CN110777188B - Method for detecting glutamic acid content by enzyme method and application thereof - Google Patents

Method for detecting glutamic acid content by enzyme method and application thereof Download PDF

Info

Publication number
CN110777188B
CN110777188B CN201911053004.5A CN201911053004A CN110777188B CN 110777188 B CN110777188 B CN 110777188B CN 201911053004 A CN201911053004 A CN 201911053004A CN 110777188 B CN110777188 B CN 110777188B
Authority
CN
China
Prior art keywords
glutamic acid
solution
concentration
enzyme
detecting
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201911053004.5A
Other languages
Chinese (zh)
Other versions
CN110777188A (en
Inventor
花强
朱虹
董辉
金维荣
邓伟伟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Qianghao Biotechnology Co ltd
Shenyou Genomics Research Institute Nanjing Co ltd
Original Assignee
Shanghai Qianghao Biotechnology Co ltd
Shenyou Genomics Research Institute Nanjing Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Qianghao Biotechnology Co ltd, Shenyou Genomics Research Institute Nanjing Co ltd filed Critical Shanghai Qianghao Biotechnology Co ltd
Priority to CN201911053004.5A priority Critical patent/CN110777188B/en
Publication of CN110777188A publication Critical patent/CN110777188A/en
Application granted granted Critical
Publication of CN110777188B publication Critical patent/CN110777188B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/26—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving oxidoreductase
    • C12Q1/32—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving oxidoreductase involving dehydrogenase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
    • C12Q1/52—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase involving transaminase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6806—Determination of free amino acids
    • G01N33/6812—Assays for specific amino acids

Abstract

The invention relates to a method for detecting glutamic acid content by an enzymatic method and application thereof, and glycine aminotransferase AT is utilized 2 And a double enzyme coupling system of 3-phosphoglycerate dehydrogenase SerA, and determining the content of glutamic acid; the method for detecting the glutamic acid content by the enzyme method overcomes the defect that the traditional glutamic acid dehydrogenase method is not suitable for high-concentration ammonia environment, and creatively passes through glycine aminotransferase AT 2 And 3-phosphoglycerate dehydrogenase SerA double enzyme coupling method, deaminizing glutamic acid to form alpha-ketoglutarate, and rapidly and correctly characterizing glutamic acid content in the system by reducing NADH content through reduction reaction of the alpha-ketoglutarate. The invention has the advantages of high sensitivity, rapid and stable detection, good repeatability, simple operation, lower cost and wider application range.

Description

Method for detecting glutamic acid content by enzyme method and application thereof
Technical Field
The invention relates to the technical field of enzymatic detection, in particular to a method for detecting glutamic acid content by an enzymatic method and application thereof.
Background
The current methods for detecting glutamic acid mainly comprise liquid chromatography, ion chromatography, spectrophotometry and the like. The liquid chromatography and the ion chromatography have high analysis sensitivity and good separation effect, are suitable for analysis and determination of complex samples, but in the method for determining glutamic acid by partial liquid chromatography, derivatization treatment is needed for the samples, and the two instruments have high cost, time consumption and high cost, and are not suitable for analysis and determination of high-flux samples.
The detection system for determining the content of the glutamic acid by the traditional spectrophotometry is mainly based on glutamate dehydrogenase, and the method has the advantages of simplicity in operation, low cost and rapidness in detection. However, when the method is used for detecting blood samples, urine samples and other samples containing high-concentration ammonia, the normal reaction is inhibited due to the existence of the high-concentration ammonia in the system, and the accurate result of the glutamic acid content in the samples cannot be obtained. This limits the use of glutamate dehydrogenase and its kits in such samples.
Disclosure of Invention
The invention provides a method for detecting the content of glutamic acid by an enzyme method and application thereof, aiming at the defects in the prior art, so as to solve the problems in the prior art.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
the method for detecting the content of the glutamic acid by using an enzymatic method utilizes a double-enzyme coupling system of glycine aminotransferase AT2 and 3-phosphoglycerate dehydrogenase SerA to realize the determination of the content of the glutamic acid;
wherein the nucleotide sequence of glycine aminotransferase AT2 shown in the sequence table SEQ ID No. 1 is as follows:
ATGTATCAGGAAAGGCTCTTCACACCAGGACCTGTTGAGATCCCCGATAGAGTAAGGGAAGCTCTGGGAAGGCAGATTATCCATCACAGGACAGAAGAGTTCAGGCGCGCCTTTTTGGAAGTGCGAGAACTCCTCAAGAGACTGCTGGATGACCCATCAGAGAACTTCGTCTTTTTCTCATCTTCGGGCACAGGTGCCATGGAAGCGGCTATTCTGAACTTCTTTGAAGAAGGTCAGAAGGTGCTGGTGGTAAACGGCGGAAAGTTTGGCGAGAGATGGTTTTTGCTGGCAAAACACTGGGGGCTTGAGGTTGTGGAGTACAGACTGGACTGGGGCAAGTCCGCAGACCCCGAAAAAGTCAAGGATCTGCTTAAAAAGCATCCCGATTGCAAGGGTGTGCTTCTTCAAATATCAGAAACATCTACAGGTGCTTACCACCCTGTTGAAGATATAGCGGAGGTTTGCAAAAGTGCAGACGCTCTTTTGGTAGCTGATGCCATAACAGCCTTGGGAGTTTATAACTTAAAGCCTTCGGTGGGCATTGATGTAATGGTAGGTGGGTCCCAGAAGGCTCTTATGCTTCCACCTGGACTTTCTCTCCTCTGGTTCTCTCAAAAGGCAAAAGAGAGATTAAAAGACAGAGCCTTTTACTTTAGCGTAAAAAAGGAGCTTGGCAAACAGCAAGAAGGACAGACCGCGTGGACTCCTGCCATAAGCCTCCTTTTAGCTCTGAAGGAGTCTCTTAGTCTTCTTTTGCAAGAGGGAATGGAGAGAGTAGAAAAAAGGTACAGAGCCATGTCGGAGGGAACTAAGAGAGCGATAAGTGCCTTTGGTCTTGAGGTCTTCCCAGAAAGACCAGCCATATCCATAACGGCTGTAAAAAGCGACGATGCGGAAAGGATAAGAAAGGAGCTCTTAAGACATGGTATAAGGATTGCTGGAGGACAGGACCACCTTAAAGGTAAGATTTTCAGGGTTTCCCACATGGGAGTAAGTGAAAAAGATATGCTCATGCTGATAGGTGTGCTGGAGGTAGTACTAAAAAGGCTTGGTTACCCTGTGGAGCTTGGCAGCGGTGTTTGTAGATACTCACAAACTCTAGTAGAATTTGGGCTATGGTAA；
the amino acid sequence of glycine aminotransferase AT2 shown in the sequence table SEQ ID No. 2 is as follows: MYQERLFTPGPVEIPDRVREALGRQIIHHRTEEFRRAFLEVRELLKRLLDDPSENFVFFSSSGTGAMEAAILNFFEEGQKVLVVNGGKFGERWFLLAKHWGLEVVEYRLDWGKSADPEKVKDLLKKHPDCKGVLLQISETSTGAYHPVEDIAEVCKSADALLVADAITALGVYNLKPSVGIDVMVGGSQKALMLPPGLSLLWFSQKAKERLKDRAFYFSVKKELGKQQEGQTAWTPAISLLLALKESLSLLLQEGMERVEKRYRAMSEGTKRAISAFGLEVFPERPAISITAVKSDDAERIRKELLRHGIRIAGGQDHLKGKIFRVSHMGVSEKDMLMLIGVLEVVLKRLGYPVELGSGVCRYSQTLVEFGLW;
The nucleotide sequence of the 3-phosphoglycerate dehydrogenase SerA shown in the sequence table SEQ ID No. 3 is as follows: ATGGCAAAGGTATCGCTGGAGAAAGACAAGATTAAGTTTCTGCTGGTAGAAGGCGTGCACCAAAAGGCGCTGGAAAGCCTTCGTGCAGCTGGTTACACCAACATCGAATTTCACAAAGGCGCGCTGGATGATGAACAATTAAAAGAATCCATCCGCGATGCCCACTTCATCGGCCTGCGATCCCGTACCCATCTGACTGAAGACGTGATCAACGCCGCAGAAAAACTGGTCGCTATTGGCTGTTTCTGTATCGGAACAAACCAGGTTGATCTGGATGCGGCGGCAAAGCGCGGGATCCCGGTATTTAACGCACCGTTCTCAAATACGCGCTCTGTTGCGGAGCTGGTGATTGGCGAACTGCTGCTGCTATTGCGCGGCGTGCCGGAAGCCAATGCTAAAGCGCACCGTGGCGTGTGGAACAAACTGGCGGCGGGTTCTTTTGAAGCGCGCGGCAAAAAGCTGGGTATCATCGGCTACGGTCATATTGGTACGCAATTGGGCATTCTGGCTGAATCGCTGGGAATGTATGTTTACTTTTATGATATTGAAAATAAACTGCCGCTGGGCAACGCCACTCAGGTACAGCATCTTTCTGACCTGCTGAATATGAGCGATGTGGTGAGTCTGCATGTACCAGAGAATCCGTCCACCAAAAATATGATGGGCGCGAAAGAAATTTCACTAATGAAGCCCGGCTCGCTGCTGATTAATGCTTCGCGCGGTACTGTGGTGGATATTCCGGCGCTGTGTGATGCGCTGGCGAGCAAACATCTGGCGGGGGCGGCAATCGACGTATTCCCGACGGAACCGGCGACCAATAGCGATCCATTTACCTCTCCGCTGTGTGAATTCGACAACGTCCTTCTGACGCCACACATTGGCGGTTCGACTCAGGAAGCGCAGGAGAATATCGGCCTGGAAGTTGCGGGTAAATTGATCAAGTATTCTGACAATGGCTCAACGCTCTCTGCGGTGAACTTCCCGGAAGTCTCGCTGCCACTGCACGGTGGGCGTCGTCTGATGCACATCCACGAAAACCGTCCGGGCGTGCTAACTGCGCTGAACAAAATCTTCGCCGAGCAGGGCGTCAACATCGCCGCGCAATATCTGCAAACTTCCGCCCAGATGGGTTATGTGGTTATTGATATTGAAGCCGACGAAGACGTTGCCGAAAAAGCGCTGCAGGCAATGAAAGCTATTCCGGGTACCATTCGCGCCCGTCTGCTGTACTAA;
The amino acid sequence of the 3-phosphoglycerate dehydrogenase SerA shown in the sequence table SEQ ID No. 4 is as follows: MAKVSLEKDKIKFLLVEGVHQKALESLRAAGYTNIEFHKGALDDEQLKESIRDAHFIGLRSRTHLTEDVINAAEKLVAIGCFCIGTNQVDLDAAAKRGIPVFNAPFSNTRSVAELVIGELLLLLRGVPEANAKAHRGVWNKLAAGSFEARGKKLGIIGYGHIGTQLGILAESLGMYVYFYDIENKLPLGNATQVQHLSDLLNMSDVVSLHVPENPSTKNMMGAKEISLMKPGSLLINASRGTVVDIPALCDALASKHLAGAAIDVFPTEPATNSDPFTSPLCEFDNVLLTPHIGGSTQEAQENIGLEVAGKLIKYSDNGSTLSAVNFPEVSLPLHGGRRLMHIHENRPGVLTALNKIFAEQGVNIAAQYLQTSAQMGYVVIDIEADEDVAEKALQAMKAIPGTIRARLLY.
Preferably, the method for detecting the glutamic acid content by using the enzymatic method comprises the following steps of:
exogenous expression of protein and separation and purification:
(1) The combination sequence comparison analysis means selects the gene coding sequence of glycine aminotransferase AT2 and the gene coding sequence of 3-phosphoglycerate dehydrogenase SerA, and then the target genes are respectively obtained by total gene synthesis and PCR (wherein the template of serA gene cloning is the genome of E.coli E. Coli k-12 strain) to obtain the target genes of glycine aminotransferase AT2 and 3-phosphoglycerate dehydrogenase SerA;
(2) Respectively adopting molecular cloning to connect the glycine aminotransferase AT2 target gene and the 3-phosphoglycerate dehydrogenase SerA target gene obtained in the step (1) into a pET28a expression vector, respectively transferring pET28a-AT2 and pET28a-SerA plasmids which are sequenced correctly after cloning into an escherichia coli Rosetta (DE 3) strain, culturing overnight AT 37 ℃ in a test tube filled with Luria-Bertani (LB) culture medium, transferring into a shake flask filled with LB culture medium, adding IPTG with a final concentration of 1 mM when the temperature reaches 37 ℃ and 220 rpm to reach OD600 of about 0.6, and carrying out induction expression for 4 hours to respectively obtain glycine aminotransferase AT2 target protein and 3-phosphoglycerate dehydrogenase SerA target protein;
(3) Separating and purifying target protein: after collecting thalli by low-temperature centrifugation of a bacterial liquid containing target proteins, crushing thalli, centrifugally collecting supernatant, and separating and purifying the target proteins by using a nickel column for later use, wherein the target proteins comprise glycine aminotransferase AT2 target proteins and 3-phosphoglycerate dehydrogenase serA target proteins obtained in the step (2);
(II) detecting glutamic acid by a double enzyme coupling method:
(1) Preparing a reaction mixed solution:
preparing 100 mM TEA-HCl solution (pH 9.0), 100 mM sodium glyoxylate aqueous solution, 5 mM NADH solution for later use;
Preparing 500 mu l of double-enzyme mixed solution containing glycine aminotransferase AT2 and 3-phosphoglycerate dehydrogenase SerA, wherein the mixed solution contains 100 mu l of 3.4 mg/ml purified AT2 target protein and 80 mu l of 32 mg/ml purified SerA target protein, and adding 320 mu l of buffer solution B to complement to 500 mu l for later use;
the composition of buffer B is: 1L buffer B contained 2.42 g of tris, 7.45 g of potassium chloride, 200ml of glycerol, 0.154 g of dithiothreitol and was adjusted to pH 7.9 using hydrochloric acid.
The reaction mixture was prepared according to the above solution, wherein the ratio composition of the reaction mixture per 75. Mu.l comprises: TEA-HCl solution, 25. Mu.l; 10-30 μl of sodium glyoxylate aqueous solution; NADH solution, 4-5 μl; 5-10 μl of a mixed solution of double enzymes; ultrapure water was replenished to 75. Mu.l.
(2) Endpoint method glutamate concentration standard curve:
preparing a series of glutamic acid standard substance solutions with the concentration of 0-0.4 mM, respectively taking 25 mu l of each solution, respectively dripping the solutions into 96-well ELISA plates filled with 75 mu l of reaction mixed solution, slightly mixing the solutions, reacting at 30-40 ℃ for 15-30 minutes, and ending the reaction. The ratio composition of the blank reaction mixture includes: TEA-HCl solution, 25. Mu.l; 5-10 μl of a mixed solution of double enzymes; ultrapure water was replenished to 100. Mu.l. The proportional composition of the reaction mixture for the raw absorbance reading included: TEA-HCl solution, 25. Mu.l; NADH solution, 4-5 μl; 5-10 μl of a mixed solution of double enzymes; ultrapure water was replenished to 100. Mu.l. After the reaction is finished, an enzyme label instrument is used for reading the absorbance value at 340 and nm, and the change value of the absorbance is the difference between the original absorbance value reading and the rest reading. Drawing a glutamic acid concentration standard curve by taking an absorbance change value as an ordinate and the concentration of a glutamic acid standard substance solution as an abscissa;
(3) Initial speed method for preparing glutamic acid concentration standard curve
Preparing a series of glutamic acid standard substance solutions with the concentration of 0-0.4 mM, respectively taking 25 mu l of each solution and respectively dripping the solutions into a 96-well ELISA plate filled with 75 mu l of reaction mixed solution, gently mixing the solutions, and reacting for 2-10 minutes at the temperature of 30-40 ℃. The ratio composition of the blank reaction mixture includes: TEA-HCl solution, 25. Mu.l; 5-10 μl of a mixed solution of double enzymes; ultrapure water was replenished to 100. Mu.l. The change in absorbance at 340 nm was monitored using a microplate reader. And drawing a glutamic acid concentration standard curve by taking the absorbance change value at the position of 340 nm within 2-10 minutes as an ordinate and the concentration of the glutamic acid standard substance solution as an abscissa.
(III) detection of glutamic acid in urine, blood, or general biological samples:
(1) Urine treatment and detection
Endpoint method: treating urine by using a deproteinization kit, and centrifuging to obtain supernatant to obtain a urine sample; in the detection process, 25 mu l of urine is added into a 96-well ELISA plate filled with 75 mu l of reaction mixed solution, the mixture is gently mixed, and the reaction is finished after the reaction is carried out for 15-30 minutes at the temperature of 30-40 ℃. The ratio composition of the blank reaction mixture includes: TEA-HCl solution, 25. Mu.l; 5-10 μl of a mixed solution of double enzymes; ultrapure water was replenished to 100. Mu.l. The proportional composition of the reaction mixture for the raw absorbance reading included: TEA-HCl solution, 25. Mu.l; NADH solution, 4-5 μl; 5-10 μl of a mixed solution of double enzymes; urine 25. Mu.l, and ultrapure water was replenished to 100. Mu.l. After the reaction is finished, an enzyme label instrument is used for reading the absorbance value at 340 and nm, and the change value of the absorbance is the difference between the original absorbance value reading and the rest reading.
And calculating according to the change value of the absorbance of the urine sample and the glutamic acid standard curve manufactured by the end-point method to obtain the glutamic acid content of the urine.
Initial velocity method: treating urine by using a deproteinization kit, and centrifuging to obtain supernatant to obtain a urine sample; in the detection process, 25 μl of urine is added into a 96-well ELISA plate filled with 75 μl of reaction mixture, and the mixture is gently mixed, reacted for 2-10 minutes at 30-40 ℃, and the ratio composition of the blank control reaction mixture comprises: TEA-HCl solution, 25. Mu.l; 5-10 μl of a mixed solution of double enzymes; ultrapure water was replenished to 100. Mu.l. The change in absorbance at 340 nm was monitored using a microplate reader.
And calculating according to a glutamic acid standard curve manufactured by a preliminary speed method and the change value of absorbance of the urine sample within 2-10 minutes to obtain the glutamic acid content of the urine.
(2) Blood processing and testing
The blood sample used in the present invention is stored in an anticoagulant tube, and thus the blood sample contains a blood sample anticoagulant, and the anticoagulant in the blood anticoagulant tube is 10% potassium oxalate-sodium fluoride.
When the blood sample is detected, the blood sample needs to be preprocessed, and the steps are as follows: the blood in the anticoagulation tube needs to be centrifuged at a low speed to obtain plasma at 4 ℃ for 10 min at 4000 rpm, and then centrifuged at a high speed to remove impurities possibly interfering with experiments in the plasma at 4 ℃ for 14000 rpm for 10 min. After centrifugation, the supernatant was taken for measurement of glutamic acid content.
Endpoint method: blood separation to obtain plasma or serum to obtain a blood sample; in the detection process, 25 mu l of plasma or serum is taken and added into a 96-well ELISA plate filled with 75 mu l of reaction mixture, the mixture is gently mixed, the reaction is finished after 15-30 minutes at the temperature of 30-40 ℃, and the proportion composition of the blank control reaction mixture comprises: TEA-HCl solution, 25. Mu.l; 5-10 μl of a mixed solution of double enzymes; ultrapure water was replenished to 100. Mu.l. The proportional composition of the reaction mixture for the raw absorbance reading included: TEA-HCl solution, 25. Mu.l; NADH solution, 4-5 μl; 5-10 μl of a mixed solution of double enzymes; 25. Mu.l of plasma or serum was supplemented with ultrapure water to 100. Mu.l. After the reaction is finished, an enzyme label instrument is used for reading the absorbance value at 340 and nm, and the change value of the absorbance is the difference between the original absorbance value reading and the rest reading.
And calculating according to a glutamic acid standard curve prepared by an end-point method according to the change value of the absorbance of the plasma or serum sample to obtain the glutamic acid content of the blood.
Initial velocity method: blood separation to obtain plasma or serum to obtain a blood sample; in the detection process, 25 mu l of plasma or serum is taken and added into a 96-well ELISA plate filled with 75 mu l of reaction mixture, the mixture is gently mixed, the mixture is reacted for 2-10 minutes at the temperature of 30-40 ℃, and the proportion composition of the blank reaction mixture comprises: TEA-HCl solution, 25. Mu.l; 5-10 μl of a mixed solution of double enzymes; ultrapure water was replenished to 100. Mu.l. The change in absorbance at 340 nm was monitored using a microplate reader.
And calculating the glutamic acid content of the plasma or serum sample according to a glutamic acid standard curve prepared by an initial speed method and the change value of the absorbance of the plasma or serum sample within 2-10 minutes.
(3) Detection of biological samples in general
Endpoint method: the method comprises the steps of processing a general biological sample, taking a supernatant, adding 25 mu l of the biological sample into a 96-well ELISA plate with 75 mu l, lightly mixing, and ending the reaction after reacting for 15-30 minutes at 30-40 ℃, wherein the proportion composition of a blank control reaction mixture comprises: TEA-HCl solution, 25. Mu.l; 5-10 μl of a mixed solution of double enzymes; ultrapure water was replenished to 100. Mu.l. The proportional composition of the reaction mixture for the raw absorbance reading included: TEA-HCl solution, 25. Mu.l; NADH solution, 4-5 μl; 5-10 μl of a mixed solution of double enzymes; the biological sample was typically made up to 25. Mu.l with ultrapure water to 100. Mu.l. After the reaction is finished, an enzyme label instrument is used for reading the absorbance value at 340 and nm, and the change value of the absorbance is the difference between the original absorbance value reading and the rest reading. And calculating according to a glutamic acid standard curve prepared by an end point method and the change value of the absorbance of a general biological sample to obtain the glutamic acid content.
Initial velocity method: the method comprises the steps of processing a general biological sample, taking a supernatant, adding 25 mu l of the biological sample into a 96-well ELISA plate with 75 mu l, lightly mixing, reacting for 2-10 minutes at 30-40 ℃, and mixing the blank control reaction mixture in proportion: TEA-HCl solution, 25. Mu.l; 5-10 μl of a mixed solution of double enzymes; ultrapure water was replenished to 100. Mu.l. The change in absorbance at 340nm was monitored using a microplate reader.
And calculating the glutamic acid content of the plasma or serum sample according to a glutamic acid standard curve manufactured by a general biological sample absorbance change value and an initial speed method within 2-10 minutes.
Preferably, the steps of separating and purifying the target protein are as follows:
A. centrifuging the bacterial liquid containing the target protein at a low temperature, removing the supernatant, collecting bacterial cells, adding the buffer solution A, and suspending the bacterial cells in the buffer solution A. The centrifugal condition is that the reaction temperature is 4-16 ℃ and the rotating speed is 10000-12000 rpm; buffer a consisted of the following components: 1L buffer A contained 2.42 g of tris, 37.3 g of potassium chloride, 100 ml of glycerol and was adjusted to pH 7.9 using hydrochloric acid. The target protein comprises glycine aminotransferase AT2 target protein and 3-phosphoglycerate dehydrogenase serA target protein obtained in the step (2);
B. after crushing cells by using a high-pressure cell crusher, centrifuging at 10000-12000 rpm for 30-50 min at 4-16 ℃, and collecting supernatant;
C. passing the supernatant through a nickel column, eluting by using eluent containing imidazole with different concentrations, wherein the concentration of imidazole in the eluent is 20 mM-500 mM;
D. and (3) placing the enzyme solution obtained by eluting with 500 and mM in a ultrafiltration tube, centrifuging at 4-16 ℃ and 5000-6000 rpm, concentrating the protein, and adding a buffer solution B to suspend the protein in the concentration process. Buffer B consisted of the following components: 1L buffer B contained 2.42 g tris, 7.45 g potassium chloride, 200 ml glycerol, 0.154 g dithiothreitol and was adjusted to pH 7.9 using hydrochloric acid. The concentrated protein solution is packaged and stored in a refrigerator at the temperature of minus 80 ℃.
Preferably, the glycine aminotransferase in the method for detecting glutamic acid by the double enzyme coupling method adopts the following coding gene sequences: first, the homology with the coding gene sequence of glycine aminotransferase AT2 is more than 50%, and the coding protein has glycine aminotransferase activity; second, the amino acid sequence identity with glycine aminotransferase AT2 protein is greater than 40%, and the encoded protein has glycine aminotransferase activity.
Preferably, the double enzyme coupling method for detecting 3-phosphoglycerate dehydrogenase in the glutamic acid method adopts the following coding gene sequences: first, the homology with the coding gene sequence of 3-phosphoglycerate dehydrogenase SerA is more than 50%, and the coding protein has the gene sequence of 3-phosphoglycerate dehydrogenase activity; second, the amino acid sequence identity with the 3-phosphoglycerate dehydrogenase serA protein is greater than 40%, and the encoded protein has 3-phosphoglycerate dehydrogenase activity.
The invention also comprises application of the method for detecting the glutamic acid content by the enzyme method, which is used for developing a glutamic acid detection kit. For example, according to the principle of determining the glutamic acid content by the double enzyme coupling method of the present invention, the AT2 and Sera prepared according to the steps of the present invention, together with 100 mM TEA-HCl solution (pH 9.0), 100 mM sodium glyoxylate aqueous solution, 5 mM NADH solution and the like are placed in a kit, and the kit can be easily developed according to the preparation instructions of the steps of the present invention.
As shown in the schematic diagram of the method for detecting the content of glutamic acid by an enzymatic method in fig. 1, glutamic acid and glyoxylic acid are converted into glycine and 2-ketoglutarate under the action of glycine aminotransferase (glycine aminotransferase, AT 2); 3-phosphoglycerate dehydrogenase (3-phosophoglycerate dehydrogenase, serA) catalyzes the reduction of 2-ketoglutarate to 2-hydroxyglutarate, while NADH is oxidized to nad+, such that the absorbance of the system at 340 nm is reduced; according to the detection method, besides the commercial purchase of glyoxylic acid and NADH, AT2 and SerA are required to be prepared, coding genes of the AT2 and the SerA are determined by combining sequence comparison and analysis means according to literature reports, target genes are obtained through total gene synthesis or PCR cloning, an expression vector is connected, and the target genes are transferred into escherichia coli or other expression hosts special for protein expression, so that a large amount of exogenous expression, separation and purification of target proteins are realized;
secondly, constructing a reaction system containing AT2, serA, glyoxylic acid, glutamic acid and NADH; optimizing the influence of factors such as buffer solution, pH, temperature, concentration and proportion of each enzyme and each reactant on the change of absorbance of the system, estimating the detection limit and the quantitative limit, determining a proper glutamic acid detection range, and preparing a standard curve;
Finally, collecting clinical samples (including body fluids such as blood, urine and the like or tissues and the like) or general biological samples to prepare samples, and detecting the glutamic acid content by using the detection system; it should be noted that glutamic acid has correlation with diabetes, brain diseases and other diseases, and it is necessary to detect the value, but the value is only an intermediate value, and it is impossible to diagnose a certain disease, and it is necessary to check the disease in a corresponding professional department.
By adopting the technology, compared with the prior art, the invention has the following beneficial effects:
the method for detecting the glutamic acid content by the enzymatic method overcomes the defect that the traditional glutamic acid dehydrogenase method is not suitable for a high-concentration ammonia environment, creatively deaminates the glutamic acid to form alpha-ketoglutarate by a double-enzyme coupling method of glycine aminotransferase AT2 and 3-phosphoglycerate dehydrogenase SerA, and rapidly and correctly characterizes the glutamic acid content in a system by reducing the NADH content through the reduction reaction of the alpha-ketoglutarate. The invention has the advantages of high sensitivity, rapid and stable detection, good repeatability, simple operation, lower cost and wider application range.
The method for detecting the glutamic acid content by the enzyme method can realize high flux based on the micro-pore plate, can realize automatic operation by combining with a liquid treatment workstation, further reduces the detection cost, can be used as an automatic biochemical analysis matching reagent in the later period, and has good market prospect.
Drawings
FIG. 1 is a schematic diagram of a method for detecting the glutamic acid content by an enzyme method;
FIG. 2 is a standard curve of glutamic acid concentration of 0 to 100. Mu.M obtained in example 3 prepared by the end point method;
FIG. 3 is a standard curve of the initial velocity method for the concentration of glutamic acid of 0 to 100. Mu.M obtained in example 3.
Detailed Description
The invention is further elucidated below in connection with the specific embodiments.
A method for detecting the glutamic acid content by an enzyme method, which comprises the following steps:
exogenous expression of protein and separation and purification:
(1) The combination sequence comparison analysis means selects the gene coding sequence of glycine aminotransferase AT2 and the gene coding sequence of 3-phosphoglycerate dehydrogenase SerA, and then the target genes are respectively obtained by total gene synthesis and PCR (wherein the template of serA gene cloning is the genome of E.coli E. Coli k-12 strain) to obtain the target genes of glycine aminotransferase AT2 and 3-phosphoglycerate dehydrogenase SerA;
(2) Respectively adopting molecular cloning to connect the glycine aminotransferase AT2 target gene and the 3-phosphoglycerate dehydrogenase SerA target gene obtained in the step (1) into a pET28a expression vector, respectively transferring pET28a-AT2 and pET28a-SerA plasmids which are sequenced correctly after cloning into an escherichia coli Rosetta (DE 3) strain, culturing overnight AT 37 ℃ in a test tube filled with Luria-Bertani (LB) culture medium, transferring into a shake flask filled with LB culture medium, adding IPTG with a final concentration of 1 mM when the temperature reaches 37 ℃ and 220 rpm to reach OD600 of about 0.6, and carrying out induction expression for 4 hours to respectively obtain glycine aminotransferase AT2 target protein and 3-phosphoglycerate dehydrogenase SerA target protein;
(3) Separating and purifying target protein:
A. centrifuging the bacterial liquid containing the target protein at low temperature, removing the supernatant, collecting bacterial cells, adding the buffer solution A, and suspending the protein in the buffer solution A. The centrifugal condition is 4-16 ℃, and the rotating speed is 10000-12000 rpm; buffer a consisted of the following components: 1L buffer A contained 2.42 g of tris, 37.3 g of potassium chloride, 100 ml of glycerol and was adjusted to pH 7.9 using hydrochloric acid. The target proteins are glycine aminotransferase AT2 target protein and 3-phosphoglycerate dehydrogenase SerA target protein;
B. after crushing cells by using a high-pressure cell crusher, centrifuging for 30-50 min at 4-16 ℃ and 10000-12000 rpm, and collecting supernatant;
C. passing the supernatant through a nickel column, eluting by using eluent containing imidazole with different concentrations, wherein the concentration of imidazole in the eluent is 20 mM-500 mM;
D. and (3) placing the enzyme solution obtained by eluting with 500 and mM in a ultrafiltration tube, centrifuging at 4-16 ℃ and 5000-6000 rpm, concentrating the protein, and adding a buffer solution B to suspend the protein in the concentration process. Buffer B consisted of the following components: 1L buffer B contained 2.42 g tris, 7.45 g potassium chloride, 200 ml glycerol, 0.154 g dithiothreitol and was adjusted to pH 7.9 using hydrochloric acid. The concentrated protein solution is packaged and stored in a refrigerator at the temperature of minus 80 ℃.
(II) detecting glutamic acid by a double enzyme coupling method:
(1) Preparing a reaction mixed solution:
preparing 100 mM TEA-HCl solution (pH 9.0), 100 mM sodium glyoxylate aqueous solution, 5 mM NADH solution for later use;
preparing 500 mu l of double-enzyme mixed solution containing glycine aminotransferase AT2 and 3-phosphoglycerate dehydrogenase SerA, wherein the mixed solution contains 100 mu l of 3.4 mg/ml purified AT2 target protein and 80 mu l of 32 mg/ml purified SerA target protein, and adding 320 mu l of buffer solution B to complement to 500 mu l for later use;
the reaction mixture was prepared according to the above solution, wherein the ratio composition of the reaction mixture per 75. Mu.l comprises: TEA-HCl solution, 25. Mu.l; 10-30 μl of sodium glyoxylate aqueous solution; NADH solution, 4-5 μl; 5-10 μl of a mixed solution of double enzymes; ultrapure water was replenished to 75. Mu.l.
(2) Endpoint method glutamate concentration standard curve:
preparing a series of glutamic acid standard substance solutions with the concentration of 0-0.4 mM, respectively taking 25 mu l of each solution and respectively dripping the solutions into a 96-well ELISA plate filled with 75 mu l of reaction mixed solution, gently mixing the solutions, and reacting for 15-30 minutes at the temperature of 30-40 ℃. The ratio composition of the blank reaction mixture includes: TEA-HCl solution, 25. Mu.l; 5-10 μl of a mixed solution of double enzymes; ultrapure water was replenished to 100. Mu.l. The proportional composition of the reaction mixture for the raw absorbance reading included: TEA-HCl solution, 25. Mu.l; NADH solution, 4-5 μl; 5-10 μl of a mixed solution of double enzymes; ultrapure water was replenished to 100. Mu.l. After the reaction is finished, an enzyme label instrument is used for reading the absorbance value at 340 and nm, and the change value of the absorbance is the difference between the original absorbance value reading and the rest reading. Drawing a glutamic acid concentration standard curve by taking an absorbance change value as an ordinate and the concentration of a glutamic acid standard substance solution as an abscissa;
(3) Initial speed method for preparing glutamic acid concentration standard curve
Preparing a series of glutamic acid standard substance solutions with the concentration of 0-0.4 mM, respectively taking 25 mu l of each solution and respectively dripping the solutions into a 96-well ELISA plate filled with 75 mu l of reaction mixed solution, gently mixing the solutions, and reacting for 2-10 minutes at the temperature of 30-40 ℃. The ratio composition of the blank reaction mixture includes: TEA-HCl solution, 25. Mu.l; 5-10 μl of a mixed solution of double enzymes; ultrapure water was replenished to 100. Mu.l. The change in absorbance at 340 nm was monitored using a microplate reader. And drawing a glutamic acid concentration standard curve by taking the absorbance change value at the position of 340 nm within 2-10 minutes as an ordinate and the concentration of the glutamic acid standard substance solution as an abscissa.
The whole gene synthesis target gene is entrusted to biological company for synthesis, and the step of the embodiment is synthesized by Nanjing Jinsri biological technology Co., ltd;
sodium glyoxylate is named Sodium glyoxylate monohydrate, CAS number 918149-31-2;
NADH English name is Nicotinamide adenine dinucleotide, CAS number 74927-11-0;
the deproteinizing kit adopted by the invention is Biovision.
The invention is further described below in connection with specific embodiments.
Example 1
A method for detecting the glutamic acid content by an enzyme method, which comprises the following steps:
exogenous expression of protein and separation and purification:
(1) The combination sequence comparison analysis means selects the gene coding sequence of glycine aminotransferase AT2 and the gene coding sequence of 3-phosphoglycerate dehydrogenase SerA, and then the target genes are respectively obtained by total gene synthesis and PCR (wherein the template of serA gene cloning is the genome of E.coli E. Coli k-12 strain) to obtain the target genes of glycine aminotransferase AT2 and 3-phosphoglycerate dehydrogenase SerA;
according to the literature "Masaffmi Kameya, et al (2010) Purification of threeaminotransferases fromHydrogenobacter thermophilusTK-6-novel types ofalanine or glycine aminotransferase FEBS Journal 277:1876-1885, "reportHydrogenobacter thermophilus The TK-6 strain has glycine aminotransferase AT2 (amyT 2), and the Gene sequence can be obtained by searching the amyT 2 in the Gene database of NCBI;
according to the literature "Genshi Zhao, et al (1996) A novel. Alpha. -ketoglutarate reductaseactivity of thesera-encoded 3-phosphoglycerate dehydrogenase of Escherichia coliK-12 and its possible implications for human 2-hydroxyglutamic acid amide journal of Bacteriology, 178 (1): 232-239 et al Escherichia coliThe Gene sequence can be obtained by searching NP-311811.1 in the Gene database of NCBI when 3-phosphoglycerate dehydrogenase SerA (D-3-phosphoglycerate dehydrogenase, NP-311811.1) exists in the K-12 strain;
glycine aminotransferase AT2 was obtained by total gene synthesis of the objective gene commission organism company, and 3-phosphoglycerate dehydrogenase SerA was obtained byEscherichia coliPCR is carried out by taking the K-12 genome as a template to obtain a target gene;
wherein, the exogenous expression, separation and purification of the AT2 protein comprise the following specific steps:
（1）Masafumi Kameya, et al. (2010) Purification of three aminotransferasesfrom Hydrogenobacter thermophilus TK-6 – novel types of alanine or glycineaminotransferase. FEBS Journal, 277:1876-1885.
the document reportsHydrogenobacter thermophilus The TK-6 strain has glycine aminotransferase AT2 (amyT 2), and the Gene sequence can be obtained by searching the amyT 2 in the Gene database of NCBI;
(2) Sending the ambT 2 sequence to Nanjing Jinsri biotechnology Co., ltd for gene synthesis; enzyme cutting is designed at two endsSite(s)EcoRI, and RI systemHindIII；
(3) By means ofEcoRI, and RI systemHindIII enzyme cutting the synthesized amyT 2, cutting glue, and recovering gene fragments by using a glue recovery kit; determining the concentration by using Nanodrop 2000;
(4) By means ofEcoRI, and RI systemHindIII enzyme cutting pET28a carrier, cutting glue, and recovering carrier fragments by using a glue recovery kit; determining the concentration by using Nanodrop 2000;
(5) Constructing a connection reaction system by utilizing Solution I (ligase) to connect the fragments in the steps 3 and 4 with 2 h at 16 ℃;
(6) Conventional methods chemically transformed the ligation products into Rosetta (DE 3) competent cells, and plated LB plates containing kanamycin;
(7) 5 monoclonals are selected to LB culture medium, and after overnight culture, plasmids are extracted by a plasmid small-quantity extraction kit;
(8) The extracted plasmidEcoRI, and RI systemHindIII digestion, gel electrophoresis to determine correct clones according to fragment size;
(9) Sequencing and verifying the correctness of the correct clone in the step 8; strains were saved in 10% glycerol.
(10) Inserting the correct clone determined in the step 9 into an LB bottle, adding 1mM isopropyl-beta-D-thiogalactoside with the final concentration to induce protein expression when OD600 = 0.6, and inducing 4 h at 37 ℃ and 200 rpm;
(11) Centrifuging the bacterial liquid at 4 ℃ for 5 minutes at 12000rpm, removing the supernatant, collecting bacterial cells, adding a buffer A, and suspending the bacterial cells in the buffer A (the buffer A consists of 1L buffer A containing 2.42 g tris (hydroxymethyl) aminomethane, 37.3 g potassium chloride, 100 ml glycerol and adjusting the pH to 7.9 by using hydrochloric acid);
(12) After disrupting cells using a high pressure cell disruptor, centrifuging at 11000rpm for 30 min at 4 ℃, and collecting supernatant;
(13) The supernatant was passed through a nickel column to purify the protein based on the principle of affinity chromatography. Eluting by using eluent containing imidazole with different concentrations, wherein the concentration of imidazole in the eluent is 20 mM-500 mM;
(14) The enzyme solution eluted at 500 mM was placed in a ultrafiltration tube, protein was concentrated at 4℃and 5000 rpm, and buffer B was added during concentration to suspend the protein. Buffer B consisted of the following components: 1L buffer B contained 2.42 g tris, 7.45 g potassium chloride, 200 ml glycerol, 0.154 g dithiothreitol and was adjusted to pH 7.9 using hydrochloric acid. . The concentrated protein solution is packaged and stored in a refrigerator at the temperature of minus 80 ℃.
Wherein, the exogenous expression, separation and purification of the serA protein comprise the following specific steps:
（1）Genshi Zhao, et al. (1996) A novel α-ketoglutarate reductase activityof the sera-encoded 3-phosphoglycerate dehydrogenase of Escherichia coli K-12and its possible implications for human 2-hydroxyglutaric aciduria. Journalof Bacteriology, 178(1):232-239.
the document reportsEscherichia coliThe Gene sequence was obtained by searching the NCBI Gene database for NP-311811.1 in the presence of the 3-phosphoglycerate dehydrogenase SerA (D-3-phosphoglycerate dehydrogenase, NP-311811.1) in the K-12 strain.
(2) Design according to the obtained gene sequenceserAThe primers of the gene are designed with enzyme cutting sites SacI and NotI at two ends, and the primers are synthesized by Nanjing Jinsri biotechnology Co., ltdEscherichia coliThe K-12 genome was used as a template and PCR was performed using KOD polymerase;
(3) After DNA electrophoresis is carried out on the PCR obtained product, cutting glue, and recovering gene fragments by adopting a glue recovery kit; determining the concentration by using Nanodrop 2000;
(4) By means ofSacI andNoti, enzyme cutting the SerA obtained by the PCR, cutting glue, and recovering a gene fragment by using a glue recovery kit; determining the concentration by using Nanodrop 2000;
(5) By means ofSacI andNotcutting pET28a carrier by enzyme, cutting glue, and recovering carrier fragments by using a glue recovery kit; determining the concentration by using Nanodrop 2000;
(6) Constructing a connection reaction system by utilizing Solution I (ligase) to connect the fragments in the steps 4 and 5 with 2 h at 16 ℃;
(7) Conventional methods chemically transformed the ligation products into Rosetta (DE 3) competent cells, and plated LB plates containing kanamycin;
(8) 3 monoclonals are selected to LB culture medium, and plasmid is extracted by a plasmid small-quantity extraction kit after overnight culture;
(9) The extracted plasmidSacI andNoti, enzyme digestion, gel electrophoresis determines correct cloning according to fragment size;
(10) Sequencing and verifying the correctness of the correct clone in the step 9; strains were saved in 10% glycerol.
(11) Inserting the correct clone determined in the step 10 into an LB bottle, adding 1mM isopropyl-beta-D-thiogalactoside with the final concentration to induce protein expression when OD600 = 0.6, and inducing 4 h at 37 ℃ and 200 rpm;
(12) Centrifuging the bacterial liquid at 4 ℃ for 5 minutes at 12000rpm, removing the supernatant, collecting bacterial cells, adding a buffer A, and suspending the bacterial cells in the buffer A (the buffer A consists of 1L buffer A containing 2.42 g tris (hydroxymethyl) aminomethane, 37.3 g potassium chloride, 100 ml glycerol and adjusting the pH to 7.9 by using hydrochloric acid);
(13) After disrupting cells using a high pressure cell disruptor, centrifuging at 11000 rpm for 50 min at 4 ℃, and collecting supernatant;
(14) The supernatant was passed through a nickel column to purify the protein based on the principle of affinity chromatography. Eluting by using eluent containing imidazole with different concentrations, wherein the concentration of imidazole in the eluent is 20 mM-500 mM;
(15) The enzyme solution eluted at 500 mM was placed in a ultrafiltration tube, protein was concentrated at 4℃and 5000 rpm, and buffer B was added during concentration to suspend the protein. Buffer B consisted of the following components: 1L buffer B contained 2.42 g tris, 7.45 g potassium chloride, 200 ml glycerol, 0.154 g dithiothreitol and was adjusted to pH 7.9 using hydrochloric acid. The concentrated protein solution is packaged and stored in a refrigerator at the temperature of minus 80 ℃.
(II) detecting glutamic acid by a double enzyme coupling method:
(1) Preparing a reaction mixed solution:
preparing 100 mM TEA-HCl solution (pH 9.0), 100 mM sodium glyoxylate aqueous solution, 5 mM NADH solution for later use; preparing 500 mu l of double-enzyme mixed solution containing glycine aminotransferase AT2 and 3-phosphoglycerate dehydrogenase SerA, wherein the mixed solution contains 100 mu l of 3.4 mg/ml purified AT2 target protein and 80 mu l of 32 mg/ml purified SerA target protein, and adding 320 mu l of buffer solution B to complement to 500 mu l for later use;
The reaction mixture was prepared according to the above solution, wherein the ratio composition of the reaction mixture per 75. Mu.l comprises: TEA-HCl solution, 25. Mu.l; 30 μl of sodium glyoxylate aqueous solution; NADH solution, 5. Mu.l; 5 μl of the double enzyme mixture; ultrapure water was replenished to 75. Mu.l.
(2) Preparing a glutamic acid concentration standard curve:
endpoint method: preparing a series of glutamic acid standard solution with the concentration of 0-0.4 mM, respectively taking 25 mu l of each solution, respectively dripping the solution into a 96-well ELISA plate filled with 75 mu l of reaction mixed solution, gently mixing the solution, and reacting at 37 ℃ for 20 minutes to finish the reaction. The ratio composition of the blank reaction mixture includes: TEA-HCl solution, 25. Mu.l; 5 μl of the double enzyme mixture; ultrapure water was replenished to 100. Mu.l. The proportional composition of the reaction mixture for the raw absorbance reading included: TEA-HCl solution, 25. Mu.l; NADH solution, 5. Mu.l; 5 μl of the double enzyme mixture; ultrapure water was replenished to 100. Mu.l. After the reaction is finished, an enzyme label instrument is used for reading the absorbance value at 340 and nm, and the change value of the absorbance is the difference between the original absorbance value reading and the rest reading. Drawing a glutamic acid concentration standard curve by taking an absorbance change value as an ordinate and the concentration of a glutamic acid standard substance solution as an abscissa;
Initial velocity method: a series of glutamic acid standard solutions with the concentration of 0-0.4 mM are prepared, 25 μl of each solution is respectively dripped into 96-well ELISA plates filled with 75 μl of the reaction mixture, and the solutions are gently mixed and reacted for 5 minutes at 37 ℃. The ratio composition of the blank reaction mixture includes: TEA-HCl solution, 25. Mu.l; 5 μl of the double enzyme mixture; ultrapure water was replenished to 100. Mu.l. The change in absorbance at 340 nm was monitored using a microplate reader. And drawing a glutamic acid concentration standard curve by taking the absorbance change value at 340 and nm in 5 minutes as an ordinate and the glutamic acid standard solution concentration as an abscissa.
(III) detection of glutamic acid in urine, blood, or general biological samples:
(1) Urine treatment and detection
Endpoint method: treating urine by using a deproteinization kit, and centrifuging to obtain supernatant to obtain a urine sample; in the detection, 25. Mu.l of urine is added into a 96-well ELISA plate filled with 75. Mu.l of the reaction mixture, and the mixture is gently mixed, reacted at 37 ℃ for 20 minutes, and then the reaction is finished. The ratio composition of the blank reaction mixture includes: TEA-HCl solution, 25. Mu.l; 5 μl of the double enzyme mixture; ultrapure water was replenished to 100. Mu.l. The proportional composition of the reaction mixture for the raw absorbance reading included: TEA-HCl solution, 25. Mu.l; NADH solution, 5. Mu.l; 5 μl of the double enzyme mixture; urine, 25 μl; ultrapure water was replenished to 100. Mu.l. After the reaction is finished, an enzyme label instrument is used for reading the absorbance value at 340 and nm, and the change value of the absorbance is the difference between the original absorbance value reading and the rest reading.
And calculating according to the change value of the absorbance of the urine sample and the glutamic acid standard curve manufactured by the end-point method to obtain the glutamic acid content of the urine.
Initial velocity method: treating urine by using a deproteinization kit, and centrifuging to obtain supernatant to obtain a urine sample; in the detection process, 25 μl of urine is added into a 96-well ELISA plate filled with 75 μl of reaction mixture, and the mixture is gently mixed, reacted for 5 minutes at 37 ℃, and the ratio composition of the blank reaction mixture comprises: TEA-HCl solution, 25. Mu.l; 5 μl of the double enzyme mixture; ultrapure water was replenished to 100. Mu.l. The change in absorbance at 340 nm was monitored using a microplate reader.
And calculating according to a glutamic acid standard curve manufactured by a preliminary speed method and the change value of absorbance of the urine sample within 5 minutes to obtain the glutamic acid content of the urine.
(2) Blood processing and testing
The blood sample used in the present invention is stored in an anticoagulant tube, and thus the blood sample contains a blood sample anticoagulant, and the anticoagulant in the blood anticoagulant tube is 10% potassium oxalate-sodium fluoride.
When the blood sample is detected, the blood sample needs to be preprocessed, and the steps are as follows: the blood in the anticoagulation tube needs to be centrifuged at a low speed to obtain plasma at 4 ℃ for 10 min at 4000 rpm, and then centrifuged at a high speed to remove impurities possibly interfering with experiments in the plasma at 4 ℃ for 14000 rpm for 10 min. After centrifugation, the supernatant was taken for measurement of glutamic acid content.
Endpoint method: blood separation to obtain plasma or serum to obtain a blood sample; in the detection, 25 μl of plasma or serum is added into a 96-well ELISA plate filled with 75 μl of reaction mixture, and the mixture is gently mixed, and the reaction is terminated after 20 minutes at 37deg.C, wherein the ratio composition of the blank reaction mixture comprises: TEA-HCl solution, 25. Mu.l; 5 μl of the double enzyme mixture; ultrapure water was replenished to 100. Mu.l. The proportional composition of the reaction mixture for the raw absorbance reading included: TEA-HCl solution, 25. Mu.l; NADH solution, 5. Mu.l; 5 μl of the double enzyme mixture; plasma or serum, 25 μl; ultrapure water was replenished to 100. Mu.l. After the reaction is finished, an enzyme label instrument is used for reading the absorbance value at 340 and nm, and the change value of the absorbance is the difference between the original absorbance value reading and the rest reading.
And calculating according to a glutamic acid standard curve prepared by an end-point method according to the change value of the absorbance of the plasma or serum sample to obtain the glutamic acid content of the blood.
Initial velocity method: blood separation to obtain plasma or serum to obtain a blood sample; in the detection, 25 μl of plasma or serum is added into a 96-well ELISA plate filled with 75 μl of the reaction mixture, and the mixture is gently mixed, reacted at 37deg.C for 5 min, and the ratio composition of the blank reaction mixture comprises: TEA-HCl solution, 25. Mu.l; 5 μl of the double enzyme mixture; ultrapure water was replenished to 100. Mu.l. The change in absorbance at 340 nm was monitored using a microplate reader.
And calculating the glutamic acid content of the plasma or serum sample according to a glutamic acid standard curve prepared by an initial speed method and the change value of the absorbance of the plasma or serum sample within 5 minutes.
(3) Detection of biological samples in general
Endpoint method: the general biological sample is treated, supernatant is taken, 25 mu l of biological sample is taken and added into a 96-well ELISA plate with 75 mu l, the biological sample is gently mixed, the reaction is finished after 20 minutes at 37 ℃, and the proportion composition of the reaction mixture of blank control comprises: TEA-HCl solution, 25. Mu.l; 5 μl of the double enzyme mixture; ultrapure water was replenished to 100. Mu.l. The proportional composition of the reaction mixture for the raw absorbance reading included: TEA-HCl solution, 25. Mu.l; NADH solution, 5. Mu.l; 5 μl of the double enzyme mixture; typically 25 μl of biological sample; ultrapure water was replenished to 100. Mu.l. The absorbance at 340 nm was read using a microplate reader, and the absorbance was changed by the difference between the original absorbance reading and the remaining readings.
And calculating according to a glutamic acid standard curve prepared by an end point method and the change value of the absorbance of a general biological sample to obtain the glutamic acid content.
Initial velocity method: the general biological sample is treated, supernatant is taken, 25 mu l of biological sample is added into a 96-well ELISA plate with 75 mu l, the biological sample is gently mixed, the biological sample reacts for 5 minutes at 37 ℃, and the proportion composition of a blank control reaction mixture comprises: TEA-HCl solution, 25. Mu.l; 5 μl of the double enzyme mixture; ultrapure water was replenished to 100. Mu.l. The change in absorbance at 340 nm was monitored using a microplate reader.
And calculating the glutamic acid content of the plasma or serum sample according to a glutamic acid standard curve manufactured by a common biological sample absorbance change value and an initial speed method within 5 minutes.
Example 2
The conditions were the same as in example 1 except for the proportional composition per 75. Mu.l of the mixture;
the ratio composition of each 75 μl of the reaction mixture comprises: TEA-HCl solution, 25. Mu.l; 20 μl of sodium glyoxylate aqueous solution; NADH solution, 4. Mu.l; 10 μl of the mixed solution of double enzymes; ultrapure water, 16. Mu.l.
Example 3
The conditions were the same as in example 1 except for the proportional composition per 75. Mu.l of the mixture;
the ratio composition of each 75 μl of the reaction mixture comprises: TEA-HCl solution, 25. Mu.l; sodium glyoxylate in water, 10 μl; NADH solution, 5. Mu.l; 5 μl of the double enzyme mixture; ultrapure water, 30 μl.
After detecting the light absorption value at 340 nm by using an enzyme-labeled instrument by using an end-point method or an initial speed method, drawing a glutamic acid concentration standard curve by using an absorbance change value as an ordinate and using the concentration of a glutamic acid standard substance solution as an abscissa, and drawing the standard curve by using Excel and other software, wherein the result shows that the glutamic acid concentration has a good linear relationship at 0-100 mu m, so that the glutamic acid concentration is selected as a main measuring range, the standard curve at 0-100 mu m manufactured by the end-point method is shown in fig. 2, and the standard curve at 0-100 mu m manufactured by the initial speed method is shown in fig. 3; therefore, when the concentration of glutamic acid in the sample is larger than this range, the sample is appropriately diluted.
The plasma glutamic acid concentration was measured using the standard curve at the glutamic acid concentration of 0 to 100. Mu.M obtained in example 3, and the specific procedure was as follows:
(1) Collecting peripheral blood of 42 conventional physical examination personnel according to the ethical standard requirements of a hospital;
(2) The conventional method uses a plasma separation rubber tube to separate and obtain plasma, and the plasma is preserved at-80 ℃;
(3) In the measurement, 25. Mu.l of the supernatant from step 2 was added to a 96-well plate (CLS 3590-100EA, corning), and then 75. Mu.l of the reaction mixture (example 3) was added and gently mixed;
(4) Endpoint method: 37. after the reaction is completed after 20 minutes at the temperature, the proportion of the blank reaction mixture comprises: TEA-HCl solution, 25. Mu.l; 5 μl of the double enzyme mixture; ultrapure water was replenished to 100. Mu.l. The proportional composition of the reaction mixture for the raw absorbance reading included: TEA-HCl solution, 25. Mu.l; NADH solution, 5. Mu.l; 5 μl of the double enzyme mixture; plasma, 25. Mu.l, was supplemented with ultrapure water to 100. Mu.l. After the reaction is finished, an enzyme label instrument is used for reading the absorbance value at 340 and nm, and the change value of the absorbance is the difference between the original absorbance value reading and the rest reading.
Initial velocity method: 37. the reaction is carried out for 5 minutes at the temperature of C, and the proportion composition of the blank reaction mixture comprises: TEA-HCl solution, 25. Mu.l; 5 μl of the double enzyme mixture; ultrapure water was replenished to 100. Mu.l. The change in absorbance at 340 nm was monitored using a microplate reader to give a change in absorbance at 340 nm over 5 minutes.
(5) According to the change value of absorbance of the blood sample and the glutamic acid standard curve manufactured by the end-point method or the initial speed method, the glutamic acid content of the blood can be calculated, and the average value of the glutamic acid concentration of the part of people is 125.1+/-57.5 mu M.
The above embodiments are only preferred embodiments of the present invention, and should not be construed as limiting the present invention, and the protection scope of the present invention should be defined by the claims, including the technical equivalents of the technical features in the claims, as the protection scope, that is, the equivalent replacement and improvement within the protection scope of the present invention.
Sequence listing
<120> method for detecting glutamic acid content by enzyme method and application thereof
<140> 2019110530045
<141> 2019-10-31
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1122
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
atgtatcagg aaaggctctt cacaccagga cctgttgaga tccccgatag agtaagggaa 60
gctctgggaa ggcagattat ccatcacagg acagaagagt tcaggcgcgc ctttttggaa 120
gtgcgagaac tcctcaagag actgctggat gacccatcag agaacttcgt ctttttctca 180
tcttcgggca caggtgccat ggaagcggct attctgaact tctttgaaga aggtcagaag 240
gtgctggtgg taaacggcgg aaagtttggc gagagatggt ttttgctggc aaaacactgg 300
gggcttgagg ttgtggagta cagactggac tggggcaagt ccgcagaccc cgaaaaagtc 360
aaggatctgc ttaaaaagca tcccgattgc aagggtgtgc ttcttcaaat atcagaaaca 420
tctacaggtg cttaccaccc tgttgaagat atagcggagg tttgcaaaag tgcagacgct 480
cttttggtag ctgatgccat aacagccttg ggagtttata acttaaagcc ttcggtgggc 540
attgatgtaa tggtaggtgg gtcccagaag gctcttatgc ttccacctgg actttctctc 600
ctctggttct ctcaaaaggc aaaagagaga ttaaaagaca gagcctttta ctttagcgta 660
aaaaaggagc ttggcaaaca gcaagaagga cagaccgcgt ggactcctgc cataagcctc 720
cttttagctc tgaaggagtc tcttagtctt cttttgcaag agggaatgga gagagtagaa 780
aaaaggtaca gagccatgtc ggagggaact aagagagcga taagtgcctt tggtcttgag 840
gtcttcccag aaagaccagc catatccata acggctgtaa aaagcgacga tgcggaaagg 900
ataagaaagg agctcttaag acatggtata aggattgctg gaggacagga ccaccttaaa 960
ggtaagattt tcagggtttc ccacatggga gtaagtgaaa aagatatgct catgctgata 1020
ggtgtgctgg aggtagtact aaaaaggctt ggttaccctg tggagcttgg cagcggtgtt 1080
tgtagatact cacaaactct agtagaattt gggctatggt aa 1122
<210> 2
<211> 373
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Met Tyr Gln Glu Arg Leu Phe Thr Pro Gly Pro Val Glu Ile Pro Asp
1 5 10 15
Arg Val Arg Glu Ala Leu Gly Arg Gln Ile Ile His His Arg Thr Glu
20 25 30
Glu Phe Arg Arg Ala Phe Leu Glu Val Arg Glu Leu Leu Lys Arg Leu
35 40 45
Leu Asp Asp Pro Ser Glu Asn Phe Val Phe Phe Ser Ser Ser Gly Thr
50 55 60
Gly Ala Met Glu Ala Ala Ile Leu Asn Phe Phe Glu Glu Gly Gln Lys
65 70 75 80
Val Leu Val Val Asn Gly Gly Lys Phe Gly Glu Arg Trp Phe Leu Leu
85 90 95
Ala Lys His Trp Gly Leu Glu Val Val Glu Tyr Arg Leu Asp Trp Gly
100 105 110
Lys Ser Ala Asp Pro Glu Lys Val Lys Asp Leu Leu Lys Lys His Pro
115 120 125
Asp Cys Lys Gly Val Leu Leu Gln Ile Ser Glu Thr Ser Thr Gly Ala
130 135 140
Tyr His Pro Val Glu Asp Ile Ala Glu Val Cys Lys Ser Ala Asp Ala
145 150 155 160
Leu Leu Val Ala Asp Ala Ile Thr Ala Leu Gly Val Tyr Asn Leu Lys
165 170 175
Pro Ser Val Gly Ile Asp Val Met Val Gly Gly Ser Gln Lys Ala Leu
180 185 190
Met Leu Pro Pro Gly Leu Ser Leu Leu Trp Phe Ser Gln Lys Ala Lys
195 200 205
Glu Arg Leu Lys Asp Arg Ala Phe Tyr Phe Ser Val Lys Lys Glu Leu
210 215 220
Gly Lys Gln Gln Glu Gly Gln Thr Ala Trp Thr Pro Ala Ile Ser Leu
225 230 235 240
Leu Leu Ala Leu Lys Glu Ser Leu Ser Leu Leu Leu Gln Glu Gly Met
245 250 255
Glu Arg Val Glu Lys Arg Tyr Arg Ala Met Ser Glu Gly Thr Lys Arg
260 265 270
Ala Ile Ser Ala Phe Gly Leu Glu Val Phe Pro Glu Arg Pro Ala Ile
275 280 285
Ser Ile Thr Ala Val Lys Ser Asp Asp Ala Glu Arg Ile Arg Lys Glu
290 295 300
Leu Leu Arg His Gly Ile Arg Ile Ala Gly Gly Gln Asp His Leu Lys
305 310 315 320
Gly Lys Ile Phe Arg Val Ser His Met Gly Val Ser Glu Lys Asp Met
325 330 335
Leu Met Leu Ile Gly Val Leu Glu Val Val Leu Lys Arg Leu Gly Tyr
340 345 350
Pro Val Glu Leu Gly Ser Gly Val Cys Arg Tyr Ser Gln Thr Leu Val
355 360 365
Glu Phe Gly Leu Trp
370
<210> 3
<211> 1233
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
atggcaaagg tatcgctgga gaaagacaag attaagtttc tgctggtaga aggcgtgcac 60
caaaaggcgc tggaaagcct tcgtgcagct ggttacacca acatcgaatt tcacaaaggc 120
gcgctggatg atgaacaatt aaaagaatcc atccgcgatg cccacttcat cggcctgcga 180
tcccgtaccc atctgactga agacgtgatc aacgccgcag aaaaactggt cgctattggc 240
tgtttctgta tcggaacaaa ccaggttgat ctggatgcgg cggcaaagcg cgggatcccg 300
gtatttaacg caccgttctc aaatacgcgc tctgttgcgg agctggtgat tggcgaactg 360
ctgctgctat tgcgcggcgt gccggaagcc aatgctaaag cgcaccgtgg cgtgtggaac 420
aaactggcgg cgggttcttt tgaagcgcgc ggcaaaaagc tgggtatcat cggctacggt 480
catattggta cgcaattggg cattctggct gaatcgctgg gaatgtatgt ttacttttat 540
gatattgaaa ataaactgcc gctgggcaac gccactcagg tacagcatct ttctgacctg 600
ctgaatatga gcgatgtggt gagtctgcat gtaccagaga atccgtccac caaaaatatg 660
atgggcgcga aagaaatttc actaatgaag cccggctcgc tgctgattaa tgcttcgcgc 720
ggtactgtgg tggatattcc ggcgctgtgt gatgcgctgg cgagcaaaca tctggcgggg 780
gcggcaatcg acgtattccc gacggaaccg gcgaccaata gcgatccatt tacctctccg 840
ctgtgtgaat tcgacaacgt ccttctgacg ccacacattg gcggttcgac tcaggaagcg 900
caggagaata tcggcctgga agttgcgggt aaattgatca agtattctga caatggctca 960
acgctctctg cggtgaactt cccggaagtc tcgctgccac tgcacggtgg gcgtcgtctg 1020
atgcacatcc acgaaaaccg tccgggcgtg ctaactgcgc tgaacaaaat cttcgccgag 1080
cagggcgtca acatcgccgc gcaatatctg caaacttccg cccagatggg ttatgtggtt 1140
attgatattg aagccgacga agacgttgcc gaaaaagcgc tgcaggcaat gaaagctatt 1200
ccgggtacca ttcgcgcccg tctgctgtac taa 1233
<210> 4
<211> 410
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 4
Met Ala Lys Val Ser Leu Glu Lys Asp Lys Ile Lys Phe Leu Leu Val
1 5 10 15
Glu Gly Val His Gln Lys Ala Leu Glu Ser Leu Arg Ala Ala Gly Tyr
20 25 30
Thr Asn Ile Glu Phe His Lys Gly Ala Leu Asp Asp Glu Gln Leu Lys
35 40 45
Glu Ser Ile Arg Asp Ala His Phe Ile Gly Leu Arg Ser Arg Thr His
50 55 60
Leu Thr Glu Asp Val Ile Asn Ala Ala Glu Lys Leu Val Ala Ile Gly
65 70 75 80
Cys Phe Cys Ile Gly Thr Asn Gln Val Asp Leu Asp Ala Ala Ala Lys
85 90 95
Arg Gly Ile Pro Val Phe Asn Ala Pro Phe Ser Asn Thr Arg Ser Val
100 105 110
Ala Glu Leu Val Ile Gly Glu Leu Leu Leu Leu Leu Arg Gly Val Pro
115 120 125
Glu Ala Asn Ala Lys Ala His Arg Gly Val Trp Asn Lys Leu Ala Ala
130 135 140
Gly Ser Phe Glu Ala Arg Gly Lys Lys Leu Gly Ile Ile Gly Tyr Gly
145 150 155 160
His Ile Gly Thr Gln Leu Gly Ile Leu Ala Glu Ser Leu Gly Met Tyr
165 170 175
Val Tyr Phe Tyr Asp Ile Glu Asn Lys Leu Pro Leu Gly Asn Ala Thr
180 185 190
Gln Val Gln His Leu Ser Asp Leu Leu Asn Met Ser Asp Val Val Ser
195 200 205
Leu His Val Pro Glu Asn Pro Ser Thr Lys Asn Met Met Gly Ala Lys
210 215 220
Glu Ile Ser Leu Met Lys Pro Gly Ser Leu Leu Ile Asn Ala Ser Arg
225 230 235 240
Gly Thr Val Val Asp Ile Pro Ala Leu Cys Asp Ala Leu Ala Ser Lys
245 250 255
His Leu Ala Gly Ala Ala Ile Asp Val Phe Pro Thr Glu Pro Ala Thr
260 265 270
Asn Ser Asp Pro Phe Thr Ser Pro Leu Cys Glu Phe Asp Asn Val Leu
275 280 285
Leu Thr Pro His Ile Gly Gly Ser Thr Gln Glu Ala Gln Glu Asn Ile
290 295 300
Gly Leu Glu Val Ala Gly Lys Leu Ile Lys Tyr Ser Asp Asn Gly Ser
305 310 315 320
Thr Leu Ser Ala Val Asn Phe Pro Glu Val Ser Leu Pro Leu His Gly
325 330 335
Gly Arg Arg Leu Met His Ile His Glu Asn Arg Pro Gly Val Leu Thr
340 345 350
Ala Leu Asn Lys Ile Phe Ala Glu Gln Gly Val Asn Ile Ala Ala Gln
355 360 365
Tyr Leu Gln Thr Ser Ala Gln Met Gly Tyr Val Val Ile Asp Ile Glu
370 375 380
Ala Asp Glu Asp Val Ala Glu Lys Ala Leu Gln Ala Met Lys Ala Ile
385 390 395 400
Pro Gly Thr Ile Arg Ala Arg Leu Leu Tyr
405 410

Claims (9)

1. The method for detecting the glutamic acid content by using the enzymatic method is characterized by comprising the following steps of: determining the content of glutamic acid by using a double-enzyme coupling system of glycine aminotransferase AT2 and 3-phosphoglycerate dehydrogenase SerA through a double-enzyme coupling method, wherein the double-enzyme coupling method is an end-point method or an initial speed method;
The target gene sequence of the glycine aminotransferase AT2 is shown in a sequence table SEQ ID No. 1, and the target protein of the glycine aminotransferase AT2 is shown in a sequence table SEQ ID No. 2;
the target gene of the 3-phosphoglycerate dehydrogenase serA is shown in a sequence table SEQ ID No. 3, and the target protein of the 3-phosphoglycerate dehydrogenase serA is shown in a sequence table SEQ ID No. 4.
2. The method for detecting the glutamic acid content by using the enzymatic method according to claim 1, wherein the method comprises the following steps:
(1) Exogenous expression, separation and purification of proteins
1) Preparing glycine aminotransferase AT2 target gene and 3-phosphoglycerate dehydrogenase serA target gene;
2) Respectively connecting the glycine aminotransferase AT2 target gene and the 3-phosphoglycerate dehydrogenase serA target gene obtained in the step 1) into a pET28a expression vector to obtain pET28a-AT2 and pET28a-serA plasmids;
3) Respectively transferring pET28a-AT2 and pET28a-SerA plasmids into an escherichia coli Rosetta strain, and culturing in a culture medium to obtain glycine aminotransferase AT2 target protein and 3-phosphoglycerate dehydrogenase SerA target protein;
4) Separating and purifying target protein;
(2) And detecting the glutamic acid content in the sample by utilizing the target protein obtained by separation and purification through a double-enzyme coupling method.
3. The method for detecting glutamic acid content by enzymatic method according to claim 2, wherein the step of separating and purifying the target protein in the step 4) is as follows:
A. centrifuging the bacterial liquid containing the glycine aminotransferase AT2 target protein and the 3-phosphoglycerate dehydrogenase SerA target protein obtained in the step 3) AT a low temperature, removing supernatant, collecting thalli, adding a buffer solution A, and suspending the thalli in the buffer solution A;
B. after the thalli are crushed, centrifuging and collecting supernatant;
C. passing the supernatant through a nickel column, and eluting with eluent;
D. and (3) placing the eluted enzyme solution in a ultrafilter tube for centrifugation and concentration, and subpackaging the concentrated protein solution to obtain the target protein for separation and purification.
4. The method for detecting the glutamic acid content by using the enzymatic method according to claim 3, wherein in the step A, the reaction temperature of centrifugation is 4-16 ℃ and the rotating speed is 10000-12000 rpm; in the step D, the reaction temperature of centrifugation is 4-16 ℃, and the rotating speed is 5000-6000 rpm.
5. The method for detecting glutamic acid content by enzyme method according to claim 3, wherein in the step a, the buffer a is composed of the following components: 1L buffer A contained 2.42 g tris, 37.3 g potassium chloride and 100 ml glycerol; in the step D, a buffer solution B is added in the concentration process, and the protein is suspended in the buffer solution B; buffer B consisted of the following components: buffer B of 1L contained 2.42 g tris, 7.45 g potassium chloride, 200 ml glycerol and 0.154 g dithiothreitol.
6. The method for detecting glutamic acid content by enzyme method according to claim 3, wherein in the step C, the eluent contains imidazole, and the concentration of imidazole in the eluent is 20-500 mmol/L.
7. The method for detecting the glutamic acid content by using the enzymatic method according to claim 1, wherein the detection step of the end-point method is as follows: preparing glutamic acid standard substance solutions with the concentration of 0-0.4 mmol/L, respectively taking 25 mu L of each concentration, respectively dripping the solutions into 96-hole ELISA plates filled with 75 mu L of reaction mixed solution, uniformly mixing, reacting for 15-30 minutes at 30-40 ℃, finishing the reaction, reading the absorbance value at 340 nm by using an ELISA reader, and drawing a glutamic acid concentration standard curve by taking the absorbance change value as an ordinate and the concentration of the glutamic acid standard substance solution as an abscissa.
8. The method for detecting the glutamic acid content by using the enzymatic method according to claim 1, wherein the method comprises the following steps of: the detection steps of the initial velocity method are as follows: preparing glutamic acid standard substance solutions with the concentration of 0-0.4 mmol/L, respectively taking 25 mu L of each solution and respectively dripping the solutions into 96-hole ELISA plates filled with 75 mu L of reaction mixed solution, uniformly mixing, reacting for 2-10 minutes at 30-40 ℃, monitoring the change amount of absorbance at 340 nm in the reaction process by using an ELISA meter, taking the change value of absorbance at 340 nm in 2-10 minutes as an ordinate, and drawing a glutamic acid concentration standard curve by taking the concentration of the glutamic acid standard substance solution as an abscissa.
9. The method for detecting the glutamic acid content by using the enzyme method according to claim 7 or 8, wherein: the ratio composition of each 75 μl of the reaction mixture comprises: TEA-HCl solution, 25. Mu.l; 10-30 μl of sodium glyoxylate aqueous solution; NADH solution, 4-5 μl; 5-10 mu l of the double enzyme mixed solution is supplemented with 75 mu l of ultrapure water.
CN201911053004.5A 2019-10-31 2019-10-31 Method for detecting glutamic acid content by enzyme method and application thereof Active CN110777188B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911053004.5A CN110777188B (en) 2019-10-31 2019-10-31 Method for detecting glutamic acid content by enzyme method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911053004.5A CN110777188B (en) 2019-10-31 2019-10-31 Method for detecting glutamic acid content by enzyme method and application thereof

Publications (2)

Publication Number Publication Date
CN110777188A CN110777188A (en) 2020-02-11
CN110777188B true CN110777188B (en) 2024-02-27

Family

ID=69388179

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911053004.5A Active CN110777188B (en) 2019-10-31 2019-10-31 Method for detecting glutamic acid content by enzyme method and application thereof

Country Status (1)

Country Link
CN (1) CN110777188B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101324568A (en) * 2007-06-13 2008-12-17 苏州艾杰生物科技有限公司 Glutamic acid diagnosis/determination reagent kit and method for determining aminoglutaric acid concentration
CN102298028A (en) * 2010-06-25 2011-12-28 苏州艾杰生物科技有限公司 Method for determining glycine and glycine determination kit
CN104789639A (en) * 2015-04-21 2015-07-22 华东理工大学 Fusion protein for detecting NADH dependent type enzyme substrate and application of fusion protein
CN105624265A (en) * 2014-10-30 2016-06-01 中国科学院青岛生物能源与过程研究所 Method for determining L-glutamic acid content through whole-cell of which surface displays glutamate dehydrogenase
CN109456960A (en) * 2018-12-28 2019-03-12 厦门大学 A kind of method of redox graphene immobilization Phenylalanine dehydrogenase

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101324568A (en) * 2007-06-13 2008-12-17 苏州艾杰生物科技有限公司 Glutamic acid diagnosis/determination reagent kit and method for determining aminoglutaric acid concentration
CN102298028A (en) * 2010-06-25 2011-12-28 苏州艾杰生物科技有限公司 Method for determining glycine and glycine determination kit
CN105624265A (en) * 2014-10-30 2016-06-01 中国科学院青岛生物能源与过程研究所 Method for determining L-glutamic acid content through whole-cell of which surface displays glutamate dehydrogenase
CN104789639A (en) * 2015-04-21 2015-07-22 华东理工大学 Fusion protein for detecting NADH dependent type enzyme substrate and application of fusion protein
CN109456960A (en) * 2018-12-28 2019-03-12 厦门大学 A kind of method of redox graphene immobilization Phenylalanine dehydrogenase

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
A novel alpha-ketoglutarate reductase activity of the serA-encoded 3-phosphoglycerate dehydrogenase of Escherichia coli K-12 and its possible implications for human 2-hydroxyglutaric aciduria;G Zhao等;《Journal of Bacteriology》;第178卷(第1期);摘要、图1、第234页左栏第2段 *
Purification of three aminotransferases from Hydrogenobacter thermophilus TK-6 – novel types of alanine or glycine aminotransferase;Masafumi Kameya等;《FEBS Journal》;第277卷(第8期);摘要、图1 *
王振伟等.兔肌3-磷酸甘油脱氢酶的提纯及性质研究.中国生物工程杂志.2023,第33卷(第2期), *
陈平安等.慢性心力衰竭患者血清α酮戊二酸水平的变化及其临床意义的研究.中国博士学位论文全文数据库医药卫生科技辑.2016, *

Also Published As

Publication number Publication date
CN110777188A (en) 2020-02-11

Similar Documents

Publication Publication Date Title
JP3337693B2 (en) High specificity homocysteine assay for biological samples
HOPPE et al. Identification of Amino‐Acid Substitutions in the Proteolipid Subunit of the ATP Synthase from Dicyclohexylcarbodiimide‐Resistant Mutants of Escherichia coli
JP5937547B2 (en) Improved mutants of pyrroloquinoline quinone-dependent soluble glucose dehydrogenase
WO2015096621A1 (en) Fructose amino acid oxidase, preparation method and enzyme-containing kit for detecting glycated albumin
EP0932689B1 (en) Assays for homocysteine and homocysteine desulphurase from protozoan trichomonasvaginalis
CN109239351B (en) Lotus root latent virus double-antibody sandwich enzyme-linked immunosorbent assay kit and preparation and detection methods thereof
US20010011130A1 (en) Materials and methods for detection of oxalate
CN108507984A (en) A kind of method and its application of enzyme process detection trimethylamine oxide TMAO
CN110777188B (en) Method for detecting glutamic acid content by enzyme method and application thereof
CN109706130A (en) Fructoamino-acid-oxidase mutant, detection kit and detection method
CN112175980B (en) Method for improving activity of polymerase large fragment through site-directed mutagenesis and application
CN114277021B (en) Cystathionine-beta-lyase and preparation method and application thereof
CN115976154A (en) Metalloprotease ADAMTS13 activity detection method
CN115247158B (en) Glycerol phosphate oxidase mutant and screening method, preparation method and application thereof
CN110760562A (en) Method for detecting branched chain amino acid content by enzyme method and application thereof
CN111676236A (en) Escherichia coli expression method of recombinant FLOD protein
CN110760561A (en) Method for detecting glycine content by enzyme method and application thereof
CN109957003B (en) Stable SAA mutant and application thereof in disease detection
Crabb et al. Sequence homology in the amino-terminal and active-site regions of thermolabile glyceraldehyde-3-phosphate dehydrogenase from a thermophile
EP1595950A1 (en) Method of measuring homocysteine
EP1210443B1 (en) Method to determine the level of hydrogen sulfide in a sample and method to identify a sequence encoding a homocysteinase with a desired degree of specificity
CA2655890A1 (en) Method of determining 1,5-anhydroglucitol, and reagent composition for determining 1,5-anhydroglucitol
JP3819969B2 (en) Recombinant fructosyl amino acid oxidase
CN111751526A (en) Kit and method for detecting autoantibodies against GM, IIDD and NR in human body fluid
CN106554945B (en) A kind of fructosyl peptide oxidase that thermal stability is high and its encoding gene and purposes

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant