CN110777217A - Cordyceps militaris fruiting body development stage reference gene, primer, screening method and application - Google Patents
Cordyceps militaris fruiting body development stage reference gene, primer, screening method and application Download PDFInfo
- Publication number
- CN110777217A CN110777217A CN201911237280.7A CN201911237280A CN110777217A CN 110777217 A CN110777217 A CN 110777217A CN 201911237280 A CN201911237280 A CN 201911237280A CN 110777217 A CN110777217 A CN 110777217A
- Authority
- CN
- China
- Prior art keywords
- cordyceps militaris
- stage
- reference gene
- gene
- development
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
An internal reference gene, a primer, a screening method and application in the development stage of a cordyceps militaris sporocarp are disclosed, wherein the internal reference gene is TUB, and the nucleotide sequence is SEQ ID NO. 1. Nucleotide sequences of forward and reverse primers of TUB are SEQ ID NO 13-14. The screening method comprises the following steps: (1) selecting 12 internal reference genes as alternative internal reference genes, and designing primers; (2) inducing the development of cordyceps militaris sporocarp, extracting total RNA at different development stages, determining the concentration of the RNA, carrying out reverse transcription on the RNA to synthesize cDNA, and analyzing the alternative reference gene by using real-time fluorescent quantitative PCR (polymerase chain reaction) by taking the cDNA as a template; (3) and (5) carrying out Ct value analysis on the real-time fluorescence quantitative PCR data, and screening out the stable reference gene. The application takes TUB as an internal reference gene to detect the relative expression quantity of target genes at different development stages. The stability of the reference gene is good; the method is simple, rapid and low in cost.
Description
Technical Field
The invention relates to a cordyceps militaris reference gene, a primer, a screening method and application, and particularly relates to a cordyceps militaris reference gene, a primer, a screening method and application in a development stage of a fruiting body of cordyceps militaris.
Background
Cordyceps militaris is a famous Chinese medicine which is a famous Chinese medicine and has been used as a health food in China for a long time. The Cordyceps militaris fruiting body has antiinflammatory, antibacterial, antitumor, antiaging and immunity regulating effects. At present, insects (such as silkworm chrysalis), rice and the like are used as main raw materials of a culture medium, and a commercialized production method for planting cordyceps militaris sporocarp is established. However, there has been little research on the molecular mechanism of pupa worm seed entity formation, which is a fundamental biological problem.
The development of cordyceps militaris from mycelium to fruiting body shows a simple to complex multicellular transition, which proceeds through four typical stages: the sporophore development of various mushrooms in the hypha stage, primordial stage, elongation stage and maturation stage is all subjected to the four stages, such as flammulina velutipes, pleurotus eryngii, agrocybe cylindracea, pholiota nameko and the like. However, the molecular mechanism of the development of mushroom mycelia into fruiting bodies has been rarely studied, which will severely restrict the further development of commercial production of mushroom fruiting bodies.
Real-time fluorescence quantitative PCR has become an important tool for researching complex signal networks of organisms under different stimuli due to high sensitivity, specificity and reliability. However, real-time fluorescent quantitative PCR analysis depends to a large extent on the choice of the reference gene, and will lead to erroneous results due to failure to screen for the appropriate reference gene under specific experimental conditions. Therefore, the selection of a gene that is relatively stable under the action of the processing factors as an internal reference gene or internal reference standard is critical to the success of real-time fluorescence quantitative PCR.
In the prior art, no related research on reference genes in the development stage of cordyceps militaris sporocarp is disclosed.
Disclosure of Invention
The invention aims to solve the technical problem of overcoming the defects in the prior art and providing the reference gene with good stability in the development stage of the cordyceps militaris sporocarp.
The invention further aims to solve the technical problem of overcoming the defects in the prior art and providing the primer of the reference gene in the development stage of the cordyceps militaris sporocarp, which has high amplification efficiency.
The invention further aims to solve the technical problem of overcoming the defects in the prior art and providing a simple, quick and low-cost method for screening the reference genes in the development stage of the cordyceps militaris sporocarp.
The invention further solves the technical problem of overcoming the defects in the prior art and provides the application of the reference gene in the development stage of the cordyceps militaris sporocarp, wherein the expression quantity of the target gene is stable and accurate.
The technical scheme adopted by the invention for solving the technical problems is as follows: an internal reference gene of the cordyceps militaris fruiting body in a development stage is TUB, and the nucleotide sequence of the TUB is SEQ ID NO. 1. TUB is known as: tubulin, Tubulin.
Preferably, the developmental stages include a hyphal stage, an primordial stage, an elongation stage, and a maturation stage.
The technical scheme adopted for further solving the technical problems is as follows: the nucleotide sequences of forward and reverse primers of the primer of the reference gene in the development stage of the cordyceps militaris sporocarp are SEQ ID NO. 13-14 in sequence.
The technical scheme adopted by the invention for further solving the technical problems is as follows: the method for screening the reference gene in the development stage of the cordyceps militaris sporocarp comprises the following steps:
(1) selecting 12 reference genes TUB, EF-1 α, UBC, GTPB, RPS, ACTIN, FBOX, CYP, GAPDH, PP2A, PGK and UBQ as alternative reference genes, and designing fluorescent quantitative PCR primers thereof;
(2) inducing the development of cordyceps militaris sporocarp, respectively collecting cordyceps militaris hypha samples in hypha stage and cordyceps militaris sporocarp samples in primordial stage, elongation stage and maturation stage, immediately extracting total RNA, determining RNA concentration, carrying out reverse transcription on the RNA to synthesize cDNA, and then analyzing the alternative reference gene by using the primer in the step (1) and real-time fluorescence quantitative PCR (polymerase chain reaction) by using the cDNA as a template;
(3) and performing internal reference gene Ct value stability analysis on the real-time fluorescent quantitative PCR data by adopting GeNorm, NormFinder and BestKeeper software, thereby screening the internal reference gene most stably expressed in the development stage of the cordyceps militaris sporocarp.
Preferably, in step (1), the nucleotide sequences of the 12 internal reference genes are sequentially SEQ ID NO: 1-12. all of the 12 internal reference genes are called Tubulin (TUB), Elongation factor-1 α (electrophoresis factor-1 α -1 α), Ubiquitin-binding enzyme (Ubiquitin-conjugating enzyme, UBC), GTP-binding protein (GTP-binding protein, GTPB), Ribosomal protein S25 (Ribosoman S25, RPS), ACTIN-skeleton protein (Actinytosenton protein, ACTIN), F-box protein (F-box protein, FBOX), Cyclophilin (CYP), Glyceraldehyde-3-phosphate dehydrogenase (Glyceraldehyde-3-phosphate, Phosphoglycerate kinase, PDH 2A), Polyubiquitin-phosphate kinase (PGQ 2P), Polyubiquitin-phosphate kinase (P2, Pp).
Preferably, in step (1), the forward and reverse primers of the 12 reference genes are designed by using primer5.0 software.
Preferably, in the step (1), the nucleotide sequences of the forward primers and the reverse primers of the 12 reference genes are sequentially SEQ ID NO: 13-36.
Preferably, in the step (2), the culture conditions of the cordyceps militaris are as follows: inoculating Cordyceps militaris mycelium into a glass bottle containing rice culture medium, and culturing at constant temperature in shade until the mycelium is full of the rice culture medium.
Preferably, the formula of the rice culture medium is as follows: and uniformly mixing the rice, the silkworm chrysalis meal and the nutrient solution according to a solid-to-liquid ratio (g/g/mL) of 30-50: 1: 40-60.
Preferably, the formula of the nutrient solution is as follows: each 1000mL of distilled water contains 15-25 g of glucose and KH
2PO
41～3g、MgSO
40.5-1.5 g, 0.5-1.5 g ammonium citrate, 4-6 g peptone and 115-25 mg vitamin B.
Preferably, the temperature of the constant-temperature shading culture is 20-28 ℃, and the time is 20-30 days.
Preferably, in the step (2), the method for inducing development of cordyceps militaris fruiting body comprises: under the circulation induction of temperature and illumination, the cordyceps militaris is continuously cultured to a hypha stage, an primordial stage, an elongation stage and a maturation stage.
Preferably, the cyclic induction of temperature and light means: in each development stage, the illumination treatment is carried out for 12-16 h at the temperature of 20-25 ℃ and the shading treatment is carried out for 8-12 h at the temperature of 15-20 ℃ every day. The purpose of the cycle induction is to mimic the changes in natural conditions.
Preferably, the hyphal stage is 28-32 days, the primordial stage is 38-42 days, the elongation stage is 48-52 days, and the maturation stage is 60-70 days.
Preferably, in the step (2), the real-time fluorescence quantitative PCR amplification system consists of cDNA, PCR buffer Mix, forward primer, reverse primer and double distilled water in a volume ratio of 1: 8-12: 1:1: 5-10.
Preferably, in the step (2), the cDNA is diluted into 4-8 dilutions with different concentrations according to a 10-fold equal ratio as a template.
Preferably, in the step (2), the reaction system of the real-time fluorescence quantitative PCR consists of cDNA diluent, a fluorescent reagent, a forward primer, a reverse primer and double distilled water in a volume ratio of 1: 8-12: 1:1: 5-10.
Preferably, in the step (2), the reaction conditions of the real-time fluorescence quantitative PCR are as follows: pre-denaturation at 90-95 ℃ for 25-35 s, denaturation at 90-95 ℃ for 5-15 s, annealing at 50-60 ℃ for 25-35 s for 30-50 cycles, and then performing melting curve analysis at 55-95 ℃ to collect fluorescence signals every 0.5 ℃. Each sample was set for more than or equal to 3 technical replicates.
Preferably, in the step (2), the induced cordyceps militaris fruiting body development under the same condition is set to be more than or equal to 3 biological repetitions.
Preferably, in step (2), the RNA is extracted by the following method: taking 0.1-0.3 g of cordyceps militaris hypha or fruiting body, adding liquid nitrogen, grinding into fine powder, adding 400-600 mu L of Trizol reagent, and manually homogenizing for 3-8 min, wherein the steps are finished according to the Trizol reagent specification.
The method for detecting the quality and the concentration of the RNA comprises the following steps: taking 1 mu L of RNA sample, and detecting OD260/280 and concentration by using NanoDrop2000, wherein the OD260/280 value is between 1.8 and 2.2, and the sample is qualified.
First strand cDNA Synthesis: reverse transcription was performed using 3. mu.g RNA, and the procedure was performed according to the Thermo Fisher reverse transcription kit instructions.
Preferably, in the step (3), the GeNorm software obtains variation values V for pairwise comparison through normalization factor pairing difference analysis, and finally selects an appropriate number of reference genes, where when the value of Vn/n +1 is less than the threshold value 0.15, the most appropriate number of reference genes is n, and the first n genes are selected as reference genes. The GeNorm program can be used for screening any number of internal reference genes under any conditions and selecting more than two internal reference genes instead of the traditional method of using a single internal reference gene, which is beneficial to correcting system deviation and obtaining more reliable accurate quantitative results of the genes and has extremely important significance for biological research of slight expression difference.
Preferably, in the step (3), the expression stability value M of each gene is directly calculated by the NormFinder software, and the smaller the M value is, the higher the stability is, according to the sorting of the M values.
Preferably, in the step (3), the BestKeeper software determines the most suitable reference genes according to the original Ct value and the amplification efficiency of the primers, and sorts the reference genes in sequence, wherein the reference genes with a stability value less than 1 are qualified as stable reference genes. BestKeeper can compare the expression levels of multiple reference genes and multiple genes of interest in 100 samples. During operation, the original Ct value data is input into an Excel table of BestKeeper software, and the operated reference gene and target gene are independently analyzed. The program generated a correlation coefficient and BestKeeper index for the pairings between each gene, i.e., the geometric mean of Ct values for each candidate gene, which were compared according to their magnitude.
The invention further solves the technical problems by adopting the following technical scheme: the application of the internal reference gene in the development stage of the cordyceps militaris sporocarp is to detect the relative expression quantity of a target gene related to the development of the sporocarp in different development stages of the cordyceps militaris sporocarp by using the TUB as the internal reference gene and using real-time fluorescent quantitative PCR. The application can analyze the expression rule of target gene related to fruiting body development in Cordyceps militaris body at different development stages.
Preferably, the objective gene related to fruiting body development is a phospholipase protein gene.
Preferably, the phospholipase protein gene is PLA, PLC, PLD. PLA, PLC and PLD are key regulating genes in the growth and development stages of the cordyceps militaris sporocarp.
Preferably, the nucleotide sequences of the PLA, the PLC and the PLD are SEQ ID NO: 37-39.
Preferably, the forward and reverse primers of PLA, PLC and PLD are designed by using primer5.0 software.
Preferably, the nucleotide sequences of the forward primers and the reverse primers of the PLA, the PLC and the PLD are SEQ ID NO:40-45 in sequence.
The invention has the following beneficial effects:
(1) the internal reference gene meets the stability threshold of three analysis software at the development stage of the cordyceps militaris sporocarp, has good stability, provides stable internal reference gene reference for the analysis of the gene expression profile in the cordyceps militaris at each sporocarp development stage, and provides reference for researching the regulation and control mechanism of each development stage of the cordyceps militaris sporocarp;
(2) the primer amplification efficiency of the reference gene is high;
(3) the screening method is simple, rapid and low in cost, and provides reference for screening of real-time fluorescence quantitative PCR reference genes of other species under specific experimental conditions;
(4) the invention analyzes the relative expression levels of 3 phospholipase protein genes in different development stages of the cordyceps militaris sporocarp, and establishes a method for detecting each gene in the cordyceps militaris by using real-time fluorescent quantitative PCR (polymerase chain reaction) in different development stages of the cordyceps militaris sporocarp.
Drawings
FIG. 1 shows Ct values of alternative reference genes in 4 developmental stages of Cordyceps militaris fruiting body in accordance with the present invention;
FIG. 2 shows the stability of the expression of each candidate reference gene analyzed by GeNorm software in 4 developmental stages of the fruiting body of Cordyceps militaris in accordance with an embodiment of the present invention;
FIG. 3 shows the number of reference genes with the most suitable expression of the reference genes in 4 developmental stages of fruiting bodies of Cordyceps militaris according to an embodiment of the present invention;
FIG. 4 shows the relative quantitative expression level of the PLA gene in vivo at the development stage of the fruiting body of Cordyceps militaris with TUB as the reference gene in the embodiment of the present invention;
FIG. 5 shows the relative quantitative expression level of the PLC gene in vivo at the development stage of the fruiting body of Cordyceps militaris with TUB as the reference gene in the embodiment of the present invention;
FIG. 6 shows the relative quantitative expression level of the PLD gene in vivo at the stage of fruiting body development of Cordyceps militaris with TUB as the reference gene in the example of the present invention.
Detailed Description
The invention is further illustrated by the following examples and figures.
The cordyceps militaris hyphae used in the reference example are purchased from China general microbiological culture collection center with the preservation number of CGMCC 3.14242, and the silkworm chrysalis powder is purchased from Meiyue feed science and technology Limited company in Shandong province; the 12 reference genes and forward and reverse primers of PLA, PLC and PLD are synthesized by Biotechnology engineering (Shanghai) GmbH after being designed; trizol reagent used in the embodiment of the present invention, batch number: 15596026, available from Invitrogen; thermo Fisher reverse transcription kit, lot No.: k1622 available from Themo Fisher; PCR buffer Mix was purchased from near-shore protein novoprotein science and technology ltd; SYBR Green fluorescent reagent was purchased from Bio-Rad; CFX96 instrument was purchased from Bio-Rad; the starting materials or chemicals used in the examples of the present invention are, unless otherwise specified, commercially available in a conventional manner.
The use of the reference gene stability analysis software according to the examples of the present invention was carried out in accordance with the instructions for its use.
Reference example 1
The culture conditions of the cordyceps militaris are as follows: inoculating Cordyceps militaris mycelium in a glass bottle containing rice culture medium at a clean bench, and culturing at 25 deg.C under constant temperature and light shielding for 25 days until the mycelium is full of riceCulturing to obtain culture medium; the formula of the rice culture medium is as follows: uniformly mixing 20g of rice, 0.5g of silkworm chrysalis meal and 25mL of nutrient solution; the formula of the nutrient solution is as follows: the distilled water per 1000mL contains glucose 20g and KH
2PO
42g、MgSO
41g, 1g ammonium citrate, 5g peptone and vitamin B120 mg.
Examples
(1) Selecting 12 reference genes TUB, EF-1 α, UBC, GTPB, RPS, ACTIN, FBOX, CYP, GAPDH, PP2A, PGK and UBQ as alternative reference genes, and designing fluorescent quantitative PCR primers thereof;
the nucleotide sequences of the 12 internal reference genes are SEQ ID NO 1-12 in sequence, and the nucleotide sequences of forward primers and reverse primers of the 12 internal reference genes are designed by primer5.0 software to be SEQ ID NO 13-36 in sequence;
(2) in each development stage, the cordyceps militaris cultured in reference example 1 is continuously cultured to a hyphal stage (day 30), a primordial stage (day 40), an elongation stage (day 50) and a maturation stage (day 65) at the first 22 ℃ per day, and then is subjected to shading treatment for 10 hours at the second 17 ℃, cordyceps militaris hypha samples in the hyphal stage and cordyceps militaris fruiting body samples in the primordial stage, the elongation stage and the maturation stage are respectively collected, total RNA is immediately extracted, the concentration of RNA is determined, the RNA is subjected to reverse transcription to synthesize cDNA, then the cDNA is used as a template, and the primers in the step (1) are used for analyzing the alternative reference gene by using real-time fluorescence quantitative PCR;
the extraction method of the RNA comprises the following steps: adding liquid nitrogen into 0.2g of cordyceps militaris hypha or fruiting body sample, grinding into fine powder, adding 500 mu L of Trizol reagent, and manually homogenizing for 5min, wherein the steps are finished according to the Trizol reagent instruction;
the method for detecting the quality and the concentration of the RNA comprises the following steps: taking 1 mu L of RNA sample, detecting that the OD260/280 value is 2.0 by using NanoDrop2000, and detecting that the concentration is 900 ng/mu L by using NanoDrop 2000;
first strand cDNA Synthesis: reverse transcription was performed using 3. mu.g RNA, the procedure was performed according to the Thermo Fisher reverse transcription kit instructions;
the real-time fluorescent quantitative PCR amplification system consists of 1 mu L of cDNA, 10 mu L of 2X PCR buffer Mix, 1 mu L of forward primer, 1 mu L of reverse primer and 7 mu L of double distilled water, and the length results of amplified fragments are shown in Table 1;
the reaction system of the real-time fluorescent quantitative PCR consists of 1 mu L of cDNA (which is respectively diluted into 5 diluents with different concentrations, namely 3 mu g, 0.3 mu g, 0.03 mu g, 0.003 mu g and 0.0003 mu g of total RNA), 10 mu L of 2 XTaq SYBR Green fluorescent reagent, 1 mu L of forward primer, 1 mu L of reverse primer and 7 mu L of double distilled water;
the reaction conditions of the real-time fluorescent quantitative PCR are as follows: pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 10s, annealing at 55 ℃ for 30s for 40 cycles, then performing melting curve analysis at 55-95 ℃, and collecting fluorescence signals every 0.5 ℃ by a CFX96 instrument; each sample was set for 3 technical replicates;
3 biological repetitions are set for inducing cordyceps militaris fruiting body development under the same conditions;
(3) performing internal reference gene Ct value stability analysis on real-time fluorescent quantitative PCR data by adopting GeNorm, NormFinder and BestKeeper software, thereby screening out the most stably expressed internal reference gene in the development stage of the cordyceps militaris sporocarp;
the GeNorm software obtains variation values V compared in pairs through standardized factor pairing difference analysis, finally, a proper reference gene number is selected, when the Vn/n +1 value is smaller than a threshold value of 0.15, the most proper gene reference number is n, and the first n genes are selected as reference genes; the NormFinder software directly calculates the expression stability value M of each gene, and the expression stability value M is sorted according to the size of the value M, and the smaller the value M is, the higher the stability is; the BestKeeper software determines the most suitable reference genes through the original Ct value and the primer amplification efficiency, and sequences the most suitable reference genes in sequence, wherein the reference genes with the stability value less than 1 are qualified as stable reference genes.
In the step (2), agarose gel electrophoresis is adopted to detect whether the length of the amplified fragment is consistent with that of the selected target fragment, and then a PCR product is recovered and sequenced for verification.
In the step (2), the amplification efficiency of the primers is given by a CFX96 instrument under different cDNA concentrations, whether the primers are suitable is judged according to whether the amplification efficiency (%) is between 90-110%, and the results are shown in Table 1.
TABLE 1 primer sequence, amplification length and amplification efficiency table of Cordyceps militaris in vivo candidate internal reference gene amplified by real-time fluorescence quantitative PCR
As can be seen from Table 1, the primers designed above can effectively amplify target fragments, which are consistent in size with the designed target fragments, and have single band and no specific amplification; the amplification efficiency is 95.5-106.2%, and the primer has high amplification efficiency.
As shown in FIG. 1, Ct values of 12 different candidate reference genes obtained by CFX96 instrument have great variation, with Ct being 15.5 at minimum and 28.9 at maximum. The Ct value variation is the primary screening condition for whether the internal reference gene can be used, the proper Ct value of the internal reference gene needs to be moderate and is about 15-25, and the gene with over-high expression (small Ct value) or over-low expression (large Ct value) is not suitable for being used as the internal reference gene. In addition, the large Ct change of different genes indicates that the expression quantity of the genes at each development stage of the cordyceps militaris sporocarp is not constant and is in a changed state.
TABLE 2 stability table of each alternative reference gene expression in 4 developmental stages of cordyceps militaris fruiting body
As can be seen from Table 2 and FIG. 2, the GeNorm software analysis shows that the stability of the candidate reference genes is from low to high, wherein PGK < GTPB < ACTIN < FBOX < RPS < UBC < PP2A < CYP < GAPDH < EF-1 α < UBQ < TUB, and UBQ and TUB are most stable, and the NormFinder software analysis shows that the stability of the candidate reference genes is from low to high, wherein PGK < GTPB < ACTIN < FBOX < RPS < PP2A < UBC < UBQ < GAPDH < EF-1 α < TUB, and CYP are most stable, and the stability results of the GeNorm and NormFinder software analysis show that the average first reference gene is TUB, the second name is EF-1 α, and the Bekepier software analysis shows that the stability values of the first two reference genes and the EF-1 α, and the stability results of the Cordyceps militaris are less than the TUB stability results of the first two previous Cordyceps militaris development stages, and the stability results of the TUB is less than the TUB 3.
As shown in FIG. 3, analysis of the number of the most suitable reference genes by GeNorm software revealed V
2/3Less than 0.15 (when the Vn/n +1 value is less than the threshold value of 0.15, the most suitable gene internal reference number is n), which indicates that when the fluorescence quantitative PCR detection is carried out at each development stage of the cordyceps militaris sporocarp, the most suitable internal reference number is 2, namely TUB and EF-1 α.
The most suitable internal reference gene for each development stage of the cordyceps militaris sporocarp screened by the 3 software analysis methods is TUB, the nucleotide sequence of the internal reference gene is SEQ ID NO. 1, and the nucleotide sequences of the forward primer and the reverse primer of the TUB are SEQ ID NO. 13-14 in sequence.
The application of the reference gene in the development stage of the cordyceps militaris sporocarp comprises the following steps: detecting relative expression amounts of PLA, PLC and PLD in different development stages of the cordyceps militaris sporocarp cultured in reference example 1 by using TUB as an internal reference gene and using real-time fluorescent quantitative PCR; the nucleotide sequences of the PLA, the PLC and the PLD are SEQ ID NO: 37-39; designing the nucleotide sequences of forward and reverse primers of the PLA, the PLC and the PLD to be 40-45 SEQ ID NO by using primer5.0 software; the method for testing the relative expression quantity of the cordyceps militaris fruiting bodies in different development stages is the same as the step (2) in the embodiment; the primer sequences, amplification lengths and amplification efficiencies of PLA, PLC and PLD in vivo of Cordyceps militaris amplified by real-time fluorescence quantitative PCR are shown in Table 3.
TABLE 3 primer sequences, amplification lengths and amplification efficiencies of PLA, PLC and PLD in Cordyceps militaris body amplified by real-time fluorescence quantitative PCR
As can be seen from Table 3, the primers designed above can effectively amplify target fragments, which are identical in size to the designed target fragments, single in band and free of specific amplification; the amplification efficiency is 97.2-104.5%, and the primer has high amplification efficiency.
In order to evaluate the gene expression amount of PLA, PLC and PLD, data collected by fluorescence quantitative PCR were processed, △△ Ct (△ Ct treatment sample) (primordial phase, elongation phase and maturation phase) - △ Ct control sample (hypha phase), △ Ct (△ Ct target gene) - △ Ct internal reference gene, and the significance of differences among samples was statistically analyzed by GraphPad Prism 6 software.
As shown in FIGS. 4-6, the relative expression levels of PLA, PLC and PLD genes of the fruiting body of Cordyceps militaris at different developmental stages are all significantly increased; PLA was 6-fold, PLC 16-fold, and PLD 14-fold during elongation, compared to control samples.
In conclusion, the most stable internal reference gene TUB in the cordyceps militaris body at different development stages of the cordyceps militaris sporocarp is screened out, and the TUB is taken as the internal reference gene, and the cordyceps militaris phospholipase protein genes PLA, PLC and PLD are taken as target genes, so that the expression rules of the cordyceps militaris PLA, PLC and PLD genes at different development stages of the cordyceps militaris sporocarp are determined. The screened internal reference gene TUB is suitable for analyzing the expression profiles of target genes in the cordyceps militaris fruiting body at different development stages, and provides a reference for quantitative PCR experiments of the genes of the cordyceps militaris fruiting body at different development stages.
Sequence listing
<110> technical university of the middle and south forestry
<120> cordyceps militaris sporocarp development stage internal reference gene, primer, screening method and application
<160>45
<170>SIPOSequenceListing 1.0
<210>1
<211>208
<212>DNA
<213> Cordyceps militaris (cordyces militaris)
<400>1
atgtcgttcg tcgtgaggcc gaaggctgcg actgccttca gggtttccag atcacccact 60
ctctcggtgg tggtactggt gctggtatgg gtactctgct catctccaag atccgcgaag 120
agtttcccga ccgcatgatg gccaccttct ccgttgtcccctcccccggc aactccgaca 180
ccgttgtcga accctacaac gccactct 208
<210>2
<211>200
<212>DNA
<213> Cordyceps militaris (cordyces militaris)
<400>2
tatcggaact gtgcctgtcg gccgtgtcga gactggtatc atcaagcccg gcatggtcgt 60
cacctttgcc ccctccatgg tcagcactga agtcaagtcc gtcgagatgc accacgagca 120
gctggctcag ggtgttcccg gtgacaacgt cggcttcaac gtgaagaacg tttccgtcaa 180
ggaaatccgt cgtggtaacg 200
<210>3
<211>204
<212>DNA
<213> Cordyceps militaris (cordyces militaris)
<400>3
accattgaca cgagccagtt tgcccaaccg tccgccgccg cccccgtaga cgatgctcag 60
agatacaacg ggtacaacaa acgcatggtc gacaagttta cttccatggg gtttgacgta 120
gaggccgtcg tcgacgcctt tcggcttgtg ggcatcgatc gtaacaacgg ccactattac 180
gagcttgagg aggcttacat gggc 204
<210>4
<211>181
<212>DNA
<213> Cordyceps militaris (cordyces militaris)
<400>4
taagaagccc aagaagaaaa aggtgctgct gatgggcaag tcgggctctg gcaagtcgag 60
catgcggagc atcatcttca gcaactacat tgcgcgcgac acgcgccgac tcggcgcaac 120
cattgacatt gacctctcgc acgtcaagtt cctcggcaac ctcacgctga acctgtggga 180
c 181
<210>5
<211>182
<212>DNA
<213> Cordyceps militaris (cordyces militaris)
<400>5
aagtggtcta agggcaaggt caaggacaag gcccagcacg ccgtccttct cgacaagacc 60
accgccgaga agctctacaa ggatgtccag tcctaccgcc tggtcaccgt tgctgttctc 120
gtggaccgta tgaagatcaa cggctccctg gcccgccagt gcattaccga cctggaggag 180
aa 182
<210>6
<211>219
<212>DNA
<213> Cordyceps militaris (cordyces militaris)
<400>6
caacaacttc ctgacgggcc tgagctcgta ctttgaaaag gcgagcacca cgcccaccgg 60
ccgcaagatt gccaagttct acaccgacgg ctcccgccag gtccaggaca tccacgccga 120
ggcccgccgc ctcgccgacc tgaagaagga gaaccatggg ggcagcgcct acaaggccgc 180
cggcctcgag cgcgtctttg gtcagcagaa gcccaagga 219
<210>7
<211>224
<212>DNA
<213> Cordyceps militaris (cordyces militaris)
<400>7
ccgatgacaa cgacagcgac gcctccgtct tcaacccgga taacacctcc cctaagaatt 60
cgcgccagct tctgagtccg cgcgagcgtg cacagcgtcg ccaggcccgc gaggaggccg 120
cgacgctctc catgacacca tcaattttcc cgacatggaa gagcatgttc cgccggcgcc 180
cgcgcatccg cttcgacggg tgctacatct ccacggtcaa ctac 224
<210>8
<211>197
<212>DNA
<213> Cordyceps militaris (cordyces militaris)
<400>8
ttttccgcct tattccaccc gaagctcaag cacctcgagc gcggcaccgt cagcatggca 60
acggccccat ccacgacgga cccagatatc cgcgtggccg gctcccagtt catcatcacc 120
ctcggcgagg acacagactt tttagacggc aaggccgcca tctttggcaa ggtcgtcgag 180
ggatttgatg ctctgga 197
<210>9
<211>220
<212>DNA
<213> Cordyceps militaris (cordyces militaris)
<400>9
catccactcc tacactgcta cccagaagac tgtcgatggc ccctctgcca aggattggcg 60
cggtggccgt ggtgccgctc agaacatcat cccctccagc actggtgccg ccaaggctgt 120
cggcaaggtc attcctgagc tcaacggcaa gcttactggc atgtccatgc gtgtccctac 180
cgccaacgtt tccgttgtcg acctgactgt tcgtcttgag 220
<210>10
<211>198
<212>DNA
<213> Cordyceps militaris (cordyces militaris)
<400>10
cctcctacag tcgtcatcag cccgactccc ggccatgtcc cacctccagg tgccgccgag 60
acgatgccgc acgacctggc ccccccaaag tctggccaaa agtcgctcat gattcaccgc 120
ggaatagata accgcgatgc tattcccgag gggcttcgaa cgcccaagcg acaacactca 180
tctcgctttg acatttct 198
<210>11
<211>159
<212>DNA
<213> Cordyceps militaris (cordyces militaris)
<400>11
gctcaagccc gtcgtttcgg agctcgagaa gcagctgggc aagtcggtca cgtttgcgcc 60
cgactgcgtc ggccccgagg tggagaagat tgtcaatggt gccgacaccg gcgccgtcat 120
cctgctcgag aacctgcgct tccacattga ggaggaggg 159
<210>12
<211>209
<212>DNA
<213> Cordyceps militaris (cordyces militaris)
<400>12
tcaaagaaga taatggtaac gtgacggcac acacatggtc aatgggcgag cagcagtgga 60
tcaatgttgg cacggtagtg gacgcggtcg gtagtacagg gaagaaggtc gaatacaagg 120
gcaagtccta cgactttgtg tttgacgtgg acattgagga cggtaagcca ccgctgaagt 180
tgccatataa cctttccgag aacccatac 209
<210>13
<211>18
<212>DNA
<213> Artificial sequence
<400>13
atgtcgttcg tcgtgagg 18
<210>14
<211>18
<212>DNA
<213> Artificial sequence
<400>14
agagtggcgt tgtagggt 18
<210>15
<211>18
<212>DNA
<213> Artificial sequence
<400>15
tatcggaact gtgcctgt 18
<210>16
<211>18
<212>DNA
<213> Artificial sequence
<400>16
cgttaccacg acggattt 18
<210>17
<211>20
<212>DNA
<213> Artificial sequence
<400>17
<210>18
<211>19
<212>DNA
<213> Artificial sequence
<400>18
gcccatgtaa gcctcctca 19
<210>19
<211>20
<212>DNA
<213> Artificial sequence
<400>19
<210>20
<211>18
<212>DNA
<213> Artificial sequence
<400>20
gtcccacagg ttcagcgt 18
<210>21
<211>19
<212>DNA
<213> Artificial sequence
<400>21
aagtggtcta agggcaagg 19
<210>22
<211>19
<212>DNA
<213> Artificial sequence
<400>22
ttctcctcca ggtcggtaa 19
<210>23
<211>19
<212>DNA
<213> Artificial sequence
<400>23
caacaacttc ctgacgggc 19
<210>24
<211>19
<212>DNA
<213> Artificial sequence
<400>24
tccttgggct tctgctgac 19
<210>25
<211>20
<212>DNA
<213> Artificial sequence
<400>25
<210>26
<211>20
<212>DNA
<213> Artificial sequence
<400>26
<210>27
<211>19
<212>DNA
<213> Artificial sequence
<400>27
ttttccgcct tattccacc 19
<210>28
<211>19
<212>DNA
<213> Artificial sequence
<400>28
tccagagcat caaatccct 19
<210>29
<211>21
<212>DNA
<213> Artificial sequence
<400>29
catccactcc tacactgcta c 21
<210>30
<211>20
<212>DNA
<213> Artificial sequence
<400>30
<210>31
<211>21
<212>DNA
<213> Artificial sequence
<400>31
cctcctacag tcgtcatcag c 21
<210>32
<211>18
<212>DNA
<213> Artificial sequence
<400>32
agaaatgtca aagcgaga 18
<210>33
<211>18
<212>DNA
<213> Artificial sequence
<400>33
gctcaagccc gtcgtttc 18
<210>34
<211>18
<212>DNA
<213> Artificial sequence
<400>34
ccctcctcct caatgtgg 18
<210>35
<211>21
<212>DNA
<213> Artificial sequence
<400>35
tcaaagaaga taatggtaac g 21
<210>36
<211>20
<212>DNA
<213> Artificial sequence
<400>36
gtatgggttc tcggaaaggt 20
<210>37
<211>145
<212>DNA
<213> Cordyceps militaris (cordyces militaris)
<400>37
gaagtacctg cacgaaaccc gcgaccaata tctaccttga aaagaaatgg aaagccggtt 60
ctacgcatgg acactgtcct cctaggcatc tactacccag gggacttgcg aaaggaggcc 120
aacagcaagg atggtctcaa gggca 145
<210>38
<211>183
<212>DNA
<213> Cordyceps militaris (cordyces militaris)
<400>38
tgccattgga aacagacctc cgattccgta tggcgaggcg aatgcaaagc aagatatggc 60
gtcgctggtg gaagagggtt tcaagactat gcgtggacag ccgactgaag ggcgctacgt 120
ggtattcgag actgatgggt ttgcgctgac caacattggc aacactgtcg gtattagcaa 180
ggg 183
<210>39
<211>116
<212>DNA
<213> Cordyceps militaris (cordyces militaris)
<400>39
acgacatcaa cgcacagccg ccgagcgtca acccggaaaa cgacatatac gaccgggacg 60
agagctacaa gtttgttgaa gatccactag gcgatgagct ctgggaccta tggacc 116
<210>40
<211>19
<212>DNA
<213> Artificial sequence
<400>40
gaagtacctg cacgaaacc 19
<210>41
<211>17
<212>DNA
<213> Artificial sequence
<400>41
tgcccttgag accatcc 17
<210>42
<211>18
<212>DNA
<213> Artificial sequence
<400>42
tgccattgga aacagacc 18
<210>43
<211>19
<212>DNA
<213> Artificial sequence
<400>43
cccttgctaa taccgacag 19
<210>44
<211>17
<212>DNA
<213> Artificial sequence
<400>44
acgacatcaa cgcacag 17
<210>45
<211>17
<212>DNA
<213> Artificial sequence
<400>45
ggtccatagg tcccaga 17
Claims (9)
1. An internal reference gene of a cordyceps militaris fruiting body in a development stage is characterized in that: the internal reference gene is TUB, and the nucleotide sequence of the TUB is SEQ ID NO: 1.
2. The internal reference gene of the cordyceps militaris fruiting body development stage according to claim 1, wherein the internal reference gene comprises: the development stage comprises a hyphal stage, an primordial stage, an elongation stage and a maturation stage.
3. A primer of the reference gene in the development stage of the fruiting body of Cordyceps militaris as claimed in claim 1 or 2, wherein: the nucleotide sequences of the forward primer and the reverse primer of the TUB are SEQ ID NO 13-14 in sequence.
4. A method for screening the reference gene in the development stage of the fruiting body of Cordyceps militaris as claimed in claim 1 or 2, comprising the steps of:
(1) selecting 12 reference genes TUB, EF-1 α, UBC, GTPB, RPS, ACTIN, FBOX, CYP, GAPDH, PP2A, PGK and UBQ as alternative reference genes, and designing fluorescent quantitative PCR primers thereof;
(2) inducing the development of cordyceps militaris sporocarp, respectively collecting cordyceps militaris hypha samples in hypha stage and cordyceps militaris sporocarp samples in primordial stage, elongation stage and maturation stage, immediately extracting total RNA, determining RNA concentration, carrying out reverse transcription on the RNA to synthesize cDNA, and then analyzing the alternative reference gene by using the primer in the step (1) and real-time fluorescence quantitative PCR (polymerase chain reaction) by using the cDNA as a template;
(3) and performing internal reference gene Ct value stability analysis on the real-time fluorescent quantitative PCR data by adopting GeNorm, NormFinder and BestKeeper software, thereby screening the internal reference gene most stably expressed in the development stage of the cordyceps militaris sporocarp.
5. The method for screening the reference gene in the development stage of the fruiting body of Cordyceps militaris as claimed in claim 4, wherein: in the step (1), the nucleotide sequences of the 12 reference genes are SEQ ID NO 1-12 in sequence; the forward primers and the reverse primers of the 12 reference genes are designed by using primer5.0 software; the nucleotide sequences of the forward primers and the reverse primers of the 12 reference genes are SEQ ID NO 13-36 in sequence.
6. The method for screening the reference gene in the development stage of the fruiting body of Cordyceps militaris according to claim 4 or 5, wherein the method comprises the following steps: in the step (2), the culture conditions of the cordyceps militaris are as follows: inoculating Cordyceps militaris mycelium into a glass bottle containing a rice culture medium, and performing constant-temperature light-shielding culture until the mycelium overgrows the rice culture medium; the formula of the rice culture medium is as follows: uniformly mixing the rice, the silkworm chrysalis powder and the nutrient solution according to a solid-to-liquid ratio of 30-50: 1: 40-60; the formula of the nutrient solution is as follows: each 1000mL of distilled water contains 15-25 g of glucose and KH
2PO
41～3g、MgSO
40.5-1.5 g, 0.5-1.5 g of ammonium citrate, 4-6 g of peptone and 115-25 mg of vitamin B; the temperature of the constant-temperature shading culture is 20-28 ℃, and the time is 20-30 days; the method for inducing the development of the cordyceps militaris sporocarp comprises the following steps: under the circulation induction of temperature and illumination, continuously culturing the cordyceps militaris to a hypha stage, a primordial stage, an elongation stage and a maturation stage; the cyclic induction of temperature and light is as follows: in each development stage, the illumination treatment is carried out for 12-16 h at the temperature of 20-25 ℃ every day, and then the shading treatment is carried out for 8-12 h at the temperature of 15-20 ℃; the hypha period is 28-32 days, the primordial period is 38-42 days, the elongation period is 48-52 days, and the maturation period is 60-70 days; the real-time fluorescent quantitative PCR amplification system consists of cDNA, PCR buffer Mix, a forward primer, a reverse primer and double distilled water in a volume ratio of 1: 8-12: 1:1: 5-10; diluting the cDNA into 4-8 diluents with different concentrations according to an equal ratio of 10 times as a template; the reaction system of the real-time fluorescence quantitative PCR consists of cDNA diluent, a fluorescence reagent, a forward primer, a reverse primer and double distilled water in a volume ratio of 1: 8-12: 1:1: 5-10; the reaction conditions of the real-time fluorescent quantitative PCR are as follows: pre-denatured at 90-95 ℃ for 25-35 s and denatured at 90-95 ℃ for 5 ℃Annealing at 50-60 ℃ for 25-35 s for 15s, carrying out 30-50 cycles, then carrying out melting curve analysis at 55-95 ℃, and collecting fluorescence signals every 0.5 ℃.
7. The method for screening the reference gene in the development stage of the fruiting body of Cordyceps militaris according to any one of claims 4 to 6, wherein the method comprises the following steps: in the step (3), the GeNorm software obtains variation values V of pairwise comparison through standardized factor pairing difference analysis, and finally selects the number of the suitable reference genes, when the Vn/n +1 value is smaller than the threshold value of 0.15, the number of the most suitable gene reference is n, and the first n genes are selected as the reference genes; the NormFinder software directly calculates the expression stability value M of each gene, and the expression stability value M is sorted according to the size of the value M, and the smaller the value M is, the higher the stability is; the BestKeeper software determines the most suitable reference genes through the original Ct value and the primer amplification efficiency, and sequences the most suitable reference genes in sequence, wherein the reference genes with the stability value less than 1 are qualified as stable reference genes.
8. The use of the reference gene in the development stage of the fruiting body of Cordyceps militaris as claimed in claim 1 or 2, wherein: and detecting the relative expression quantity of a target gene related to the development of the fruiting body of the cordyceps militaris at different development stages by using the TUB as an internal reference gene and using real-time fluorescent quantitative PCR.
9. The application of the reference gene in the development stage of the fruiting body of Cordyceps militaris (L.) Link as claimed in claim 8, wherein: the target gene related to fruiting body development is a phospholipase protein gene; the phospholipase protein gene is PLA, PLC or PLD; the nucleotide sequences of the PLA, the PLC and the PLD are SEQ ID NO: 37-39; forward and reverse primers of the PLA, the PLC and the PLD are designed by primer5.0 software; the nucleotide sequences of the forward primers and the reverse primers of the PLA, the PLC and the PLD are SEQ ID NO:40-45 in sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911237280.7A CN110777217B (en) | 2019-12-05 | 2019-12-05 | Cordyceps militaris fruiting body development stage reference gene, primer, screening method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911237280.7A CN110777217B (en) | 2019-12-05 | 2019-12-05 | Cordyceps militaris fruiting body development stage reference gene, primer, screening method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110777217A true CN110777217A (en) | 2020-02-11 |
| CN110777217B CN110777217B (en) | 2023-09-05 |
Family
ID=69394280
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911237280.7A Active CN110777217B (en) | 2019-12-05 | 2019-12-05 | Cordyceps militaris fruiting body development stage reference gene, primer, screening method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110777217B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112210617A (en) * | 2020-08-24 | 2021-01-12 | 浙江省农业科学院 | Reference gene suitable for research on growth and development of phellinus igniarius and screening method of reference primer thereof |
| CN112501183A (en) * | 2020-12-14 | 2021-03-16 | 云南农业大学 | Fluorescence quantitative reference gene for different growth time periods of Chinese yam as well as primer and application thereof |
| CN113151505A (en) * | 2021-05-19 | 2021-07-23 | 南京林业大学 | Fluorescent quantitative reference gene for different population densities of fall webworms and primers and application thereof |
-
2019
- 2019-12-05 CN CN201911237280.7A patent/CN110777217B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| GENBANK: "XM_006669203.1", 《GENBANK》 * |
| TIANTIAN LIAN等: "Reliable reference gene selection for Cordyceps militaris gene expression studies under different developmental stages and media", 《FEMS MICROBIOL LETT》 * |
| 鲍大鹏等: "蛹虫草凝集素编码基因JRL-ccm4的初步研究", 《上海农业学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112210617A (en) * | 2020-08-24 | 2021-01-12 | 浙江省农业科学院 | Reference gene suitable for research on growth and development of phellinus igniarius and screening method of reference primer thereof |
| CN112210617B (en) * | 2020-08-24 | 2022-05-10 | 浙江省农业科学院 | Reference gene suitable for research on growth and development of phellinus igniarius and screening method of reference primer thereof |
| CN112501183A (en) * | 2020-12-14 | 2021-03-16 | 云南农业大学 | Fluorescence quantitative reference gene for different growth time periods of Chinese yam as well as primer and application thereof |
| CN112501183B (en) * | 2020-12-14 | 2022-11-08 | 云南农业大学 | Fluorescence quantitative reference gene for different growth time periods of Chinese yam as well as primer and application thereof |
| CN113151505A (en) * | 2021-05-19 | 2021-07-23 | 南京林业大学 | Fluorescent quantitative reference gene for different population densities of fall webworms and primers and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110777217B (en) | 2023-09-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110777217B (en) | Cordyceps militaris fruiting body development stage reference gene, primer, screening method and application | |
| CN112280687A (en) | Mushroom-Jian-Hypsizygus marmoreus GJ5 strain, SSR marker primer and application thereof | |
| CN110791586B (en) | SSR (simple sequence repeat) marker primer group for identifying Chinese chestnut varieties and application thereof | |
| CN110791585B (en) | Internal reference gene, primer, screening method and application of cordyceps militaris mycelium under cold stress | |
| Guerin-Laguette et al. | Identification of a prevalent Tricholoma matsutake ribotype in Japan by rDNA IGS1 spacer characterization | |
| CN109207634B (en) | Fluorescent quantitative reference gene under drought stress of Changsha dichroa and special primer and application thereof | |
| CN113774065B (en) | Fluorescent quantitative internal reference gene for different adults of fall webworm, primer and application thereof | |
| CN108359738B (en) | Torreya sinensis EST-SSR primer and variety fingerprint construction method | |
| CN114107542B (en) | DNA bar code for identifying origin of agrocybe aegerita, primer group and application | |
| CN116121440A (en) | Molecular marker closely linked with major QTL locus of sesame golden yellow grains and application of molecular marker | |
| CN114107541B (en) | DNA bar code for screening index of total soluble amino acid content of agrocybe aegerita | |
| CN114134248B (en) | DNA bar code for screening index of total polyphenol content of agrocybe aegerita | |
| CN115873978B (en) | Application of special-shaped rhizopus root cyst mycorrhizal symbiotic early marker gene RiPde2 | |
| CN108728453A (en) | A kind of giant pumpkin EF1- α genes and its application | |
| CN113046460B (en) | Leek reference gene under gray mold stress condition, primer of reference gene and application | |
| CN108165655A (en) | A kind of SSR marker SP_SSR19 with spinach male close linkage and its application in spinach sex identification | |
| CN107653250B (en) | Acer palmatum reference gene and application thereof | |
| CN113755497A (en) | Screening and application of reference gene in development process of taro corm | |
| CN106755541B (en) | Molecular marker, primer and probe for identifying lyophyllum decastes | |
| CN102559923B (en) | Method of quickly identifying category of pathogenic bacteria of fungal diseases in chrysanthemum | |
| CN117025810B (en) | Internal reference gene combination for expression analysis of pseudokanbrix drop genes and application thereof | |
| CN106480231B (en) | Multiple RT-PCR method for simultaneously detecting citrus yellow vein clearing virus and tristeza virus and application thereof | |
| CN108165654A (en) | SSR marker SP_SSR04 and its application with spinach male close linkage | |
| CN110669862B (en) | Molecular marker related to peanut crown rot resistance and application thereof | |
| CN113005220B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes J1011 strain, construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |