CN110747233A - Insulator-containing lentivirus stable expression vector and construction method thereof - Google Patents

Abstract

The invention relates to a stable lentiviral expression vector containing an insulator and a construction method thereof, belonging to the technical field of biomedical engineering. The insulator IS22.3 IS integrated into a lentiviral vector, and the lentiviral vector comprises a lentiviral vector promoter; the sequence of IS22.3 IS shown as SEQ ID No. 1. The present inventors succeeded in developing a novel lentiviral vector containing a chromatin insulator (IS 22.3) which exhibits a stable and efficient expression function as compared with the conventional lentiviral vector. The lentiviral vector is expected to become a new choice for gene therapy and cell transfection research.

Description

Insulator-containing lentivirus stable expression vector and construction method thereof

Technical Field

The invention relates to a stable lentiviral expression vector containing an insulator and a construction method thereof, belonging to the technical field of biomedical engineering.

Background

Lentiviral Vectors (LV) belong to retroviral vectors, and they can stably express a target gene by efficiently transfecting dividing cells and non-dividing cells and integrating a foreign gene into genomic DNA. Is an effective vector for gene transfer in mammalian cells, and is widely applied to basic experimental research and gene therapy.

However, lentiviral vectors also have their limitations in the long-term stable expression of exogenous genes and in the transfection of multiple genes. Usually, the gene transferred by the viral vector loses expression after a period of time, i.e., the foreign gene is silenced. There are generally three mechanisms thought to be involved in the transfer of lentiviral vectors into gene silencing: the promoter is inactivated by intrinsic trans-acting factors of the cellular genome distal to the viral Long Terminal Repeat (LTR), methylation of CpG sites within the internal promoter, chromatin condensation, and thus silencing the transgene. Moreover, these and other reasons have led to the expression of exogenous genes in different cell types, and even in different individuals of the same cell type, with great variability in expression. These all severely impact experimental studies and gene therapy.

Commercial lentiviral vectors have been developed to the third generation (e.g., products of Life Technologies), and commercial third generation products have been introduced on the basis of one or two experimental lentiviral vectors, but all focus on safety improvement. Researchers have adopted MSCV and EF1 promoters aiming at methylation of CpG sites in internal promoters, and recently SFFV promoters are mostly used for stem cell transfection, but are still insufficient in expression efficiency and stability.

Francisco Martin and the like construct a lentivirus protein stable expression vector (1) by using an insulator (IS2), and the invention successfully constructs a lentivirus stable RNA interference (RNAi) vector (2) containing IS2 on the basis of the research.

Disclosure of Invention

The invention aims to overcome the defects and provides a stable lentiviral expression vector containing an insulator and a construction method thereof, wherein a component of a lentivirus is formed by combining a CTCF (CCCTC binding factor) binding domain sequence with a promoter, thereby overcoming the instability of gene silencing and exogenous gene expression.

According to the technical scheme, the insulator-containing lentivirus stable expression vector IS characterized in that an insulator IS22.3 IS integrated into a lentivirus vector, and the lentivirus vector comprises a lentivirus vector promoter; the sequence of IS22.3 IS shown as SEQ ID No. 1.

There are also inherent special sequences in eukaryotic genomic DNA that are involved in expression regulation, such as insulators, to prevent the aforementioned regulatory elements from interfering and chromatin from condensing, and to maintain the essential stability of gene expression.

The Insulator (Insulator) DNA sequence (IS22 & 3) used in the present invention IS located on human chromosome 22, and the sequence IS located between the protein gene with helical domain (ZDHHC8) and the reticuloendothelin-4 receptor (Endothelin 4receptor) (3). The upstream regulatory region of ZDHHC8 has DNA sequences that bind CTCF and block the enhancer effect.

The invention simulates a genome structure, and integrates the sequence into a lentiviral vector as a regulatory element of a vector promoter, and the specific structure is shown in figure 1. As shown in FIG. 1, a stable expression vector driven by RNA polymerase III promoter represented by U6, RNA polymerase II promoter represented by SFFV, and CMV/H1 fusion promoter which are the two promoters was constructed.

FIG. 1 shows a lentiviral vector comprising an insulator (IS 22.3), A IS RNA polymerase III promoter U6; b is a fusion of RNA polymerase II and III promoters, CMV is an enhancer sequence from RNA polymerase II promoter CMV, H1 is a human RNA polymerase III promoter; c is insulator of RNA polymerase II promoter SFFV, MSC is multiple cloning site.

The vector construction uses a lentivirus vector (pLenti6V5-GW-LaZ) produced by Invitrogen company as a framework, and integrates the following elements:

(1) cPPT (HIV central polypurine tract): this is an element that pLenti does not have, and the efficiency of nuclear translocation before vector integration can be improved after the addition of the element, and the sequence is shown in SEQ ID No. 2.

(2) PGK 1-eGFP: PGK1 is mouse phosphoglyceridekinase 1 promoter, and the sequence is shown in SEQ ID No. 3; eGFP is a green enhanced fluorescent protein used for tracing, and the sequence is shown as SEQ ID No. 4.

(3) WPRE post-transcriptional regulatory element (Woodchuck hepatitis virus post-transcriptional regulation element) of Woodchuck hepatitis virus can further improve the expression of foreign gene, and the sequence is shown in SEQ ID No. 5.

(4) The fusion promoter CMV/H1, wherein the CMV is cytomegalovirus CMV enhancer sequence, and the sequence is shown as SEQ ID No. 6. (ii) a H1 is human RNA polymerase III RNA promoter, and the sequence is shown in SEQ ID No. 7. The driving effect of the fused promoter is far stronger than that of H1(4), and the CMV promoter is easily affected by gene silencing, so that the fused promoter is more suitable for testing the function of the insulator.

(5) The insulator IS22.3 has a sequence shown in SEQ ID No. 1; the upstream regulatory region sequence of the gene ZDHHC8 contains insulator structure characteristics, and is used as an element for constructing slow virus, preventing gene silencing and maintaining expression stability.

(6) U6 is mouse RNA polymerase III RNA promoter, the sequence is shown in SEQ ID No. 8.

(7) SSFV: the sequence is shown as SEQ ID No. 9; is a 3' LTR sequence with promoter function of Friend spleen focus forming virus (Friend spleenfocus forming-virus), belonging to RNA polymerase II promoter.

For insulator-containing RNA polymerase iii promoter viral vectors:

in order to test the effect of the IS22 & 3 insulator-containing RNA polymerase III promoter vector on RNAi, a pair of interfering RNAs against red fluorescent DsRed, shDsRed, was designed. The lentiviral plasmid and the control plasmid thereof are shown in FIG. 2. Interfering rna for DsRed (shdsred) plasmid; (A) and (C) plasmids containing IS22.3 insulators, LV-IS 22.3-U6-shDsRed and LV-IS 22.3-CMV/H1-shDsRed; (B) and (D) an IS22.3 insulator-deficient control plasmid.

shDsRed1(R1)：CGGAAGTTCA TCGGCGTGAA CTTCCTCGAG GAAGTTCACG CCGATGAACTTT；

shDsRed2(R2)：CGGAAGTTCA TCGGCGTGAA CTTCCTCGAG GAAGTTCACG CCGATGAACTTT。

For insulator-containing RNA polymerase iii promoter viral vectors:

lentivirus packaging and virus production was performed in 293T cells, which were then transfected into 293 cells for virus titer determination. Although the titer of the IS 22.3-containing insulator plasmid was significantly lower than that of the control (P)<0.05) (FIG. 3), but still the titer reached the standard for the general viral packaging titer>10⁶TU/ml. As shown in FIG. 3, A is the intracellular marker protein eGFP under the fluorescence microscope; b is flow cytometry counting sensationAnd (5) staining cells to obtain the virus titer. The viral titer of the vector constructed by IS22.3 IS obviously lower than that of the traditional vector (P)<0.05)。

RNAi test of target exogenously expressed DsRed gene was performed in DsRed mouse fiber cells. RNAi activity was determined by flow cytometry to measure the mean fluorescence intensity of the red fluorescence. The results show that the vector with insulator has a more potent interference activity (P <0.05), especially in CMV/H1 framework P <0.01, compared to the control without insulator. This demonstrates that IS22.3 IS indeed able to enhance the expression stability of lentiviral RNAi vectors (figure 4).

For the RNA polymerase II promoter viral vector containing insulator:

the SSFV is used as a promoter of the vector to drive red fluorescent protein (DsRed) (figure 5), and the virus titer test shows that the titer of the vector containing the insulator is obviously lower than that of a control (figure 6), but the vector also meets the above general titer requirement.

The virus obtained from the packaging cell 293 infected mouse fiber cells, and then analyzed the mean fluorescence intensity of red fluorescent cells by flow cytometry, and it was found that there was a significant difference (p <0.05) between plasmids LV-IS 22.3-SSFV-DsRed and LV-SSFV-DsRed (FIG. 7).

The invention has the beneficial effects that: the present inventors succeeded in developing a novel lentiviral vector containing a chromatin insulator (IS 22.3) which exhibits a stable and efficient expression function of both RNA polymerase II and RNA polymerase III promoters as compared with conventional lentiviral vectors. The lentiviral vector is expected to become a new choice for gene therapy and cell transfection research.

Drawings

FIG. 1 shows a lentiviral vector containing an insulator (IS 22-3).

FIG. 2 interfering RNA for DsRed (shDsRed) plasmid;

A：LV-IS22·3-U6-shDsRed(R1)；B：LV-U6-shDsRed1(R1)；

C：LV-IS22·3-CMV/H1-shDsRed2(R2)；D：LV-CMV/H1-shDsRed2(R2)。

FIG. 3 comparison of the titers of RNA polymerase III promoter viral plasmids, TU/mL: number of active virus particles/mL;

a: marking protein eGFP in cells under a fluorescence microscope; b: and counting the infected cells by a flow cytometer to obtain the virus titer.

FIG. 4 comparison of mean fluorescence intensity of RNA polymerase III promoter viral plasmids (P <0.01), MFI: meanfluorescence Intensity.

FIG. 5 SSFV promoter drives a viral plasmid expressing DsRed.

FIG. 6 comparison of the titers of SSFV promoter viral plasmids. (A) GFP positive cells under fluorescent microscope. (B) Comparison of virus titers obtained by flow cytometry analysis.

FIG. 7DsRed fluorescence intensity comparison. The mean intensity of red fluorescence expressed by LV-IS 22.3-SSFV-DsRed was significantly higher than that of the control (P < 0.05).

FIG. 8 is a schematic cloning flow diagram.

FIG. 9 is a schematic diagram of pLenti6V 5-GW-LaZ.

FIG. 10 RRE-cPPT element. M: marker 14, 10, 8, 6, 5, 4, 3, 2.5, 2, 1.5, 1, 0.5 and 0.2 kb; lane 1: the RRE-cPPT element was obtained by PCR, 1096 bp.

FIG. 11 PGK1-GFP-WPRE elements.

Lane 2: PGK-GFP-WPRE elements of 2087bp were obtained by PCR. M is Marker 14, 10, 8, 6, 5, 4, 3, 2.5, 2, 1.5, 1, 0.5 and 0.2 kb.

FIG. 12 schematic representation of lentiviral vector construction.

(A) A viral basic plasmid architecture; (B) RNAi viral vector architecture. The italicized endonuclease sites are the cloning sites used for the reconstitution vector.

FIG. 13 shows the restriction identification of lentivirus basic plasmid.

Lanes: marker: 10000. 8000, 6000, 5000, 4000, 3000, 2000, 1000 bp. A single band 7615bp formed by SalI single enzyme digestion; EcoRV cleavage results in 6144bp and 1471bp bands.

FIG. 14 schematic representation of fusion promoter generation.

FIG. 15 fusion promoter CMV/H1.

A.M: marker 14, 10, 8, 6, 5, 4, 3, 2.5, 2, 1.5, 1, 0.5 and 0.2 kb; lane 1: PCR to obtain 403bp CMV enhancer element;

B.M: marker 2000, 1000, 750, 500, 250, 100 bp; lane 2: obtaining 93bp H1 promoter element by PCR;

C.M: marker 14, 10, 8, 6, 5, 4, 3, 2.5, 2, 1.5, 1, 0.5 and 0.2 kb; lane 3: PCR fusion is carried out to obtain a 496bp fusion promoter CMV/H1.

Fig. 16 insulator (IS 22-3).

M: marker 14, 10, 8, 6, 5, 4, 3, 2.5, 2, 1.5, 1, 0.5, 0.2 kb. Lane 2: an 896bp IS22.3 fragment containing the chromatin isolate was obtained by PCR.

FIG. 17 lentiviral vector containing insulator.

FIG. 18 restriction identification of insulator-containing lentiviral vectors.

M: marker 10000, 8000, 6000, 5000, 4000, 3000, 2000, 1000 bp; lane 1: a single band formed by SalI single enzyme digestion plasmid is 9034 bp; lane 2: NotI cleaved to form 2597bp and 6437bp bands.

FIG. 19 PCR yielded mU6 promoter element.

Marker: 14. 10, 8, 6, 5, 4, 3, 2.5, 2, 1.5, 1, 0.5, 0.2 kb. Lane U6: PCR yielded a 314bp mU6 promoter element. Lane SSFV is a 504bp SSFV promoter fragment obtained from the plasmid pHR' SINcppt-SE-HS650pSAR2

FIG. 20 is a schematic diagram of the construction of LV-U6 vector.

FIG. 21 is a schematic diagram of LV-SSFV vector construction.

FIG. 22 PCR generated DsRed fragment.

And (5) Maker: 1200, 900, 700, 500,300,100 bp; lane DsRed: 690 bp.

FIG. 23 expression of DsRed in PT67 cells after stable transfection. A. A red fluorescent field of view; B. bright field view.

FIG. 24 flow cytometry detected DsRed expression in PT67 cells 1 month after transfection. A. PT67 cells; B. transfected PT67 cells.

Detailed Description

The invention firstly analyzes the component and the enzyme cutting site on the basis of the commercial lentiviral vector sequence (pLenti6V5-GW-LaZ) by Snapgene software, then inserts the insulator and the promoter sequence, simulates and reconstructs a complete new lentiviral vector.

The components used for the reconstitution of the vector were obtained by high fidelity PCR (Takara) and restriction enzymes (Takara). PCR primers were synthesized by Suzhou Hongxn. The whole molecular cloning technique is shown in FIG. 8. Plasmid extraction agarose gel DNA recovery kits belong to the Beijing village alliance product. Competent bacteria Stable was purchased from New England Lab. The PCR reaction system is shown in Table 1, and the primer sequences are shown in Table 2.

TABLE 1 PCR reaction System

TABLE 2 primers used for vector construction

Example 1 Lentiviral basic plasmid construction

(1) A lentiviral backbone fragment of 4339bp was generated by digestion with NotI and KpnI using a viral vector (pLenti6V5-GW-LaZ) from Invitrogen as a template (FIG. 9). And separating and purifying the enzyme digestion fragment by gel electrophoresis for later use. A schematic diagram of pLenti6V5-GW-LaZ is shown in FIG. 9.

(2) The cPPT-containing fragment was produced by PCR from plasmid pll 3.7. The primers were synthesized by Hongxi, Suzhou, and 5 '-end and 3' -end primers (cPPT-F; cPPT-R) were provided with NotI and SalI/mluI cleavage sites, respectively (see FIG. 10). The PCR reaction system is shown in Table 1, and the reaction procedure is shown in Table 3.

TABLE 3 PCR reaction procedure

(3) The PGK1-GFP-WPRE fragment was generated from plasmid pLL3.7 using high fidelity Taq enzyme. The 5 'primer (PGK-WPRE-F) has SalI/BsiWI/XbaI site, and the 3' primer has KpnI site. The PCR reaction procedure is shown in Table 3 above, and the PCR products are shown in FIG. 11.

(4) The fragments generated by the above PCR are reacted with the corresponding restriction enzymes overnight, and then the gel of the DNA fragment of interest is separated and excised by gel electrophoresis. The DNA was recovered and purified by agarose gel DNA recovery kit (Beijing Zhuang union) according to the method.

(5) The two PCR fragments and the viral backbone fragment were ligated into a circular plasmid by T4 DNA ligase at 14 ℃ overnight. The ligation reaction is shown in table 4, the ligation product is transformed into Stale Escherichia coli competent cells (New England Lab, NEB), cloning is carried out by ampicillin screening, and finally a lentivirus basic plasmid is obtained, wherein the specific structure is shown in figure 12, A is a virus basic plasmid framework; b is an RNAi virus vector framework, and the italicized marked endonuclease site is a cloning site used by a reconstruction vector. Then enzyme digestion identification is carried out on the DNA fragment, the result is shown in figure 13, and further sequencing verification is carried out. As shown in fig. 13, (1) Marker: 10000. 8000, 6000, 5000, 4000, 3000, 2000, 1000 bp. (2) A single band 7615bp formed by SalI single enzyme digestion; (3) the EcoRV enzyme is cut to form 6144bp and 1471bp bands.

TABLE 4

Reagent	Volume of addition
		10×Buffer	1μL
pLenti6V5 backbone fragment	1μL
		cPPT fragments	1μL
PGK1-GFP-WPRE	1μL
		T4 Ligase	1μL
Total of	10μL

Example 2 Lentiviral vector construction

CMV/H1 promoter RNA i lentiviral vectors

(1) Both CMV and H1 were generated by PCR from commercial plasmid and human leukocyte DNA, respectively, with the PCR reaction system described in table 4 and the PCR reaction procedure shown in table 5. The CMV-F5 ' primer contains an HpaI site, and the CMV-R3 ' primer contains an H15 ' sequence. The 3' primer of fragment H1 has SalI site, and PCR products were isolated by gel electrophoresis and purified, and the PCR reaction procedure for H1 was as shown in Table 6.

TABLE 5 PCR reaction procedure for CMV production

TABLE 6

The two DNA fragments were denatured-renatured-extended by the sequence complementary to H1 designed from the CMV 3' primer to finally form a fusion promoter (CMV/H1) mediated by the designed complementary sequence as shown in FIG. 14, and then full-length DNA was generated by PCR (reaction program shown in Table 7) using CMV-F and H1-R primers.

TABLE 7 PCR reaction procedure for CMV/H1 production

FIG. 15 shows the fusion promoter CMV/H1. A.M: marker 14, 10, 8, 6, 5, 4, 3, 2.5, 2, 1.5, 1, 0.5 and 0.2 kb; lane 1: PCR to obtain 403bp CMV enhancer element; B.M: marker 2000, 1000, 750, 500, 250, 100 bp; lane 2: obtaining 93bp H1 promoter element by PCR; C.M: marker 14, 10, 8, 6, 5, 4, 3, 2.5, 2, 1.5, 1, 0.5 and 0.2 kb; lane 3: PCR fusion is carried out to obtain a 496bp fusion promoter CMV/H1.

(2) IS22.3 was also generated from human leukocyte DNA by PCR. The 5 'primer contains MluI site, and the 3' primer contains HpaI site.

TABLE 8 PCR reaction procedure for IS22-3 production

The insulator (IS22 · 3) IS shown in fig. 16. M: marker 14, 10, 8, 6, 5, 4, 3, 2.5, 2, 1.5, 1, 0.5, 0.2 kb. Lane 2: an 896bp IS22-3 fragment containing the chromatin isolate was obtained by PCR.

(3) The IS22.3 and CMV/H1 fragments are treated by corresponding endonucleases and then cloned into MluI and SalI sites of the circularized virus basic plasmid to form a practical RNA interference (RNA i) lentiviral vector, and specifically, as shown in FIG. 12B, the endonuclease sites marked in italics are cloning sites used for reconstructing the vector, and MCS IS a multiple cloning site. As shown in the flow chart of FIG. 8, the virus vector map is shown in FIG. 17 after cloning and enzyme digestion identification. The restriction enzyme identification results are shown in FIG. 18, M: marker 10000, 8000, 6000, 5000, 4000, 3000, 2000, 1000 bp; lane 1: a single band formed by SalI single enzyme digestion plasmid is 9034 bp; lane 2: NotI cleaved to form 2597bp and 6437bp bands.

The sequences of IS22.3 and CMV/H1 building blocks were further verified by sequencing.

V-U6 vector construction:

the U6 promoter fragment was generated by PCR using plasmid pLL3.7 as template and the 5' primer (U6-F) with EcoRI site; the 3' primer (U6-R) has BamHI/PmlI/MluI/SalI sites. The PCR fragment (see FIG. 19) was cloned into the basic viral vector (see FIG. 20) via EcoRI and SalI.

In FIG. 19, the mU6 promoter element was obtained by PCR. Marker: 14. 10, 8, 6, 5, 4, 3, 2.5, 2, 1.5, 1, 0.5, 0.2 kb. Lane U6: PCR yielded a 314bp mU6 promoter element. Lane SSFV is a 504bp SSFV promoter fragment obtained from plasmid pHR' SINcppt-SE-HS650pSAR2 (see below).

Construction of the SSFV promoter viral vector:

the SSFV fragment was cleaved from pHR' SINcppt-SE-HS650pSAR2 (present in Francisco Martin) plasmid by EocRI and BmHI (see FIG. 19). The LV-SSFV was obtained by direct replacement of U6 in LV-U6 vector with this construct (see FIG. 21).

Example 3 shDsRed RNAi plasmid construction

shDsRed primers were synthesized by Hongsn according to the data from Sigma (Table 2). The 5 'and 3' primers of shDsRed have corresponding sites, the two primers are annealed and extended to form full-length double-stranded DNA in the presence of Taq enzyme (Nanjing Novovisan), the reaction system is shown in Table 9, the reaction condition is that denaturation is carried out for 3 minutes at 95 ℃, and then incubation is carried out for 10 minutes at 72 ℃. The stem loop part of the stem carries an XhoI site so as to be convenient for clone screening and identification. The transformed clones were identified by XhoI digestion and then further verified by sequencing.

Table 9 reaction System for producing shDsRed

(1) LV-IS 22.3-CMV/H1-shDsRed 2 plasmid: the double-stranded shDsRed2(R2) was digested with SalI and XbaI and cloned into the multiple cloning site of the above viral vector (FIGS. 2 and 17). Transformed clones were identified by XhoI-cutting and further verified by sequencing.

(2) LV-CMV/H1-shDsRed2 IS 22.3-CMV/H1-shDsRed 2 the CMV/H1-shDsRed2 fragment generated by digestion with HpaI and XbaI was cloned with the previous PGK1-GFP-WPRE (XbaI/KpnI) fragment into the EcoRV and KpnI sites of the lentivirus base vector (FIG. 12A).

(3) LV-U6-shDsRed1 plasmid double-stranded shDsRed1(R1) was digested with BmHI and MluI and cloned as the above LV-U6 vector (FIG. 20), resulting in LV-U6-shDsRed (R1) plasmid.

(4) LV-IS 22.3-U6-shDsRed 1: the U6-shDsRed fragment was generated from the LV-U6-shDsRed1 plasmid by digestion with EcoRV and SalI and was cloned into the MluI and SalI sites of the virus base plasmid (FIG. 12A) together with the IS22.3 fragment.

Example 4 DsRed expression plasmid construction

(1) Construction of LV-SSFV-DsRed plasmid: DsRed was produced by PCR from pCMV-DsRed-Express (Invitrogen). After enzyme digestion, the DNA fragment was cloned into BmHI/SalI site of LV-SSFV vector (FIG. 21), and specifically, as shown in FIG. 22, it was a PCR-generated DsRed fragment. And (5) Maker: 1200, 900, 700, 500,300,100 bp; lane DsRed: 690 bp.

(2) LV-IS 22.3-SSFV-DsRed: the LV-SSFV-DsRed was digested with EcoRV and SalI to obtain an SSFV-DsRed fragment, which was cloned into MluI and SalI sites of the virus basic plasmid (FIG. 12A) together with the IS22.3 fragment.

Example 5

And (3) packaging the virus: the two plasmids were transfected into 293T cells separately from the packaging plasmids (pLP1, pLP2, pLP-VSVG) and, according to the Invitrogen instructions, when the virus was packaged: 9. mu.g of packaging plasmids (pLP1, pLP2, pLP-VSVG), 3. mu.g of vector plasmids, and CPT high-efficiency transfection reagent were purchased from Wuhanweisai Biotech. Inoculation 5X 10 one day before transfection⁶293T cells/100 mm Petri dish at 37 ℃ in 5% CO₂The culture was carried out overnight in an incubator. The medium was changed to non-resistant complete medium 3-4h before transfection the next day. Two sterile, clean centrifuge tubes, labeled a and B: adding a proper amount of sterile water, plasmid DNA and 50 mu L of Buffer B (the total amount is 500 mu L) into a tube B, uniformly mixing, and slowly dropwise adding the mixture into a tube A containing 500 mu L of Buffer A; the transfection mixture was mixed by bubbling with a suction nozzle and allowed to stand at room temperature for 30 min. The transfection mixture was added dropwise to the cell culture plate, the dish was gently shaken to spread the transfection mixture evenly over the entire plate, mixed well and placed in a 37 ℃ 5% CO2 incubator for 4-6h before changing the medium. On the third day, the culture medium was changed to fresh complete medium containing double antibody at 37 deg.C and 5% CO₂Continuously culturing in incubator for 24-48h, collecting virus supernatantAnd stored at-80 ℃ for use.

And (3) virus titer determination: after counting the number of the 293T cells in good growth state, the cells were plated in 24-well plates at 1X 105 cells per well. The next day, the virus was diluted in 10-fold gradient and the cells prepared above were placed after 5 serial dilutions. On the third day, 500. mu.L of complete medium was added to each well. Cells were collected on the fifth day and the proportion of cells expressing GFP positive was determined by flow cytometry loading. Viral titer (TU/mL) ═ 10⁵Number of cells × GFP +%) × 1000 × dilution.

PT67DsRed cell line: the pCMV-DsRed-Express plasmid (Invitrogen) was transfected into mouse fiber cells (PT67) using Lipo3000 transfection reagent as medium, after three days, the cells were passaged and screened by adding G418 (600. mu.g/mL), and mouse fiber cells (PT67DsRed) stably expressing red fluorescent protein (DsRed) were obtained after 3 weeks.

Expression of DsRed in stably transfected PT67 cells is shown in figure 23, where a is a red fluorescent field; b is a bright field view. FIG. 24 shows the expression of DsRed in PT67 cells detected by flow cytometry 1 month after transfection; wherein A is PT67 cells; b is transfected PT67 cells.

Fluorescence detection: PT67DsRed cells were digested, counted and plated in 96-well plates at 1.5X 10 per well⁴(ii) individual cells; the next day, the culture solution is changed, 50 mu L of fresh DMEM culture solution is added with concentrated lentivirus, polybrene (polybrene) is added to the final concentration of 8 mu g/mL, and the cells are infected after being uniformly mixed; after 6-8h, 100. mu.L of fresh DMEM culture solution is supplemented at 37 ℃ with 5% CO₂Culturing in an incubator overnight; on the third day, cells were collected and washed twice with PBS, and cells were transferred to six-well plates for culture; when the six-hole plate cell grows more than 90%, collecting the cell for flow cytometry analysis. The fluorescence of DsRed in GFP positive cells IS detected to obtain the average fluorescence intensity, and the influence of IS22 & 3 on the expression of exogenous genes IS judged by comparing the average fluorescence intensity of DsRed with a control, so that the success and the non-success of the designed virus vector are indicated.

Sequence listing

<110> second people hospital in Changzhou city

<120> lentiviral stable expression vector containing insulator and construction method thereof

<160>9

<170>SIPOSequenceListing 1.0

<210>1

<211>896

<212>DNA

<213> insulator IS22 ∙ 3 (upstream regulatory region sequence 2 Ambystoma laterale xBombystoma jeffersonia gene ZDHHC8)

<400>1

gtgaggctca gagaggtaag ggcgcaccct ttgtctgccc cctccccagc atggccaagt 60

cgctcccagg gtgcaggcga tggcaggcca tttgtctccc tcctgggtga gtctctggac 120

atggattctc acatttttta tttaagaatc agagagatat aagaatgtca aggaaaaatc 180

ctctcatgga caatgcagcc ccagtaaatg actgtcagcc ggcgtgtcca gggcttcaag 240

gccccaggaa gtggccatgc tggggctgcc aggcctctgg ctccagggtc actggggctg 300

aactgtctgc ccaggcccgg agacaccctg cccctgagga gcccaccggc ttggccagtc 360

catcttcttg gcactccctg accaccactt accttctagt cggacagtgg agcctggggg 420

gacagcgtgg cagagtgcct gatggtcggt gacaaagtca tctccaaagt ccttgctggg 480

gccaagagcc aggactcctt gcccgtcccc gtcactgccc tgtgcccgcc cagcacctgc 540

tggggactag gctgcccatt ggagaaggaa acacagtgct gggctgtgag ctcctgaagc 600

ctgtctctgt gccccaggac caggctcctg ggtggaggga gagaccaggg gcaggtgagg 660

aaaggcaggg cccccagaat ccctccatgc ctgcccctca gtctccagga cttatgtgca 720

ggtaccgttt ggagctgtgg tgcagttccc agtctcacca ccagatggca ccatgcccct 780

gcagaagcag tgcccagagc aggccaggtg gttctcgggg gctgcggtgg aggaatccac 840

ccagccgaag ctctggcagg gaaggggcag tgctaggtgg agccccctcc ccactt 896

<210>2

<211>180

<212>DNA

<213> cPPT (HIV central polypurine region 2 Ambystoma laterale x Ambystomajeffersonia)

<400>2

cgccaaatgg cagtattcat ccacaatttt aaaagaaaag gggggattgg ggggtacagt 60

gcaggggaaa gaatagtaga cataatagca acagacatac aaactaaaga attacaaaaa 120

caaattacaa aaattcaaaa ttttcgggtt tattacaggg acagcagaga tccagtttgg 180

<210>3

<211>516

<212>DNA

<213> PGK1 (mouse Phosphoglycerate kinase 1 promoter 2 Ambystoma laterals Ambystoma jeffersonianum)

<400>3

aattctaccg ggtaggggag gcgcttttcc caaggcagtc tggagcatgc gctttagcag 60

ccccgctggg cacttggcgc tacacaagtg gcctctggcc tcgcacacat tccacatcca 120

ccggtaggcg ccaaccggct ccgttctttg gtggcccctt cgcgccacct tctactcctc 180

ccctagtcag gaagttcccc cccgccccgc agctcgcgtc gtgcaggacg tgacaaatgg 240

aagtagcacg tctcactagt ctcgtgcaga tggacagcac cgctgagcaa tggaagcggg 300

taggcctttg gggcagcggc caatagcagc tttgctcctt cgctttctgg gctcagaggc 360

tgggaagggg tgggtccggg ggcgggctca ggggcgggct caggggcggg gcgggcgccc 420

gaaggtcctc cggaggcccg gcattctgca cgcttcaaaa gcgcacgtct gccgcgctgt 480

tctcctcttc ctcatctccg ggcctttcga cctgca 516

<210>4

<211>720

<212>DNA

<213> eGFP (Green enhanced fluorescent protein 2 Ambystoma laterale x Ambystomajeffersonanium)

<400>4

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgtgcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtag 720

<210>5

<211>588

<212>DNA

<213> post-transcriptional regulatory element of Woodchuck hepatitis virus (Woodchuck hepatitis virus post-transcriptional regulation element2 Ambystomajeffersonanum)

<400>5

tcaacctctg gattacaaaa tttgtgaaag attgactggt attcttaact atgttgctcc 60

ttttacgcta tgtggatacg ctgctttaat gcctttgtat catgctattg cttcccgtat 120

ggctttcatt ttctcctcct tgtataaatc ctggttgctg tctctttatg aggagttgtg 180

gcccgttgtc aggcaacgtg gcgtggtgtg cactgtgttt gctgacgcaa cccccactgg 240

ttggggcatt gccaccacct gtcagctcct ttccgggact ttcgctttcc ccctccctat 300

tgccacggcg gaactcatcg ccgcctgcct tgcccgctgc tggacagggg ctcggctgtt 360

gggcactgac aattccgtgg tgttgtcggg gaaatcatcg tcctttcctt ggctgctcgc 420

ctgtgttgcc acctggattc tgcgcgggac gtccttctgc tacgtccctt cggccctcaa 480

tccagcggac cttccttccc gcggcctgct gccggctctg cggcctcttc cgcgtcttcg 540

ccttcgccct cagacgagtc ggatctccct ttgggccgcc tccccgca 588

<210>6

<211>403

<212>DNA

<213> cytomegalovirus CMV enhancer sequence (cytomegalovirus CMV enhancer 2 Ambystoma laterabare xABrystoma jeffersonianum)

<400>6

acataactta cggtaaatgg cccgcctggc tgaccgccca acgacccccg cccattgacg 60

tcaataatga cgtatgttcc catagtaacg ccaataggga ctttccattg acgtcaatgg 120

gtggactatt tacggtaaac tgcccacttg gcagtacatc aagtgtatca tatgccaagt 180

acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct ggcattatgc ccagtacatg 240

accttatggg actttcctac ttggcagtac atctacgtat tagtcatcgc tattaccatg 300

gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc acggggattt 360

ccaagtctcc accccattga cgtcaatggg agtttgtttt ggc 403

<210>7

<211>93

<212>DNA

<213> human RNA polymerase III RNA promoter (2 Ambystoma laterale x Ambystomajeffersonanium)

<400>7

atatttgcat gtcgctatgt gttctgggaa atcaccataa acgtgaaatg tctttggatt 60

tgggaatctt ataagttctg tatgagacca ctc 93

<210>8

<211>314

<212>DNA

<213> mouse RNA polymerase III RNA promoter (2 Ambystoma laterale x Ambystomajeffersonanium)

<400>8

gatccgacgc cgccatctct aggcccgcgc cggccccctc gcacagactt gtgggagaag 60

ctcggctact cccctgcccc ggttaatttg catataatat ttcctagtaa ctatagaggc 120

ttaatgtgcg ataaaagaca gataatctgt tctttttaat actagctaca ttttacatga 180

taggcttgga tttctataag agatacaaat actaaattat tattttaaaa aacagcacaa 240

aaggaaactc accctaactg taaagtaatt gtgtgttttg agactataaa tatcccttgg 300

agaaaagcct tgtt 314

<210>9

<211>412

<212>DNA

<213> RNA polymerase II promoter (Friend spen focus forming-virus2 Ambytoma laterale x Ambytoma jeffersonia)

<400>9

ccgggcgact cagtcaatcg gaggactggc gcgccgagtg aggggttgtg agctctttta 60

tagagctcgg gaagcagaag cgcgcgaaca gaagcgagaa gcaggctgat tggttaattc 120

aaataaggcg cagggtcatt tcaggtcctt gggggagcct ggaaacatct gatgggtctt 180

aagaaactgc tgagggttgg gccatatctg gggaccatct gttcttggcc tcgggccggg 240

gccgaaactg cggtgaccat ctgttcttgg ccccgggccg gggccgaaac tgctcaccgc 300

agatatcctg tttggcccaa cgttagctat tttcatgtac ccgcccttga tctgaacttc 360

tctattcttg gtttggtatt tttccatgcc ttgcaaaatg gcgttactgc ag 412

Claims (6)

1. A lentivirus stable expression vector containing an insulator is characterized in that: the insulator IS22.3 IS integrated into a lentiviral vector, and the lentiviral vector comprises a lentiviral vector promoter; the sequence of IS22.3 IS shown as SEQ ID No. 1.

2. The lentiviral expression vector of claim 1, comprising an insulator, wherein: the lentivirus vector promoter is specifically an RNA polymerase II promoter, an RNA polymerase III promoter or a promoter fused with the RNA polymerase III promoter.

3. The lentiviral expression vector of claim 2, comprising an insulator, wherein: the RNA polymerase III RNA promoter is specifically a U6 or H1 promoter, and the RNA polymerase II promoter is an SFFV or CMV promoter; the fusion promoter was CMV/H1.

4. The lentiviral expression vector of claim 1, comprising an insulator, wherein: the framework of the lentiviral vector is based on a lentiviral vector Lenti6V 5-GW-LaZ.

5. The construction method of the stable lentiviral expression vector containing the insulator is characterized by comprising the following steps of:

(1) lentivirus basic plasmid: using a virus vector Lenti6V5-GW-LaZ as a template, and carrying out enzyme digestion by NotI and KpnI to generate a 4339bp lentivirus skeleton fragment; the fragment containing cPPT is produced from a plasmid pLL3.7 by PCR, and primers at the 5 'end and the 3' end respectively have NotI enzyme cutting sites and SalI/mluI enzyme cutting sites; the PGK1-GFP-WPRE fragment was generated from plasmid pLL3.7 with a SalI/BsiWI/XbaI site in the 5 'primer and a KpnI site in the 3' primer;

reacting the fragment generated by the PCR with corresponding restriction enzyme overnight, and then separating and cutting a target DNA fragment gel by gel electrophoresis; transforming the ligation product into Stale escherichia coli competent cells, cloning and screening by ampicillin to finally obtain a lentivirus basic plasmid;

(2) construction of lentivirus stable expression vector: constructing a corresponding lentivirus vector promoter and an insulator, treating the lentivirus vector promoter and the insulator by using a corresponding endonuclease, and cloning the treated lentivirus vector promoter and the insulator into the cyclized virus basic plasmid to obtain the lentivirus stable expression vector.

6. The method according to claim 5, wherein the vector comprises an insulator,

the method is characterized in that: the promoters are respectively a U6 promoter, an H1 promoter, an SFFV promoter, a CMV promoter or a fusion promoter CMV/H1;

the fusion promoter CMV/H1 vector construction and cloning steps are as follows:

a. both CMV and H1 were generated by PCR from plasmid and human leukocyte DNA, respectively, with the CMV-F5 'primer containing a HpaI site and the CMV-R3' primer containing the H15 'sequence H1 fragment 3' primer carrying a SalI site; the two DNA fragments are subjected to denaturation-renaturation-extension by a sequence which is designed by a CMV 3' primer and is complementary with a sequence of H1, and finally a fusion promoter CMV/H1 is formed;

b. the 5 'primer of IS22.3 contains MluI site, and the 3' primer contains HpaI site;

c. and (b) treating the IS22 & 3 and CMV/H1 fragments obtained in the steps a and b by using corresponding endonucleases, and cloning the fragments into MluI and SalI sites of the circularized virus basic plasmid to form RNA interference, namely a lentiviral stable expression vector LV-IS22 & 3-CMV/H1 of CMV/H1 driven RNA i.

The U6 promoter vector comprises the following construction steps: PCR takes plasmid pLL3.7 as a template, and a 5' primer U6-F has an EcoRI site; 3' primer U6-R has BamHI/PmlI/MluI/SalI sites, PCR fragment via EcoRI and SalI cloning into virus basic plasmid to obtain LV-U6 vector; constructing and obtaining a lentivirus stable expression vector LV-IS 22.3-U6 by adopting a corresponding method;

the construction steps of the SSFV promoter vector are as follows: the SSFV fragment is obtained by enzyme digestion of pHR' SINcppt-SE-HS650pSAR2 plasmid through EocRI and BmHI, and the component is adopted to directly replace U6 in LV-U6 vector, thus obtaining LV-SSFV vector; the lentivirus stable expression vector LV-IS 22.3-SSFV IS constructed and obtained by adopting a corresponding method.

Images