive miR-34a through viral oncoprotein E6
Holley-Guthrie et al. The Epstein-Barr virus (EBV) BMRF1 promoter for early antigen (EA-D) is regulated by the EBV transactivators, BRLF1 and BZLF1, in a cell-specific manner
Wu et al. The E1A 13S product of adenovirus 5 activates transcription of the cellular human HSP70 gene
Brady et al. trans Activation of the simian virus 40 late transcription unit by T-antigen
Makielski et al. Human papillomavirus promotes Epstein-Barr virus maintenance and lytic reactivation in immortalized oral keratinocytes
Gloss et al. Numerous nuclear proteins bind the long control region of human papillomavirus type 16: a subset of 6 of 23 DNase I-protected segments coincides with the location of the cell-type-specific enhancer
Offord et al. A member of the activator protein 1 family found in keratinocytes but not in fibroblasts required for transcription from a human papillomavirus type 18 promoter
KR101946666B1 (en) Conditionally replication-competent adenovirus
Bauknecht et al. A novel C/EBP beta-YY1 complex controls the cell-type-specific activity of the human papillomavirus type 18 upstream regulatory region
Friedman et al. Cellular promoters incorporated into the adenovirus genome: cell specificity of albumin and immunoglobulin expression
Bazot et al. Epstein-Barr virus proteins EBNA3A and EBNA3C together induce expression of the oncogenic microRNA cluster miR-221/miR-222 and ablate expression of its target p57KIP2
Modjtahedi et al. Increased level of amplification of the c-myc oncogene in tumors induced in nude mice by a human breast carcinoma cell line
Yoshizaki et al. Matrix metalloproteinase 9 is induced by the Epstein–Barr virus BZLF1 transactivator
Zalani et al. The Zif268 cellular transcription factor activates expression of the Epstein-Barr virus immediate-early BRLF1 promoter
Buisson et al. The C-terminal region but not the Arg-X-Pro repeat of Epstein-Barr virus protein EB2 is required for its effect on RNA splicing and transport
CA2192689A1 (en) Method to identify tumor suppressor genes
CN110787181B (en) Group of miRNA and application thereof in biological targeted therapy of breast cancer
CA2799586C (en) Method and kit for identifying compounds capable of inhibiting human papilloma virus replication
Farr et al. Relative enhancer activity and transforming potential of authentic human papillomavirus type 6 genomes from benign and malignant lesions
Garcı́a-Ramı́rez et al. Dominance of virus over host factors in cross-species activation of human cytomegalovirus early gene expression
Liu et al. Identification and characterization of a JC virus pentanucleotide repeat element binding protein: cellular nucleic acid binding protein
Marzulli et al. A novel oncolytic herpes simplex virus design based on the common overexpression of microRNA-21 in tumors
CN111424082A (en) Application of lncRNA-SNHG6 gene in preparation of medicine for treating osteosarcoma

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant