CN110755425B

CN110755425B - Application of Largazole in preparation of medicine for treating diseases caused by overexpression of Msi1 gene ectopy

Info

Publication number: CN110755425B
Application number: CN201810835428.6A
Authority: CN
Inventors: 于政权; 宋永利; 毕雪云
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2018-07-26
Filing date: 2018-07-26
Publication date: 2022-06-24
Anticipated expiration: 2038-07-26
Also published as: CN110755425A

Abstract

The invention discloses application of Largazole in preparing a medicament for treating diseases caused by ectopic overexpression of an Msi1 gene. The invention firstly proves that Largazol can inhibit the expression of the Msi1 gene, after a DTG mouse is coated with Largazol medicine, the expression of the Msi1 at the transcription level and the translation level is reduced, and the symptom of the mouse extramammary Paget disease is found to be well recovered through histological observation and immunohistochemical staining, which indicates that Largazol can relieve the symptom of the mouse extramammary Paget disease and is realized by reducing the expression of the Msi 1. The invention provides a new medicine for treating the external mammary gland Paget disease of mice and human.

Description

Application of Largazole in preparation of medicine for treating diseases caused by ectopic overexpression of Msi1 gene

Technical Field

The invention relates to the field of biological medicines, in particular to application of Largazole in preparing a medicine for treating diseases caused by ectopic overexpression of an Msi1 gene.

Background

Largazole was originally discovered by the peer of the Luesch, university of florida, usa, and isolated from cyanobacteria as a compound having a sixteen-membered cyclic peptide lactone. Belongs to the inhibitors of histone deacetylase. The drug has good antiproliferative activity found in human and murine cells. The medicine acts on different cells in a dose-dependent manner, has inhibitory effect on growth of human breast tumor epithelial cells (MDA-MB-231) at high concentration, and is insensitive to non-cancerous murine epithelial cells (NMuMG). Many natural antineoplastic drugs do not have such high selectivity for cells. In addition, it has good inhibitory effect on human neuroblastoma cell (IMR-32) and colon tumor cell (HT29) (Ying Y,2008, J Am Chem Soc,30: 8455-8459).

Largazole contains 4 building blocks, 1: a thiazole-thiazoline fragment. 2: a beta-hydroxy ester fragment. 3: boc-valine fragment. 4: side chains. And respectively synthesizing the fragments, and finally splicing the four units. A completely new Largazole was synthesized. The medicine belongs to cyclic peptide compounds, consists of a plurality of amino acids, is a compound with novel structure, wide biological activity and unique action mechanism, and has wide antitumor and immunosuppressive activity.

Largazole blocks HCT116 cell cycle at low concentrations (1-3.2nM) at G1 and at high concentrations (10. gtoreq. nM) at G2/M. The Largazole can inhibit the proliferation of leukemia cells, non-small cell lung cancer cells, colon cancer cells, central nervous system cancer cells, melanoma cancer cells, ovarian cancer cells, renal cancer cells, prostate cancer cells, breast cancer cells and the like. Promoting apoptosis (Yanxia Liu,2010, The Journal of pharmacology and experimental therapeutics,335: 351-361).

Musashi1(Msi-1 or Msi1) is an RNA binding protein, has relatively conserved sequence, is found for the first time in Drosophila, is an RNA binding protein required in asymmetric cell division, and has an important role in neural stem cell development. Msi-1 plays an important role in the maintenance of stem cell function and self-renewal capacity, differentiation and tumorigenesis. The mouse Msi1 gene is located on the 5 th chromosome, has a full length of 2458 bp, and consists of 15 exons and 14 introns, wherein the mRNA is 1551nt, and the CDS region is 1089 nt. The mouse Msi1 protein is approximately 39KD in size, consists of 362 amino acids, and contains 2 conserved rrm (rna Recognize domain) domains at the N-terminus. Furthermore, Msi1 acts as a positive regulator of Notch signaling by binding to numb mRNA. In addition to functioning in the nervous system, in the gut, intestinal mucosa, mammary glands, Msi-1 is a selectable marker for various epithelial or progenitor cells, and Msi-1 may be expressed in early progenitor cells and function by regulating stem cell asymmetric division (Clarke RB, 2005, Dev Biol, 277: 443-.

Researchers have found that Msi-1 is expressed in luminal epithelial cells of the gastric mucosa, these cells are distinct from epithelial cells except for expression in parietal cells (gastrocytes), where Msi-1 and HES5 are co-expressed, Msi-1 positive cells are exfoliated after gastrointestinal damage, and the amount of Msi-1 positive cells expressed is up-regulated in cervical mucus cells of gastric tissues (Hiroshi Nagataa, 2006, FEBS Letters, 580(2006) 27-33). After gastrointestinal tract injuryHow to repair by self-reconstruction is always a focus of scientific research, a repair mechanism can be quickly started to complete the repair of epithelial cells after gastrointestinal tract is damaged, and reports indicate that the gastric mucosa can quickly repair self-epithelium after the gastric mucosa is damaged, the gastrointestinal epithelial cells can be reconstructed within 90min after the mucosa is damaged, and Msi-1 may participate in the repair of the damaged epithelium (

JE，1987，Gastroenterology，93(4):753)。

At present, no good treatment method exists at home and abroad for treating the external mammary gland Paget disease, and once diagnosis is confirmed, a surgical excision method is needed for treatment.

Disclosure of Invention

The invention aims to provide application of Largazole in preparing a medicament for treating diseases caused by ectopic overexpression of an Msi1 gene.

In order to achieve the object of the invention, in a first aspect, the invention provides the use of Largazole for the preparation of a medicament for treating a disease caused by ectopic overexpression of the Msi1 gene, wherein Largazole has the following structural formula:

in the formula (I), Me represents a methyl group.

Preferably, the ectopic overexpression refers to overexpression of the Msi1 gene in the basal layer of the skin.

More preferably, the disease is Paget's disease due to overexpression of the Msi1 gene.

Most preferably, the disease is an extra-mammary Paget disease due to overexpression of the Msi1 gene.

In a second aspect, the invention provides a medicament or composition for treating a disease caused by ectopic overexpression of the Msi1 gene.

For in vitro administration to mice, Largazole was dissolved in acetone and applied to the affected area at a concentration of 40 μ M. When Largazole is used as a target cell, it is prepared in DMSO at a concentration of 0.3. mu.M and then allowed to act on the cell.

In a third aspect, the present invention provides an m-TOR signaling pathway inhibitor comprising as an active ingredient the compound Largazole.

In a fourth aspect, the invention provides the use of Largazole in the manufacture of a medicament for the treatment of a disease caused by abnormal activation of the m-TOR signaling pathway.

In a fifth aspect, the invention provides a drug for inhibiting expression of the Msi1 gene, the active ingredient of the drug is Largazole, and the drug can treat the external mammary Paget disease caused by ectopic high expression of the Msi1 gene.

In the present invention, human and mouse Msi1 genes have accession numbers NM-002442.3 and NM-008629.1 in GenBank.

In the present invention, the administration mode of Largazole for treating external Paget disease of mammary gland can be external application (smearing, spraying) or intramuscular injection.

By the technical scheme, the invention at least has the following advantages and beneficial effects:

the invention proves that Largazole can inhibit the expression of the Msi1 gene for the first time, abnormal changes of skin are caused after the specific overexpression of Msi1 in the skin, the histological structure and the molecular level are obviously changed, histological changes are caused after the overexpression of Msi1, and the changes of histological and molecular characteristics caused by the overexpression of Msi1 can be recovered by coating Largazole on mice. By giving Msi1 overexpressing mice acetone and acetone + Largazole, respectively, and then sampling, the phenotype of the overexpressing Msi1 mice was restored from HE staining results after Largazole application, and by examining Msi1 from both transcription and translation levels, it was found that Msi1 was reduced in both transcription and translation levels after Largazole application. Indicating that Largazole reduces the symptoms of mouse extramammary Paget's disease by reducing the expression of Msi 1. The invention provides a new medicine for treating the external mammary Paget disease of mice and human beings.

Drawings

FIG. 1 is a schematic diagram of the process of constructing a mouse model of the extramammary Paget disease in example 1 of the present invention. A mice (K14rtta transgenic mice) were crossed with B mice (TRE-Msi1 transgenic mice).

FIG. 2 shows the results of the identification of the mouse model of the extramammary Paget disease in example 1 of the present invention. K14rttA, 500 bp; and B, Tre-msi1, 300bp and 500 bp.

FIG. 3 shows the results of genotyping mice overexpressing the Musashi1 gene of example 1. A: comparison; b: msi1 overexpressing mice (DTG mice).

FIG. 4 shows PAS staining results of DTG mice in example 1 of the present invention. The arrow indicates positive cells.

FIG. 5 shows immunohistochemical staining results of the paget-like disease markers in example 1 of the present invention.

FIG. 6 shows the results of HE staining in example 1 of the present invention. In these, Msi1 overexpressed DTG mice appeared enlarged and had slightly cytoplasmic stained paget-like cells, which were significantly reduced after Largazole application. The symptoms of the disease are reduced.

FIG. 7 shows the results of immunohistochemical staining in example 1 of the present invention. Wherein, control mice: DTG transgenic mice were acetone-coated. Experimental mice DTG transgenic mice were coated with Largazole. The results show that expression levels of Msi1 in Largazole-coated mice are significantly reduced, demonstrating that Largazole can inhibit expression of Msi 1.

FIG. 8 shows verification of the expression level of the Msi1 gene at the transcriptional level in example 1 of the present invention. The result shows that after the application of the Largazole, the expression of the transcription level of the Msi1 is inhibited, and further the expression of the transcription level of markers of the mammary gland external paget disease caused by ectopic high expression of the Msi1, such as Mmp9, Vimentin, Erbb2, Podoplanin, Krt8, Krt7 and Gata3, is obviously reduced, and the result shows that the Largazole can inhibit the expression level of the Msi1, and further reduce the symptoms of the mammary gland external paget disease.

FIG. 9 shows the results of western blot detection in example 1 of the present invention. Wherein, the first 2 lanes are DTG mice coated with acetone (Ace), the second two lanes are DTG mice coated with Largazole, and the expression of the translation level of the Msi1 is obviously reduced after the coating with Largazole is shown by western blot.

FIG. 10 shows that Largazole can inhibit the expression of Msi1 in example 1 of the present invention by in vitro cell experiments. Among them, in Lovo cells (colon cancer cells), Largazole at different concentrations was added, which showed that Largazole at different concentrations could inhibit the expression of the transcriptional level of Msi 1. However, when the concentration of 0.3. mu.M or more was added, the effect of inhibiting Msi1 remained almost unchanged. Largazole proved to be dose dependent.

FIG. 11 shows the results of western blot analysis of in vitro cell experiments in example 1 of the present invention. Wherein, in Lovo cells, protein samples are extracted at the time of adding 24h by adding 0.3 mu M Largazole, and western blot results show that the expression of the Msi1 protein level can be obviously reduced by adding 0.3 mu M Largazole.

FIG. 12 is the expression of a characteristic or pathological marker of the extramammary paget disease in example 1 of the present invention. Wherein, after 20 mu M Largazole is smeared on the skin of a mouse, the expression of pS6 and M-TOR is increased in a DTG acetone-smeared mouse, and the M-TOR pathway is activated, and after the 20 mu M Largazole is smeared on the DTG acetone-smeared mouse, the M-TOR pathway is inhibited. In DTG mice, symptoms of extramammary paget disease are shown due to ectopic overexpression of Msi1, and after the action of Largazole drugs, the expression of characteristic or pathological markers of extramammary paget disease, such as K8, Vimentin and Podoplanin, is obviously reduced. Thus, following Largazole drug action, the symptoms of extramammary paget's disease diminish.

In FIG. 6, FIG. 7 and FIG. 12, the bar is 25 μm.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are commercially available products.

Compounds Largazoles are described in Li-Chuan Wu, Zhe-Sheng Wen, Ya-Tao Qia.et al (2013) Largazol Arrests Cell Cycle at G1 Phase and Triggers protein Degradation of E2F1 in Lung Cancer Cells, ACS Med. chem. Lett,4, 921-926.

Example 1 use of Largazole for the treatment of extra-mammary Paget's disease due to overexpression of the Msi1 gene

Preparation of an extramammary mouse paget disease model (inducible mouse model)

This example prepared a transgenic mouse model (DTG mouse) with expression of Musashi1 controlled by doxycyline (dox). Overexpression of the foreign gene Musashi1 was induced by feeding Dox to mice. After Musashi1 is overexpressed for 48h (i.e., 48h after Dox administration), symptoms of the primary extramammary paget disease can develop.

The specific preparation method of the DTG mice is as follows:

the K14rtta transgenic mouse and a TRE-Msi1 transgenic mouse are mated (the construction method of the two transgenic mice is shown in Wang S, Li N, Yousefi M, Nakauka-Ddamba A, Li F, Parada K, et al (2015) Transformation of the endogenous polypeptide by the MSI2 RNA-binding protein. nat Commun 6:6517), a progeny mouse is generated, and when the progeny mouse grows to 6 weeks, tetracycline with the final concentration of 0.2g/L is added into drinking water of the mouse, so that the mouse can freely drink water, the drinking water is sufficient, and the gene Musashi1 is induced to be overexpressed. After tetracycline is fed for 48 hours, mice with external mammary gland paget disease-like symptoms can appear, namely external mammary gland mouse paget disease models (DTG mice).

And (3) identifying the genotype of the DTG mice:

1. extracting mouse genome DNA as a template, performing PCR amplification (the PCR target is K14 rta gene) by taking F1 and R1 as primers, and detecting an amplification product to generate a characteristic band of 500 bp. And (3) PCR reaction system: mix 6. mu.L (Kangwei century, cat # 01037/30252), F10.6. mu.L, R10.6. mu.L, genomic DNA template 1. mu.L, ddH₂O3.8. mu.L. Reaction procedures are as follows: 5min at 95 ℃; 30s at 95 ℃,30 s at 61 ℃,30 s at 72 ℃ and 35 cycles; 72 ℃ for 2 min.

2. Extracting mouse genome DNA as a template, performing PCR amplification (the PCR target is TRE-Msi1 gene) by taking F2 and R2 as primers, detecting the amplification product, and generating two characteristic bands of 300bp and 500 bp. And (3) PCR reaction system: mix 6. mu.L (Kangwei century, cat # 01037/30252), F20.6. mu.L, R20.6. mu.L, G0.6. mu.L, genomic DNA template 1. mu.L, ddH₂O3.2. mu.L. Reaction procedures are as follows: 5min at 95 ℃; 30s at 95 ℃,30 s at 56 ℃,30 s at 72 ℃ and 35 cycles; 72 ℃ for 2 min.

Mice identified as extramammary Paget disease mice that meet both 1 and 2 above. If other genotypes are present, they are littermate control mice.

The primer sequences used were as follows (SEQ ID NOS: 1-5):

F1:5′-CACGATACACCTGACTAGCTGGGTG-3′

R1:5′-CACGATACACCTGACTAGCTGGGTG-3′

F2:5′-CCCTCCATGTGTGACCAAGG-3′

R2:5′-GCACAGCATTGCGGACATGC-3′

G:5′-GCAGAAGCGCGGCCGTCTGG-3′

(II) mouse drug treatment

When the DTG mice grow for 6 weeks, the back hairs of the DTG mice are shaved off, and after the DTG mice are shaved off, the DTG mice begin to be coated with the medicine once a day for 5 days continuously. The application of the drug is stopped before sampling.

The specific method for applying the medicine comprises the following steps: for littermates, a portion of the DTG mice were painted with acetone (control group) and another portion of the DTG mice were painted with Largazole (40 μ M Largazole concentration in acetone, experimental group), each mouse being painted 200 μ L per day (capable of completely covering the back skin of the mice). On the 3 rd day of drug application, 0.2g/L Dox was added to the drinking water of each group of experimental mice to allow the mice to drink water freely, thereby ensuring sufficient drinking water and inducing the overexpression of the gene Musashi 1. Meanwhile, the medicine is continuously applied for 5 days. And starting sampling after the medicine application is finished on the 5 th day, and carrying out subsequent experiments.

(III) sampling

Littermates of acetone-coated DTG mice were used as a control group. Largazole + acetone coated DTG mice were used as experimental groups. The mice were sacrificed by dislocation of the neck, the hair on the back was removed by electric clippers, a small rectangular back skin was taken with scissors, fixed with 4% paraformaldehyde for 24h, washed with PBS 3 times for 20min each time, and trimmed to tissue blocks of about 1cm × 0.75cm size with a razor blade. The hair is cut at the angle (in the direction of the hair) and a small piece is cut off in preparation for dehydration.

(IV) dehydration

The dehydration procedure and procedure are as follows

The temperature of the last 3 steps is set to 60 ℃ to dissolve the wax, and the rest is normal temperature.

(V) embedding

Embedding in paraffin, vertically embedding, cutting into 5 μm size, spreading in 39 deg.C water bath, observing under solid microscope whether the film is completely spread, taking out the spread film with adhesive glass slide, and air drying.

(VI) mouse phenotype analysis (HE staining)

Hematoxylin-eosin staining (HE staining), abbreviated as HE staining, is the most common method used in cytology, histology, embryology and pathology, and can visually observe abnormal changes of tissue cells.

1. Baking slices: 63 ℃ and 1 h.

2. Dewaxing and hydrating.

3. Xylene I:15 min.

4. Xylene II 15min

5. Gradient ethanol treatment:

100% ethanol I, II: each for 5min

95% ethanol I, II: each for 5min

80% ethanol for 5min

70% ethanol for 5min

Distilled water: 5min

And (3) hematoxylin: for 10min

Tap water: 5min

95% ethanol I, II: each for 3min

Eosin: 10s

95% ethanol I, II: each for 3min

100% ethanol I, II: each for 3min

Xylene I:10min

Xylene II 10min

And sealing and taking a picture.

(VII) immunohistochemistry

1. Baking slices: 63 ℃ and 1 h.

2. Dewaxing and hydrating.

3. Xylene I:15 min.

4. And 15min for xylene II.

5. Gradient ethanol treatment:

100% ethanol I, II: each for 5min

95% ethanol I, II: each for 5min

80% ethanol for 5min

70% ethanol for 5min

Distilled water: and 5 min.

6. Antigen retrieval: boiling sodium citrate with pH of 6.0 for 20 min.

7. And (3) natural cooling: about 1 h.

PBS treatment 3 times, 5 min/time.

9.H₂O₂Light shielding for 20 min.

PBS treatment 3 times, 5 min/time.

11. And (3) sealing: the confining liquid acts for at least 1 h.

12. A first antibody: the prepared primary antibody is added according to the proper proportion and amount and stays overnight at 4 ℃.

13. Rewarming: standing at room temperature for half an hour.

PBS treatment 3 times, 5 min/time.

Solution B: room temperature for 30 min.

PBS treatment 3 times, 5 min/time.

Liquid C: room temperature for 30 min.

PBS treatment 3 times, 5 min/time.

19. Distilled water: the treatment is carried out for 5 min.

DAB, stopping color development under the condition of proper color development time according to the characteristics of the antibody, and putting the antibody into distilled water.

21. And (3) hematoxylin: counterstaining for 5 min.

22. Tap water: the treatment is carried out for 5 min.

23. Gradient ethanol treatment:

70% ethanol for 3min

80% ethanol for 3min

90% ethanol for 3min

3min with 100% ethanol

Xylene I:5min

Xylene II:5min

And sealing and taking a picture.

Wherein, the B liquid and the C liquid are from a China fir Jinqiao kit, and the catalog number is as follows: sp9001, sp 9002.

(eighth) quantitative PCR

1. Extraction of RNA

(1) A sample of mouse skin was shaved, and cut into skin pieces of 1.5cm long by 1cm wide, and 1mL of TRIzol reagent (sample volume not more than 10% of TRIzol volume) was added to the skin pieces, and the tissue was disrupted with a tissue homogenizer.

(2) 0.2mL of chloroform was added to 1mL of TRIzol, and the mixture was vigorously shaken and mixed for 15 seconds, and then allowed to stand at room temperature for 2 min. Then, 12000g was centrifuged at 4 ℃ for 15min, and 400. mu.L of the supernatant was carefully pipetted into a centrifugal tube without RNase.

(3) 400 μ L of isopropanol was added to the supernatant, mixed by inversion, left at room temperature for 10min, and then centrifuged at 12000g at 4 ℃ for 10 min.

(4) Carefully discard the supernatant, add 1mL 75% ethanol (in DEPC water), gently bounce the pellet up and down, centrifuge at 12000g for 3min at 4 ℃, discard the supernatant, and empty for 2 min. Excess ethanol was aspirated.

(5) Adding 30 mu L DEPC water to resuspend the precipitated RNA, standing on ice for 30min, using a part of the sample for reverse transcription, performing quantitative PCR, and storing the rest samples at-70 ℃.

2. Reverse transcription to synthesize cDNA

Reverse transcription system:

70 ℃ for 5 min. Cooling on ice for 3 min.

Synthesis of cDNA:

42 ℃ for 60 min. Then, cDNA was obtained at 70 ℃ for 15 min.

3. Quantitative PCR

And (3) PCR reaction system:

quantitative PCR primers (5 '-3'):

MSI1 F:CACTTCCATGAAATCAACAACAA

R:GGCTGGGCTTTCTTGCATT

MMP9 F:GCAGAGGCATACTTGTACCG

R:TGATGTTATGATGGTCCCACTTG

ERRB2 F:TGCAGGGAAACCTGGAACTC

R:ACAGGGGTGGTATTGTTCAGC

PODOPLANIN F:ACCGTGCCAGTGTTGTTCTG

R:ACCATGCCGTCTCCTGTACC

KRT8 F:AAGGTCTGGAAGCCCAGATT

R:CTTGGTGGTGACAACTGTGG

KRT7 F:AGGAGATCAACCGACGCAC

R:GTCTCGTGAAGGGTCTTGAGG

GATA3 F:AAGCTCAGTATCCGCTGACG

R:GTTTCCGTAGTAGGACGGGAC

and (3) PCR reaction conditions: 10min at 95 ℃; 95 ℃ for 10s, 60 ℃ for 10s, 72 ℃ for 10s, 45 cycles.

(nine) Western blot

1. Extraction of proteins

(1) The hair on the back of the mouse was shaved off, and a skin piece of about 1.5cm in length and 1cm in width was taken, and 400. mu.L of an IP cell lysate was added to the sample and mixed well. PMSF: the IP volume ratio is 1:100, the final concentration of PMSF is 1mmol/L, and the tissue is dispersed uniformly by a homogenizer.

(2) Shaking on ice for 30min to fully lyse the tissue.

(3) Centrifuging at 12000g for 10min at 4 deg.C, collecting supernatant, and performing Western operation.

2. Determination of protein concentration

The concentration of each sample was determined using a Biyun-day BCA assay kit according to the instructions.

3. Protein electrophoresis

(1) According to the concentration measured in the previous step, the sample was loaded in an amount of 50. mu.g per sample.

(2) Electrophoresis: the voltage is 60v, and when the marker runs through the concentrated glue, the voltage is changed to 90 v. The electrophoresis was stopped until bromophenol blue ran to the lower edge of the gel. Preparing for film transfer.

(3) Film transfer: full wet process film transfer, current: 330mA, time: and (4) 1 h.

(4) And (3) sealing: 5% skimmed milk powder for 1 h.

(5) Primary antibody: musashi1, molecular weight: 39KD, murine origin, 1:1000 dilution ratio, 4 ℃ overnight.

(6) Secondary antibody: and (4) 1 h.

(7) And (6) developing.

Wherein, the first antibody: msi1 (from MBL, dilution ratio 1:1000, cat # D270-3). Internal control β -tubulin (purchased from shanghai assist saint biotechnology limited, dilution ratio 1: 4000), secondary antibody horseradish peroxidase-labeled goat anti-rat IgG (H + L), numbered: a0192, horseradish peroxidase-labeled goat anti-mouse IgG (H + L), no: a0216, purchased from Shanghai assist saint Biotech Co., Ltd, at a dilution ratio of 1: 10000.

FIG. 1 is a schematic diagram of the process of constructing a mouse model of the extramammary Paget disease. A mice (K14rtta transgenic mice) were crossed with B mice (TRE-Msi1 transgenic mice).

FIG. 2 shows the result of identifying a mouse model of Paget's disease in vitro mammary gland. A is K14rttA, 500 bp; b, Tre-msi1, 300bp and 500 bp.

FIG. 3 shows the results of genotyping the mice overexpressing the gene Musashi 1. A: comparison; b: msi1 overexpressing mice (DTG mice).

FIG. 4 shows the result of PAS staining in DTG mice. The arrow indicates positive cells.

FIG. 5 is the results of immunohistochemical staining of paget-like disease markers.

FIG. 6 shows the results of HE staining. In these, Msi1 overexpressed DTG mice appeared enlarged and had slightly cytoplasmic stained paget-like cells, which were significantly reduced after Largazole application. The symptoms of the disease are reduced.

FIG. 7 shows immunohistochemical staining results. Wherein, control mice: DTG transgenic mice were acetone-coated. Experimental mice DTG transgenic mice were coated with Largazole. The results show that expression levels of Msi1 in Largazole-coated mice are significantly reduced, demonstrating that Largazole can inhibit expression of Msi 1.

Fig. 8 is a graph showing the verification of the expression level of the Msi1 gene at the transcriptional level. The results show that after the Largazole is coated, the expression of the Msi1 transcription level is inhibited, and further the expression of the Msi1 ectopic high expression caused markers of the mammary gland external paget disease, such as Mmp9, Vimentin, Erbb2, Podoplanin, Krt8, Krt7 and Gata3 transcription level is obviously reduced, and the results show that the Largazole can inhibit the expression level of the Msi1 and further weaken the symptom of the mammary gland external paget disease.

FIG. 9 shows the results of western blot detection. Wherein, the first 2 lanes are DTG mice coated with acetone (Ace), the second two lanes are DTG mice coated with Largazole, and the expression of the translation level of the Msi1 is obviously reduced after the coating with Largazole is shown by western blot.

Fig. 10 is a graph demonstrating that Largazole can inhibit the expression of Msi1 by in vitro cell experiments. Among them, in Lovo cells (colon cancer cells), Largazole at different concentrations was added, which showed that Largazole at different concentrations could inhibit the expression of the transcriptional level of Msi 1. However, when the concentration of 0.3. mu.M or more was added, the effect of inhibiting Msi1 remained almost unchanged. Largazole proved to be dose dependent.

FIG. 11 shows the results of western blot assays in vitro cell experiments. Wherein, in Lovo cells, protein samples are extracted at the time of 24h addition by adding 0.3 mu M Largazole, and western blot results show that the expression of the Msi1 protein level can be obviously reduced by adding 0.3 mu M Largazole.

FIG. 12 is the expression of characteristic or pathological markers of extramammary paget disease. Wherein, after 20 μ M Largazole is smeared on the skin of mice, the expression of pS6 in DTG acetone-smeared mice is increased, the M-TOR pathway is activated, and after the 20 μ M Largazole is smeared on the skin of the mice, the M-TOR pathway is inhibited. In DTG mice, symptoms of extramammary paget disease are shown due to ectopic overexpression of Msi1, and after the action of Largazole drugs, the expression of characteristic or pathological markers of extramammary paget disease, such as K8, Vimentin and Podoplanin, is obviously reduced. Thus, following Largazole drug action, the symptoms of extramammary paget's disease diminish.

The above experimental results show that:

largazole was first demonstrated to inhibit the expression of Msi1 in vitro cell experiments by real-time quantitative PCR and western blot. And the inhibition effect is obvious.

In a mouse model that induces ectopic overexpression of Msi1, the disease symptoms paget-like cells substantially disappear and the symptoms are reduced after administration of Largazole drug.

In an in vitro mouse model, protein expression levels of Msi1 were significantly reduced by immunohistochemistry following Largazole drug administration.

In a transgenic mouse model, after acetone and Largazole medicaments are applied, RNA is extracted, and quantitative PCR detection shows that the expression level of a paget-like marker is reduced after the latex medicaments are applied, which indicates that the paget-like disease is reduced after the Largazole medicaments are applied.

It can be seen that Largazole slows down paget-like disease by inhibiting ectopic expression of the Msi1 gene.

Largazole has achieved very good results in the treatment of mouse EMPD disease (extramammary Paget disease) and creams are currently being developed for use in clinical trials of Largazole drugs in humans. Will soon be expected to be useful in the treatment of EMPD diseases.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of agriculture in China

Application of <120> Largazole in preparation of medicine for treating diseases caused by ectopic overexpression of Msi1 gene

<130> KHP181113673.1

<160>5

<170>SIPOSequenceListing1.0

<210> 1

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cacgatacac ctgactagct gggtg 25

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cacgatacac ctgactagct gggtg 25

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccctccatgt gtgaccaagg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcacagcatt gcggacatgc 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gcagaagcgc ggccgtctgg 20

Claims

Use of Largazole for the manufacture of a medicament for the treatment of a disorder caused by ectopic overexpression of the Msi1 gene, wherein Largazole has the following structural formula:

the disease is external Paget disease of mammary gland.