CN110759995A

CN110759995A - Human-mouse chimeric whole-molecule IgG antibody for identifying HBsAg variant and application thereof

Info

Publication number: CN110759995A
Application number: CN201911098703.1A
Authority: CN
Inventors: 杨永林; 申玉英; 傅强; 冯振卿; 唐奇
Original assignee: Nanjing First Hospital
Current assignee: Nanjing First Hospital
Priority date: 2019-11-12
Filing date: 2019-11-12
Publication date: 2020-02-07

Abstract

The invention discloses a human-mouse chimeric whole-molecule IgG antibody for identifying HBsAg variant and application thereof, wherein the nucleic acid sequence of the light chain variable region is shown as SEQ ID NO. 1; the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO.2, the invention also discloses a DNA molecule, an expression vector, a host cell and application of the whole-molecule IgG antibody, and belongs to the field of biological pharmacy. The invention uses natural wild type recombinant HBsAg protein to immunize a mouse, adopts HBsAg variant strains to carry out multiple screening, prepares mouse HBsAg variant strain monoclonal antibody by hybridoma technology, and prepares recombinant human-mouse chimeric anti-HBsAg variant strain whole-molecule IgG by adopting gene engineering technology and antibody engineering technology. The chimeric antibody can effectively identify various HBsAg variant strains, and can be effectively used for detecting the HBsAg variant strains and for passively protecting a human body from being infected by the HBV variant strains through immunization.

Description

Human-mouse chimeric whole-molecule IgG antibody for identifying HBsAg variant and application thereof

Technical Field

The invention belongs to the field of biological pharmacy, and particularly relates to a human-mouse chimeric whole-molecule IgG antibody for identifying HBsAg variant strains and application thereof.

Background

The monoclonal antibody technology has great effects in diagnosis, treatment and the like, the medical technology level is greatly improved, and the application of the conventional mouse or other animal source antibodies in human bodies is greatly limited because the conventional mouse or other animal source antibodies can cause strong heterogeneous immune response. At present, the clinical application aiming at the hepatitis B virus is widely applied to high-efficiency immunoglobulin (HBIg), which is from antibody response generated after volunteer vaccine immunization, and then plasma is collected for antibody concentration and purification, the application of the HBIg plays a great role in protecting susceptible people, and plays an important role in preventing HBV reinfection in liver transplantation. However, since HBV is subject to a reverse transcription process during its replication, it is susceptible to a great number of HBV variants, especially in vaccination and HBIg screening, and a great number of HBV variants are frequently found, and vaccination and HBIg deprotection are continuously occurring and are increasing year by year. It is important to develop new protection methods and articles of manufacture.

Humanized antibody technology has also matured over time and has been an important method to alter the immunogenicity and functional characteristics of antibody molecules themselves, while maintaining their specific recognition specificity. The currently published antibodies related to Hepatitis B surface antigen (HBsAg) are mainly mice, are mainly used for clinical detection and development, and are partially related to the recognition of HBV variants. The antibody prepared by the invention can be effectively combined with various HBV variant strains, shows good neutralization characteristics, and has no patent report of an anti-variant HBsAg antibody with related functions.

Disclosure of Invention

The invention aims to provide a human-mouse chimeric whole-molecule IgG antibody for identifying HBsAg variant strains and application thereof, as well as nucleic acid and amino acid sequences of CDR regions of the antibody, nucleic acid and amino acid sequences of variable regions of the antibody, whole-molecule amino acid sequences of the antibody, antigen-binding epitope amino acid sequences, a method for preparing a mouse-derived anti-HBsAg antibody, a method for preparing human-mouse chimeric anti-HBsAg whole-molecule IgG, and the capacity and application thereof for identifying different HBV variant strains.

A human mouse chimeric whole-molecule IgG antibody for identifying HBsAg variant strains comprises a light chain variable region and a heavy chain variable region, wherein the amino acid sequences of three antigen complementary region CDRs of the light chain variable region are respectively shown as SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO. 7; the amino acid sequences of three antigen complementary region CDRs of the heavy chain variable region are respectively shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO. 10.

The HBsAg variant is one or more of 118Met, 120Thr, 123Ala, 126Asn, 130Arg, 141Leu, 142Ser, 143Leu, 145Arg, 146Ser, 154Thr, 181Thr, 204Ile and 204 Val.

The HBsAg variant is one or more of 118Met, 123Ala, 130Arg, 142Ser, 145Arg and 154 Thr.

Further, the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 3; and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 4.

A nucleic acid molecule encoding the heavy and light chains of a whole IgG antibody according to any preceding claim.

Further, the light chain amino acid sequence is shown as SEQ ID NO.11, and the heavy chain amino acid sequence is shown as SEQ ID NO. 12.

Further, the nucleic acid sequence of the light chain variable region is shown as SEQ ID NO. 1; the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 2.

An expression vector comprising any of the above nucleic acid molecules and an expression control sequence operably linked to the nucleic acid molecule.

A host cell transformed with said expression vector.

An application of a full-molecular IgG antibody in preparing HBV diagnostic reagents or therapeutic drugs, wherein the full-molecular IgG antibody is the full-molecular IgG antibody.

The invention has the beneficial effects that: the human-mouse chimeric whole-molecule IgG antibody prepared by the invention can effectively recognize various HBsAg variant strains, is effectively used for detecting the HBsAg variant strains, passively protecting a human body from being infected by the HBV variant strains through immunization, is effectively used for detecting the HBsAg variant strains and passively protecting the human body from being infected by the HBV variant strains through immunization, and has good application prospect in passive immune protection aiming at immune evasion of main variant strains.

Drawings

FIG. 1 is an enzyme-linked immunosorbent assay;

FIG. 2 is an SDS-PAGE detection;

wherein, M: ProteinMarker 1:293F cell culture supernatant 2: purification eluent 3: purified flow-through fluid

FIG. 3 is a Western-blot detection of HBV infected cell strains;

wherein, 1: hepag2.2.15 cells; 2: HepaG 2; m: ProteinMarker

FIG. 4 is Western-blot detection of variant expression strains;

wherein, N is pJW4303 plasmid transfection product, and 1-7 are respectively: pJW4303-HBsAg-118, 123, 130, 142, 145, 154, Wild plasmid transfection product

FIG. 5 is a Biacore T100 antibody affinity assay;

wherein, the curves from top to bottom represent Run4, Run5, Run3, Run1 and Run2 in sequence

FIG. 6 shows the results of the ability test of HBsAg variants.

Detailed Description

1. Culture and preparation of murine anti-HBsAg hybridoma cells

2. Amplification, sequencing, analysis and identification of murine anti-HBsAg antibody sequences

3. Preparation, expression and purification of human-mouse chimeric anti-HBsAg whole-molecule IgG

4. Characterization of human murine chimeric anti-HBsAg Whole-molecule antibody

5. Recognition ability of anti-HBsAg whole-molecule IgG to various variant strains

Example 1 culture and preparation of murine anti-HBsAg hybridoma cells

The prepared murine anti-HBsAg hybridoma cell is adopted, and the hybridoma cell is preserved in China center for type culture Collection with the preservation number of CCTCC NO: C2014151.

Conventionally harvesting mouse abdominal cavity macrophage as feeder cell, solving frozen hybridoma cell strain in 37 deg.C water bath, slowly adding 10 times volume of complete culture medium, centrifuging for 5min at 500g, removing supernatant, adding high-sugar DMEM complete culture medium containing 10% fetal calf serum, and 5% CO₂Culturing in a 37 ℃ cell culture box, changing the culture solution every other day, and collecting sufficient cells for later use. The antibody subtype was also determined using a monoclonal antibody subtype determination kit (ISO-2KT) from Sigma, USA, and the result showed that the anti-HBsAg antibody subtype was Ig2 a.

Example 2 amplification, sequencing, analysis and identification of murine anti-HBsAg antibody sequences

Extracting RNA of hybridoma cells, amplifying antibody genes, recovering target bands by glue, sequencing and analyzing results. The specific method comprises the following steps:

1. RNA extraction

RNA extraction was performed using the RNeasy Plus Mini Kit from Qiagen (cat # 74134), and the specific procedure was as follows:

1) counting cultured hybridoma cells, and collecting 1 × 10 cells⁷300g × 5min, the supernatant was removed and the cells were collected.

2) Cells were lysed by adding 600. mu.l buffer RLTplus.

3) Repeatedly blowing with a gun, and homogenizing.

4) The homogenate was transferred to a genome removal column at 8000g × 30s, and the filtrate was retained.

5) Adding 600 mul of 70% ethanol, repeatedly blowing, beating and uniformly mixing.

6) The liquid was transferred to an Rneasy column, 8000g × 15s, and the filtrate was discarded.

7) 700ul of RW1 buffer (8000 g.times.15 s) was added, and the filtrate was discarded.

8) 500ul of RPE buffer (8000 g.times.15 s) was added, and the filtrate was discarded.

9) 500ul of RPEbuffer (8000 g × 2 min) was added, and the filtrate was discarded.

10) Replace with a new 1.5ml ep tube and centrifuge at full speed for 1 min.

11) 30ul of RNase-free water was added thereto, and the elution was carried out at 8000 g.times.1 min.

2. Reverse transcription

Adopts the specific operation method of the RNAPCR Kit (AMV) Ver.3.0 (cargo number: RR019A) of the company Limited in Bao bioengineering (Dalian):

reverse transcription system

Reagent	Dosage of
		MgCl2	3μl
5×AMVBuffer	3μl
		NTPMixture	1.5μl
Inhibitor	0.375μl
		OligodT-AdaptorPrimer	0.75μl
RNA template	5μl
		AMV	0.75μl
Water (W)	0.625μl

Reaction procedure

30℃	10min
		50℃	30min
99℃	5min
		5℃	5min
4℃	Heat preservation

19 VH forward and 17V kappa forward primers, 4 VH reverse and 3V kappa reverse primers were designed with reference to the statistics of the Genebank database, and the primer sequences were as follows:

Vκforward primers

Vκ-1：5’-GGGCCCAGGCGGCCGAGCTCGAYATCCAGCTGACTCAGCC-3’

Vκ-2：5’-GGGCCCAGGCGGCCGAGCTCGAYATTGTTCTCWCCCAGTC-3’

Vκ-3：5’-GGGCCCAGGCGGCCGAGCTCGAYATTGTGMTMACTCAGTC-3’

Vκ-4：5’-GGGCCCAGGCGGCCGAGCTCGAYATTGTGYTRACACAGTC-3’

Vκ-5：5’-GGGCCCAGGCGGCCGAGCTCGAYATTGTRATGACMCAGTC-3’

Vκ-6：5’-GGGCCCAGGCGGCCGAGCTCGAYATTMAGATRAMCCAGTC-3’

Vκ-7：5’-GGGCCCAGGCGGCCGAGCTCGAYATTCAGATGAYDCAGTC-3’

Vκ-8：5’-GGGCCCAGGCGGCCGAGCTCGAYATYCAGATGACACAGAC-3’

Vκ-9：5’-GGGCCCAGGCGGCCGAGCTCGAYATTGTTCTCAWCCAGTC-3’

Vκ-10：5’-GGGCCCAGGCGGCCGAGCTCGAYATTGWGCTSACCCAATC-3’

Vκ-11：5’-GGGCCCAGGCGGCCGAGCTCGAYATTSTRATGACCCARTC-3’

Vκ-12：5’-GGGCCCAGGCGGCCGAGCTCGAYATTKTGATGACCCARAC-3’

Vκ-13：5’-GGGCCCAGGCGGCCGAGCTCGAYATTGTGATGACBCAGKC-3’

Vκ-14：5’-GGGCCCAGGCGGCCGAGCTCGAYATTGTGATAACYCAGGA-3’

Vκ-15：5’-GGGCCCAGGCGGCCGAGCTCGAYATTGTGATGACCCAGWT-3’

Vκ-16：5’-GGGCCCAGGCGGCCGAGCTCGAYATTGTGATGACACAACC-3’

Vκ-17：5’-GGGCCCAGGCGGCCGAGCTCGAYATTTTGCTGACTCAGTC-3’

Vκ3’reverse primers

VκR1：5’-AGATGGTGCAGCCACAGTTCGTTTKATTTCCAGYTTGGTCCC-3’

VκR2：5’-AGATGGTGCAGCCACAGTTCGTTTTATTTCCAACTTTGTCCC-3’

VκR3：5’-AGATGGTGCAGCCACAGTTCGTTTCAGCTCCAGCTTGGTCCC-3’

VH 5’forward primers

VH1：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTRMAGCTTCAGGAGTC-3’

VH 2：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTBCAGCTCAGCAGTC-3’

VH 3：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTGCAGCTGAAGSASTC-3’

VH 4：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTCCARCTGCAACARTC-3’

VH 5：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTYCAGCTBCAGCARTC-3’

VH 6：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTYCARCTGCAGCAGTC-3’

VH 7：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTCCACGTGAAGCAGTC-3’

VH 8：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTGAASSTGGTGGAATC-3’

VH 9：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTGAWGYTGGTGGAGT C-3’

VH 10：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTGCAGSKGGTGGAGT C-3’

VH 11：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTGCAMCTGGTGGAGT C-3’

VH 12：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTGAAGCTGATGGART C-3’

VH 13：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTGCARCTTGTTGAGTC-3’

VH 14：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTRAAGCTTCTCGAGT C-3’

VH 15：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTGAARSTTGAGGAGT C-3’

VH 16：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTTACTCTRAAAGWGT STG-3’

VH 17：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTCCAACTVCAGCARC C-3’

VH 18：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTGAACTTGGAAGTGT C-3’

VH 19：5’-GCTGCCCAACCAGCCATGGCCCTCGAGGTGAAGGTCATCGAGT C-3’

VH 3’reverse primers

VH R1：5’-CGATGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACCGTGGT-3’

VH R2：5’-CGATGGGCCCTTGGTGGAGGCTGAGGAGACTGTGAGAGTGGT-3’

VH R3：5’-CGATGGGCCCTTGGTGGAGGCTGCAGAGACAGTGACCAGAGT-3’

VH R4：5’-CGATGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACTGAGGT-3’

mixing the above primers at a certain ratio, and amplifying VH and VL genes respectively at 95 deg.C for 4min, 95 deg.C for 30s, 56 deg.C for 30s, 72 deg.C for 30 cycles; finally, extending for 10min at 72 ℃, electrophoretically recovering, purifying and amplifying the gene fragment, connecting to pMD-18T, transforming escherichia coli Top 10F', and obtaining the light chain and heavy chain variable region sequences after sequencing.

(1)PCR

The reaction system is as follows:

the reaction conditions were as follows:

(2) performing 2% agarose gel electrophoresis, observing a target band under ultraviolet, cutting the gel and recovering.

(3) And purifying the target DNA fragment by using the gel recovery kit, and eluting by using deionized water.

The recovered bands were sent to Shanghai Biotech for sequencing analysis.

Example 3 preparation, expression and purification of human murine chimeric anti-HBsAg Whole IgG

(1) Double restriction enzyme IgG expression plasmid

The IgG expression plasmids pFUSE-CHIg-hG1, pFUSE-CLIg-hk (from Invivogen) contained base coding sequences for the heavy and light chain (Kappa) constant regions of human origin of IgG 1.

Double digestion of pFUSE-CHIg-hG1, pFUSE-CLIg-hk template vectors

The reaction system is as follows:

the reaction conditions are as follows: the cleavage was carried out overnight at 37 ℃.

b.1% agarose gel electrophoresis, ultraviolet cutting gel recovery.

c. And purifying the target DNA fragment by using the gel recovery kit, and eluting by using deionized water.

(2) Infusion PCR recombinant expression plasmid

And comparing and analyzing the sequencing result, optimizing the nucleotide sequence according to the amino acid sequence, and handing to Shanghai bio-engineering company for complete sequence synthesis.

Primers for cloning were designed with the following sequences:

name (R)	Sequence of
		VHF	GGTGTCCACTCGCTAGAAGTTCAACTGGTGGAGTCTGGGGGA
VHR	GCCCTTGGTGGATGCTGAGGAGACTGTGAG
		VKF	ACAGACGCTCGCTGCGACATTGTGATGACCCAGTCT
VKR	TGCAGCCACCGTACGTTTGATTTCCAGCTTGGT

Corresponding sequences were amplified, the reaction system and the target band were shown in example 2, and the target gene was cloned by recombination. The reaction system is as follows:

the reaction conditions are as follows: incubate at 50 ℃ for 15 min.

5 mul of reaction solution was taken to transform competent bacteria, spread on the corresponding resistant plates, and the next day clones were picked for sequencing. And cloning and preserving strains with correct sequencing results, carrying out amplification culture, and extracting plasmids.

(3) Expression of anti-HBsAg Whole IgG molecule

a. Mu.g (or 250. mu.L) of the recombinant heavy chain plasmid was taken out in 1mL of Opti-MEM medium, 50. mu.g (or 250. mu.L) of the light chain plasmid was taken out in 1mL of Opti-MEM medium, 200. mu.L of 293Fectin was taken out in 2.8mL of Opti-MEM medium, and the three mixtures were allowed to stand at room temperature for 5 min.

b. After the two plasmid mixed solutions are mixed uniformly, 500 mu L of Opti-MEM culture medium is added and mixed uniformly, 3mL of mixed solution of the transfection reagent 293Fectin is directly added, and standing is carried out for 20min after uniform mixing. During the preparation of 293F cells, the 293F cells were centrifuged and resuspended in 293F Expression Medium, then counted and the ratio of cell viability calculated with trypan blue, and aspirated to 1.00X 10⁸The cells were placed in a flask and made up to 94mL with 293F Expression Medium.

At the end of c.20min, 6mL of the DNA, 293Fectin complex was added to the prepared 293F cells.

d. Culturing the cells in a shaking incubator under 8% CO₂Cell supernatants were collected after 6 days at 120rmp, 37 ℃.

(4) Purification of anti-HBsAg Whole-molecule IgG

The collected cell culture supernatant was filtered through a 0.45 μm filter while the balance and the eluate were filtered. The protein was purified using the AKATAP100 protein purification system following the standard procedure for ProteinA purification, loading at a flow rate of 1mL/min and eluting at a flow rate of 1.5 mL/min.

Example 4 characterization of human murine chimeric anti-HBsAg Whole antibody

(1) Enzyme-linked immunosorbent assay

Diluting the HBsAg recombinant protein with coating solution (0.1M carbonate buffer, pH9.6) to 2. mu.g/mL coated ELISA96 well plate, adding 100. mu.L each, and standing at 4 deg.C overnight; blocking with PBST (PBS containing 0.5% Tween20) 5% skim milk-wash buffer, incubating at 37 ℃ for 2 h; after PBST was washed 5 times, 100. mu.l of anti-HBsAg whole IgG diluted in two fold (250. mu.g/ml, 125. mu.g/ml, 62.5. mu.g/ml, 31.5. mu.g/ml, 15.62. mu.g/ml, 7.81. mu.g/ml, 3.96. mu.g/ml, 1.98. mu.g/ml, 0.99. mu.g/ml) was added to each well and incubated at 37 ℃ for 2 hours; adding 100 μ l of goat anti-human secondary antibody (diluted 1: 4000) into each well, and incubating at 37 ℃ for 1 h; PBST is washed for 5 times, added with peroxidase substrate developing solution, stopped with 2M sulfuric acid after 15min at room temperature, and processed on a computer to detect the absorbance value of protein.

The results are shown in figure 1, the engineered chimeric antibody of the invention can perform obvious antigen-antibody reaction with the recombinant HBsAg protein, can be effectively detected when the concentration is 0.99 mu g/ml, and indicate good antigen binding capacity, the polyacrylamide gel detection result of the purified antibody is shown in figure 2, and the heavy chain and the light chain are consistent with expected sizes, and no obvious impurity band exists.

(2) Co-immunoprecipitation

Mixing HepagG 2.2.15 cell lysate (for use after immunoglobulin is removed from ProteinA in advance) and humanized antibody respectively, diluting to 300 mu l with PBS, and placing in an environment of 4 ℃ for co-incubation; after 2h, Protein A immunomagnetic beads are added, and incubation is continued for 1 h. The supernatant was removed by centrifugation for 10min, rinsed 5 times with PBST, and 50. mu.l of citric acid eluate was added, centrifuged and the supernatant was collected, and 10. mu.l of Tris-base was added to neutralize the supernatant. The results are shown in FIG. 3, using SDS-PAGE and Western-blot for identification.

Meanwhile, eukaryotic expression plasmids (pJW4303-HBsAg-118, 123, 130, 133, 142, 145 and 154) cloned with HBsAg variants are adopted to carry out transfection in 293T cells by PEI, the cells are collected after 48 hours, freeze-thaw lysis is carried out, humanized antibodies are added for mixing, the volume is increased to 300 mu l by PBS, the mixture is placed in an environment at 4 ℃ for incubation, the method is the same as that, SDS-PAGE and Western-blot are used for identification after ProteinA affinity purification and elution, and the result is shown in figure 4.

(3) Affinity assays

The coupling conditions were optimized according to isoelectric point and protocol of BiacoreX100control soft, and sodium acetate was selected as the coupling dilution buffer for slope optimization. The anti-HBsAg humanized antibody sample was diluted to 25. mu.g/ml with this buffer and then coupled to a CM5 chip (GE # BR 100012). The preset coupling level was 1500 RU. A series of samples of chimeric antibody prepared according to the present invention was diluted with Runningbuffer at pH7.4 to a concentration of 0uM, 5nM, 10nM 20nM, 40nM, 80 nM. Setting the sample injection time at 180s, dissociation time at 10min, and regenerating buffer solution with 50mM pH2.2Gly-HCl. The on-board test was performed according to the protocol of BiacoreX100control soft. The affinity KD of the detected antibody is 5.719e (-10), and the result is shown in FIG. 5.

Example 5 detection of the recognition of HBsAg variants by anti-HBsAg Whole IgG

Quantifying the purified anti-HBsAg whole-molecule IgG, adjusting the purified anti-HBsAg whole-molecule IgG to 2 mu g/ml, coating the anti-HBsAg whole-molecule IgG on an ELISA 96-well plate, adding 100 mu L of the anti-HBsAg whole-molecule IgG into each well, and standing overnight at 4 ℃; blocking with PBST (PBS containing 0.5% Tween20) 5% skim milk-wash buffer, incubating at 37 ℃ for 2 h; after 5 PBST washes, 100. mu.l of HBsAg variant expression supernatant was added to each well, as follows: 118. 120, 122, 123, 126, 130, 141, 142, 143, 145, 146, 147, 154, 155, 181, 204, etc., and incubating at 37 ℃ for 2 h; mu.l of HRP-labeled goat anti-human HBsAg antibody (1: 5000 dilution) was added to each well and incubated at 37 ℃ for 1 h; PBST was washed 5 times, added with peroxidase substrate developing solution, quenched with 2M sulfuric acid at room temperature for 15min, and tested on a computer for protein absorbance values, the results are shown in FIG. 6.

FIG. 6 shows that the HBsAg variant 118Met, 120Thr, 123Ala, 126Asn, 130Arg, 141Leu, 142Ser, 143Leu, 145Arg, 146Ser, 154Thr, 181Thr, 204Ile, 204Val and the wild strain are effectively combined, and the combination ability with 118Met, 123Ala, 130Arg, 142Ser, 145Arg, 154Thr and the like is further verified by adopting an immune coprecipitation method (FIG. 4), which proves that the chimeric antibody can effectively identify most HBV variant antigens at present, including Arg 145 variant generated by vaccine prevention and clinical high titer immunoglobulin application, and has good application prospect for immune evasion of main variant in passive immune protection.

SEQUENCE LISTING

<110> first Hospital of Nanjing City

<120> human-mouse chimeric whole-molecule IgG antibody for identifying HBsAg variant and application thereof

<130>1

<160>12

<170>PatentIn version 3.3

<210>1

<211>321

<212>DNA

<213> Artificial sequence

<400>1

gacattgtga tgacccagtc tcaaaaactc atgtccgcat cagtaggaga cagggtcagc 60

gtcacctgca aggccagtca gaatgtggac actaatgtag cctggtttca acagaaacca 120

ggccaatctc ctaaagcact gatttactcg gcatcgtacc ggtacagtgg agtccctgat 180

cgcttcacag gcagtggatc tgggacagat ttcactctca ccatcagcaa tgtgcagtct 240

gaagacttgg cagagttttt ctgtcagcaa tatagcatct atccgttcac gttcggaggg 300

gggaccaagc tggaaataaa a 321

<210>2

<211>342

<212>DNA

<213> Artificial sequence

<400>2

gaagttcaac tggtggagtc tgggggaggc ttagtgcagc ctggagggtc cctgaaactc 60

tcctgtacag cctctggatt cactttcagt aactatgcca tgtcttgggt tcgccagact 120

ccagacaaga ggctggagtt ggtcacaacc attaacagtt atggtggtaa cacctattat 180

ccagacaatg tgaagggccg attcaccatc tccagagaca atgccaagaa caccctgtac 240

ctgcaaatga gcagtctgaa gtctgaggac acagccatgt attactgtgc aagagccttc 300

tactttgact actggggcca aggcaccact ctcacagtct cctcag 342

<210>3

<211>107

<212>PRT

<213> Artificial sequence

<400>3

Asp Ile Val Met Thr Gln Ser Gln Lys Leu Met Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Ser Val Thr Cys Lys Ala Ser Gln Asn Val Asp Thr Asn

20 25 30

Val Ala Trp Phe Gln Gln Lys Pro Gly Gln Ser Pro Lys Ala Leu Ile

35 40 45

Tyr Ser Ala Ser Tyr Arg Tyr Ser Gly Val Pro Asp Arg Phe Thr Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Val Gln Ser

65 70 75 80

Glu Asp Leu Ala Glu Phe Phe Cys Gln Gln Tyr Ser Ile Tyr Pro Phe

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105

<210>4

<211>114

<212>PRT

<213> Artificial sequence

<400>4

Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser

15 10 15

Leu Lys Leu Ser Cys Thr Ala Ser Gly Phe Thr Phe Ser Asn Tyr Ala

20 25 30

Met Ser Trp Val Arg Gln Thr Pro Asp Lys Arg Leu Glu Leu Val Thr

35 40 45

Thr Ile Asn Ser Tyr Gly Gly Asn Thr Tyr Tyr Pro Asp Asn Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr Leu

65 70 75 80

Gln Met Ser Ser Leu Lys Ser Glu Asp Thr Ala Met Tyr Tyr Cys Ala

85 90 95

Arg Ala Phe Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val

100 105 110

Ser Ser

<210>5

<211>6

<212>PRT

<213> Artificial sequence

<400>5

Gln Asn Val Asp Thr Asn

1 5

<210>6

<211>3

<212>PRT

<213> Artificial sequence

<400>6

Ser Ala Ser

1

<210>7

<211>9

<212>PRT

<213> Artificial sequence

<400>7

Gln Gln Tyr Ser Ile Tyr Pro Phe Thr

1 5

<210>8

<211>8

<212>PRT

<213> Artificial sequence

<400>8

Gly Phe Thr Phe Ser Asn Tyr Ala

1 5

<210>9

<211>8

<212>PRT

<213> Artificial sequence

<400>9

Ile Asn Ser Tyr Gly Gly Asn Thr

1 5

<210>10

<211>8

<212>PRT

<213> Artificial sequence

<400>10

Ala Arg Ala Phe Tyr Phe Asp Tyr

1 5

<210>11

<211>227

<212>PRT

<213> Artificial sequence

<400>11

Met Ser Val Pro Thr Gln Val Leu Gly Leu Leu Leu Leu Trp Leu Thr

1 5 10 15

Asp Ala Arg Cys Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser

20 25 30

Ala Ser Leu Gly Glu Arg Val Thr Met Thr Cys Thr Ala Gln Asn Val

35 40 45

Asp Thr Asn Val Ala Trp Phe Gln Gln Lys Pro Gly Gln Ser Pro Lys

50 55 60

Ala Leu Ile Tyr Ser Ala Ser Tyr Arg Tyr Ser Gly Val Pro Asp Arg

65 70 75 80

Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn

85 90 95

Val Gln Ser Glu Asp Leu Ala Glu Phe Phe Cys Gln Gln Tyr Ser Ile

100 105 110

Tyr Pro Phe Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Thr

115 120 125

Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu

130 135 140

Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro

145 150 155 160

Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly

165 170 175

Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr

180 185 190

Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His

195 200 205

Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val

210 215 220

Thr Lys Ser

225

<210>12

<211>232

<212>PRT

<213> Artificial sequence

<400>12

Met Glu Trp Ser Trp Val Phe Leu Phe Phe Leu Ser Val Thr Thr Gly

1 5 10 15

Val His Ser Leu Asp Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val

20 25 30

Gln Pro Gly Gly Ser Leu Lys Leu Ser Cys Thr Ala Ser Gly Phe Thr

35 40 45

Phe Ser Asn Tyr Ala Met Ser Trp Val Arg Gln Thr Pro Asp Lys Arg

5055 60

Leu Glu Leu Val Thr Thr Ile Asn Ser Tyr Gly Gly Asn Thr Tyr Tyr

65 70 75 80

Pro Asp Asn Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys

85 90 95

Asn Thr Leu Tyr Leu Gln Met Ser Ser Leu Lys Ser Glu Asp Thr Ala

100 105 110

Met Tyr Tyr Cys Ala Arg Ala Phe Tyr Phe Asp Tyr Trp Gly Gln Gly

115 120 125

Thr Thr Leu Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe

130 135 140

Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu

145 150 155 160

Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp

165 170 175

Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu

180 185 190

Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser

195 200 205

Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro

210 215220

Ser Asn Thr Lys Val Asp Lys Arg

225 230

Claims

1. A human mouse chimeric whole-molecule IgG antibody for identifying HBsAg variant is characterized in that the amino acid sequences of three antigen complementary region CDRs of a light chain variable region of the antibody are respectively shown as SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO. 7; the amino acid sequences of three antigen complementary region CDRs of the heavy chain variable region of the antibody are respectively shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO. 10.

2. The whole IgG antibody according to claim 1, wherein the amino acid sequence of said light chain variable region is SEQ ID No. 3; and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 4.

3. The whole IgG antibody of claim 1, wherein said HBsAg variant is one or more of 118Met, 120Thr, 123Ala, 126Asn, 130Arg, 141Leu, 142Ser, 143Leu, 145Arg, 146Ser, 154Thr, 181Thr, 204Ile, and 204 Val.

4. The whole IgG antibody of claim 3, wherein said HBsAg variant is one or more of 118Met, 123Ala, 130Arg, 142Ser, 145Arg, 154 Thr.

5. A nucleic acid molecule encoding the heavy and light chains of a whole IgG antibody according to any of claims 1-2.

6. The nucleic acid molecule of claim 5, wherein said light chain amino acid sequence is set forth in SEQ ID No.11 and said heavy chain amino acid sequence is set forth in SEQ ID No. 12.

7. The nucleic acid molecule of claim 5, wherein the variable region of the light chain has the nucleic acid sequence of seq id No. 1; the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 2.

8. An expression vector comprising the nucleic acid molecule of any one of claims 5-7 and an expression control sequence operably linked to the nucleic acid molecule.

9. A host cell transformed with the expression vector of claim 8.

10. Use of a whole IgG antibody in the preparation of a diagnostic reagent or a therapeutic drug for HBV, wherein the whole IgG antibody is the whole IgG antibody according to any one of claims 1 to 4.