CN110747204A - Double-reporter gene probe for monitoring pre-mRNA splicing efficiency and preparation method thereof - Google Patents
Double-reporter gene probe for monitoring pre-mRNA splicing efficiency and preparation method thereof Download PDFInfo
- Publication number
- CN110747204A CN110747204A CN201911193339.7A CN201911193339A CN110747204A CN 110747204 A CN110747204 A CN 110747204A CN 201911193339 A CN201911193339 A CN 201911193339A CN 110747204 A CN110747204 A CN 110747204A
- Authority
- CN
- China
- Prior art keywords
- probe
- reporter gene
- segment
- fragment
- splicing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a double-reporter gene probe for monitoring the splicing efficiency of pre-mRNA and a preparation method thereof, wherein the probe comprises a vector pcDNA3.1 and a gene segment A, B, C, the gene segment A, B, C is recombined with a linearized pcDNA3.1 vector according to an A-B-C sequence, the segment A is Fluc, the segment B consists of exon 1, Intron and exon 2, and the segment C is Rluc. The nucleotide sequence of the probe is shown as SEQ ID NO. 5. By analyzing the signal ratio Fluc/Rluc generated by the two luciferases by the reporter gene molecule image probe, the splicing efficiency of in-vivo pre-mRNA is analyzed in real time and noninvasively, and an effective screening tool is provided for the research of medicines for regulating and controlling the splicing of the pre-mRNA.
Description
Technical Field
The invention belongs to the technical field of molecular biology and genetic engineering, and particularly relates to a double-reporter gene image probe for monitoring pre-mRNA and a preparation method thereof.
Background
The chemical nature of the Pre-mRNA splicing process involves a two-step transesterification reaction. The chemical reaction is difficult to occur in cells by itself, and needs the participation of spliceosomes to complete. Spliceosomes are multicomponent complexes formed when Pre-mRNA splicing is performed, consisting mainly of small nuclear RNAs and proteins. It is formed at various stages of the splicing process with the addition of SNRNA. That is to say a splicing intermediate formed on the complete pre-mRNA. The spliceosome itself requires the participation of some small nuclear RNA. These small nuclear RNAs do not translate into any protein, but play an important role in regulating genetic activities. Since many human diseases can be due to mis-splicing of genes or mis-regulation of spliceosomes. It is known that 35% of human genetic disorders are caused by alternative splicing of individual genes due to gene mutations. Yet another cause of some diseases is that mutations in the spliceosome proteins affect the splicing of many transcripts. Still other cancers are also associated with the misregulation of splicing factors.
Researchers initially establish the generation processes of assembly, activation and depolymerization of spliceosomes, and complex RNA splicing regulation networks of interaction and mutual regulation between proteins and nucleic acids by means of research measures such as immunoprecipitation, gene knockout, cross-linking mass spectrometry, establishment of in vitro splicing reaction systems and the like. However, due to the high dynamics and complexity of spliceosomes, there has been a lack of reliable systems to detect splicing efficiency. Therefore, the invention develops a dual-luciferase reporter gene imaging probe, monitors the pre-mRNA splicing efficiency in real time, and provides a robust, rapid and convenient detection tool for researching the pre-mRNA splicing.
The invention utilizes a molecular imaging means to develop a developing system based on dual-luciferase reporter gene to quantitatively analyze the splicing efficiency of pre-mRNA. Provides a detection tool for real-time, rapid and quantitative research on splicing efficiency. The stable expression of the gene system in the living body is reported by the carrier, the real-time, dynamic and visual molecular splicing information of the living body is provided in a non-invasive and repeated way, the quantitative research is carried out simultaneously, the two fluorescent signals are analyzed, the splicing process and the splicing efficiency of the spliceosome in the body can be evaluated in real time, and the gene expression condition in the body can be detected. Imaging splicing-related genes plays a key role in optimizing gene therapy protocols and evaluating efficacy.
Disclosure of Invention
Aiming at the defects in the prior art, the invention aims to provide a double-reporter gene probe for monitoring the pre-mRNA splicing efficiency and a preparation method thereof, and the generation and development of the splicing process and the splicing efficiency are monitored according to the fluorescence intensity generated by two luciferases.
The invention is realized by the following technical scheme:
a double-reporter gene probe for monitoring the splicing efficiency of pre-mRNA comprises a vector pcDNA3.1 and a gene segment A, B, C, wherein the gene segment A, B, C is recombined with the linearized pcDNA3.1 vector according to the sequence A-B-C, the segment A is Fluc, the segment B consists of exon 1, Intron and exon 2, and the segment C is Rluc.
The nucleotide sequence of the fragment A is shown as SEQ ID NO.1, the nucleotide sequence of the fragment B is shown as SEQ ID NO.2, and the nucleotide sequence of the fragment C is shown as SEQ ID NO. 3.
The nucleotide sequence of the probe is shown as SEQ ID NO. 5.
In another aspect of the present invention, there is provided a dual reporter gene probe for monitoring pre-mRNA splicing efficiency and a method for preparing the same, comprising the steps of:
1) the vector pcDNA3.1 is digested by KpnI and XhoI, so that the vector is linearized;
2) a, B, C fragments are amplified by PCR;
3) the gene fragment A, B, C is recombined with the linearized pcDNA3.1 vector according to the sequence A-B-C;
4) and transforming the recombinant vector, extracting plasmid, and carrying out enzyme digestion identification to obtain the Dual-Luc reporter gene probe.
The fragment A is Fluc, the fragment B is composed of exon 1, Intron and exon 2, and the fragment C is Rluc.
The nucleotide sequence of the gene fragment obtained by amplification in the step (2) is shown as SEQ ID NO. 4.
The invention has the beneficial effects that:
the invention constructs a double-reporter gene probe for monitoring the pre-mRNA splicing efficiency, and has the following advantages because the double-reporter gene probe can be well expressed in organisms:
(1) provides a real-time and non-invasive monitoring tool for simulating the dynamic change of the splicing process of the living body.
(2) Overcomes the defect that the in vitro content analysis possibly has deviation with the actual in vivo effect in the traditional method.
(3) The reporter gene system has the advantages of strong targeting property, good safety, high flux, relatively low price, convenient operation and the like, provides an effective screening tool for the research of the medicament acting on the spliceosome, and has very important value in the research of new medicaments and the observation of the physiological and pathological processes in organisms.
Drawings
FIG. 1 is a schematic diagram of the Dual-Luc reporter probe of the present invention;
FIG. 2 is a structural diagram of the molecular probe of the present invention;
FIG. 3 is the activity test of reporter gene under the action of Pladienolide B with different concentrations;
FIG. 4 is the reporter gene activity assay at different time points after the action of Pladienolide B;
FIG. 5 is a diagram of in vivo activity assay of the Dual-Luc reporter gene system.
Detailed Description
The technical solutions of the present invention will be described clearly and completely with reference to specific embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1 construction of Dual-Luc reporter Gene Probe
1.1 Experimental materials
1.1.1 Main Instrument
A PCR amplification instrument: beijing Tosheng Innovation Biotech Co., Ltd; centrifuge 5415D bench Centrifuge: eppendorf; a high-speed refrigerated centrifuge: beckman coulter; digital display constant temperature water bath: jiangsu Guohua electric appliances, Inc.; THZ-92A table oven: jumping to a medical instrument factory in Shanghai; an ultraviolet analyzer: beijing Junyi Oriental electrophoresis Equipment Inc.; electrophoresis apparatus: beijing Junyi Oriental electrophoresis Equipment Inc.; genosens 800 gel imaging system: shanghai Qixiang science and technology, Inc.; superclean bench: shanghai-constant technology, Inc.; constant temperature shaking incubator: jiangsu Taicang laboratory facility.
1.1.2 enzymes and reagents
1.1.3 solutions used in the experiments
LB culture medium: 10g NaCl, 10g tryptone, 5g yeast extract in 1L double distilled water, autoclaving.
Agarose gel preparation: 5.6g agarose, placed in 500ml conical flask, added 1 x TAE 480ml, heated to completely dissolve, then cooled to 50-60 ℃, poured into the preparation of gel plate.
TAE agarose gel electrophoresis: 50 × TAE stock solution configuration: 242g Tris, 57.1ml acetic acid, 37.2g Na2EDTA.2H2O was dissolved in 1L of water and the pH was adjusted to 8.0.
1 × TAE: for electrophoresis, 50 × TAE was prepared as a 1 × working solution.
2 XLoading buffer 0.5mol/L (pH6.8) Tris-HCl 2ml, glycerol 2ml, 20% SDS (W/V)2ml, 0.1% bromophenol blue 0.5ml β -mercaptoethanol 1.0ml, double distilled water 2.5ml, room temperature storage for use.
1.1.4 strains and vectors used in the experiments
The strain is as follows: XL 10-gold.
Vector pCDNA3.1 (+).
1.2 Experimental procedures
1.2.1 Experimental protocol design and primer Synthesis
According to the whole gene sequence, synthesizing a primer for PCR amplification. All primers used in this experiment were synthesized by the primer synthesis section of shanghai agilent bioengineering, ltd.
1.2.3 cloning
30ul of carrier to be cut, 150ng/ul of NheI/PstI of 1ul of enzyme and 5ul of Buffer are added with water to be supplemented to a 50ul system, and the system is put into a constant-temperature culture incubator for 2 to 3 hours, and then the needed carrier skeleton is recovered for standby.
4ul of each gene full-length PCR sequence and the vector obtained by PCR amplification is added with homologous recombinase for recombination to 1.4ul and homologous recombinase Buffer to 1.2ul, the mixture is uniformly mixed, the mixture is placed at room temperature for 45min, single clone is immediately transformed and selected for identification and sequencing, and the sequencing result is shown as SEQ ID NO. 5.
Reporter probes were obtained, with Reporter gene structures as in FIG. 2, which contained Fluc, Exon 1, Intron, Exon 2, and Rluc. The principle of the molecular probe is shown in figure 1, firstly Reporter is transfected into cells, then shearing is carried out under the participation of spliceosome and a plurality of proteins, and firefly luciferase and sea cucumber luciferase can be normally expressed after normal excision. However, under the condition of existence of a splicing enzyme inhibitor, the splicing of Dual-Luc is inhibited, and the splicing can not occur, and the Dual-Luc is terminated by a termination codon TAG in an Intron sequence after expressing firefly luciferase, and can not express the sea cucumber luciferase. The ratio of the two fluorescence intensities formed by the luciferase catalyzing the substrate can reflect the generation and development process and splicing efficiency of splicing. The dynamic change of the splicing process in the splicing process is reflected in real time, the defects of the prior common detection means that the detection means is invasive, the operation is complicated and the complete dynamic change of the splicing can not be provided in vivo are overcome, and an effective monitoring tool is provided for monitoring the occurrence and development of the splicing efficiency in vivo.
Example 2 in vivo molecular imaging monitoring of a Dual reporter Gene imaging Probe for monitoring Pre-mRNA splicing efficiency
1.1 detection of Dual-Luc fluorescence Activity under the action of Pladienolide B
293 cells were cultured in 24-well plates, and when the cells were 80% pooled, 1. mu.g of Dual-Luc plasmid DNA was transfected into 293 cells using Lipofectamine 2000. After 24 hours, DMSO, 10nM, 100nM, 1000nM Pladienolide B was added, and after 12 hours, the cells were collected and lysed with 100. mu.l/well of cell lysate. 10. mu.l of the lysed liquid was taken, 10. mu.l of substrate was added, and fluorescence intensity measurement was performed using a Glomax-20/20 Luminometer.
1.2 Dual-Luc imaging Probe in vivo image monitoring
Culturing 4T1 cells, transfecting Dual-Luc plasmid when the cells are 80% pooled, collecting cells after 24 hours, and ensuring that the injection amount of each mouse reaches 1 × 108The mice (n ═ 3) were inoculated subcutaneously on the right side with cells, and simultaneously Pladienolide B was intraperitoneally injected, and signal collection was performed by allowing Pladienolide B to act for 0 and 12 hours, respectively.
1.3 validation of results
The reporter gene activity detection under the action of the Pladienolide B with different concentrations is shown in figure 3, after the Pladienolide B acts for 12 hours, compared with a DMSO group, the ratio of Rluc/Fluc after the Pladienolide B acts is remarkably reduced, and as the medicine concentration is increased, the ratio of Rluc/Fluc is reduced along with the increase of the medicine, and the ratios of Rluc/Fluc in different medicine concentration groups have remarkable difference. Namely, the Dual-Luc probe constructed by the invention can respond to the action of the exogenous compound and can well distinguish the difference of fluorescence intensity caused by different drug doses.
As shown in FIG. 4, the reporter gene activity detection at different time points is that the fluorescence intensity generated by the probe at different time points changes when the 1000nM Pladienolide B acts on the Dual-Luc probe, reaches the minimum ratio within 12 hours, and then gradually increases. Namely, the Dual-Luc reporter gene system constructed by the invention can dynamically monitor the splicing occurrence and development process and provide a real-time dynamic monitoring result.
In vivo Activity assay of Dual-Luc reporter Gene System in order to monitor in vivo imaging of the Dual-Luc probe, 4T1 cells transfected with the Dual-Luc reporter gene were implanted on the right side of nude mice, as shown in FIG. 5. After the drug acts for different time, software analysis is carried out on the bioluminescence intensity of the fluorescence signal area, and the fluorescence intensity of the probe dynamically changes along with the change of the time. Therefore, the results indicate that the probe of the present invention can be used for the study of splicing efficiency in vivo after stimulation with an exogenous compound.
Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.
Sequence listing
<110> university of west' an electronic technology
<120> double-reporter gene probe for monitoring pre-mRNA splicing efficiency and preparation method thereof
<160>5
<170>SIPOSequenceListing 1.0
<210>1
<211>1653
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atggccgatg ctaagaacat taagaagggc cctgctccct tctaccctct ggaggatggc 60
accgctggcg agcagctgca caaggccatg aagaggtatg ccctggtgcc tggcaccatt 120
gccttcaccg atgcccacat tgaggtggac atcacctatg ccgagtactt cgagatgtct 180
gtgcgcctgg ccgaggccat gaagaggtac ggcctgaaca ccaaccaccg catcgtggtg 240
tgctctgaga actctctgca gttcttcatg ccagtgctgg gcgccctgtt catcggagtg 300
gccgtggccc ctgctaacga catttacaac gagcgcgagc tgctgaacag catgggcatt 360
tctcagccta ccgtggtgtt cgtgtctaag aagggcctgc agaagatcct gaacgtgcag 420
aagaagctgc ctatcatcca gaagatcatc atcatggact ctaagaccga ctaccagggc 480
ttccagagca tgtacacatt cgtgacatct catctgcctc ctggcttcaa cgagtacgac 540
ttcgtgccag agtctttcga cagggacaaa accattgccc tgatcatgaa cagctctggg 600
tctaccggcc tgcctaaggg cgtggccctg cctcatcgca ccgcctgtgt gcgcttctct 660
cacgcccgcg accctatttt cggcaaccag atcatccccg acaccgctat tctgagcgtg 720
gtgccattcc accacggctt cggcatgttc accaccctgg gctacctgat ttgcggcttt 780
cgggtggtgc tgatgtaccg cttcgaggag gagctgttcc tgcgcagcct gcaagactac 840
aaaattcagt ctgccctgct ggtgccaacc ctgttcagct tcttcgctaa gagcaccctg 900
atcgacaagt acgacctgtc taacctgcac gagattgcct ctggcggcgc cccactgtct 960
aaggaggtgg gcgaagccgt ggccaagcgc tttcatctgc caggcatccg ccagggctac 1020
ggcctgaccg agacaaccag cgccattctg attaccccag agggcgacga caagcctggc 1080
gccgtgggca aggtggtgcc attcttcgag gccaaggtgg tggacctgga caccggcaag 1140
accctgggag tgaaccagcg cggcgagctg tgtgtgcgcg gccctatgat tatgtccggc 1200
tacgtgaata accctgaggc cacaaacgcc ctgatcgaca aggacggctg gctgcactct 1260
ggcgacattg cctactggga cgaggacgag cacttcttca tcgtggaccg cctgaagtct 1320
ctgatcaagt acaagggcta ccaggtggcc ccagccgagc tggagtctat cctgctgcag 1380
caccctaaca ttttcgacgc cggagtggcc ggcctgcccg acgacgatgc cggcgagctg 1440
cctgccgccg tcgtcgtgct ggaacacggc aagaccatga ccgagaagga gatcgtggac 1500
tatgtggcca gccaggtgac aaccgccaag aagctgcgcg gcggagtggt gttcgtggac 1560
gaggtgccca agggcctgac cggcaagctg gacgcccgca agatccgcga gatcctgatc 1620
aaggctaaga aaggcggcaa gatcgccgtg tat 1653
<210>2
<211>251
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
caggaagtac acgagaagct ccgaggatgg ctgaagtcca acgtctctga tgcggtggct 60
cagagcaccc gtatcattta tggaggtgag tggctttggt tcccggctga ggtggagtgg 120
gctgaggact agactgagcc ctcggacatg gaggtgggga tggggcagac tcatcccatt 180
cttgaccaag cccttgttct gctcccttcc caggctctgt gactggggca acctgcaagg 240
agctggccag c 251
<210>3
<211>933
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
gcttccaagg tgtacgaccc cgagcaacgc aaacgcatga tcactgggcc tcagtggtgg 60
gctcgctgca agcaaatgaa cgtgctggac tccttcatca actactatga ttccgagaag 120
cacgccgaga acgccgtgat ttttctgcat ggtaacgctg cctccagcta cctgtggagg 180
cacgtcgtgc ctcacatcga gcccgtggct agatgcatca tccctgatct gatcggaatg 240
ggtaagtccg gcaagagcgg gaatggctca tatcgcctcc tggatcacta caagtacctc 300
accgcttggt tcgagctgct gaaccttcca aagaaaatca tctttgtggg ccacgactgg 360
ggggcttgtc tggcctttca ctactcctac gagcaccaag acaagatcaa ggccatcgtc 420
catgctgaga gtgtcgtgga cgtgatcgag tcctgggacg agtggcctga catcgaggag 480
gatatcgccc tgatcaagag cgaagagggc gagaaaatgg tgcttgagaa taacttcttc 540
gtcgagacca tgctcccaag caagatcatg cggaaactgg agcctgagga gttcgctgcc 600
tacctggagc cattcaagga gaagggcgag gttagacggc ctaccctctc ctggcctcgc 660
gagatccctc tcgttaaggg aggcaagccc gacgtcgtcc agattgtccg caactacaac 720
gcctaccttc gggccagcga cgatctgcct aagatgttca tcgagtccga ccctgggttc 780
ttttccaacg ctattgtcga gggagctaag aagttcccta acaccgagtt cgtgaaggtg 840
aagggcctcc acttcagcca ggaggacgct ccagatgaaa tgggtaagta catcaagagc 900
ttcgtggagcgcgtgctgaa gaacgagcag taa 933
<210>4
<211>2837
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
atggccgatg ctaagaacat taagaagggc cctgctccct tctaccctct ggaggatggc 60
accgctggcg agcagctgca caaggccatg aagaggtatg ccctggtgcc tggcaccatt 120
gccttcaccg atgcccacat tgaggtggac atcacctatg ccgagtactt cgagatgtct 180
gtgcgcctgg ccgaggccat gaagaggtac ggcctgaaca ccaaccaccg catcgtggtg 240
tgctctgaga actctctgca gttcttcatg ccagtgctgg gcgccctgtt catcggagtg 300
gccgtggccc ctgctaacga catttacaac gagcgcgagc tgctgaacag catgggcatt 360
tctcagccta ccgtggtgtt cgtgtctaag aagggcctgc agaagatcct gaacgtgcag 420
aagaagctgc ctatcatcca gaagatcatc atcatggact ctaagaccga ctaccagggc 480
ttccagagca tgtacacatt cgtgacatct catctgcctc ctggcttcaa cgagtacgac 540
ttcgtgccag agtctttcga cagggacaaa accattgccc tgatcatgaa cagctctggg 600
tctaccggcc tgcctaaggg cgtggccctg cctcatcgca ccgcctgtgt gcgcttctct 660
cacgcccgcg accctatttt cggcaaccag atcatccccg acaccgctat tctgagcgtg 720
gtgccattcc accacggctt cggcatgttc accaccctgg gctacctgat ttgcggcttt 780
cgggtggtgc tgatgtaccg cttcgaggag gagctgttcc tgcgcagcct gcaagactac 840
aaaattcagt ctgccctgct ggtgccaacc ctgttcagct tcttcgctaa gagcaccctg 900
atcgacaagt acgacctgtc taacctgcac gagattgcct ctggcggcgc cccactgtct 960
aaggaggtgg gcgaagccgt ggccaagcgc tttcatctgc caggcatccg ccagggctac 1020
ggcctgaccg agacaaccag cgccattctg attaccccag agggcgacga caagcctggc 1080
gccgtgggca aggtggtgcc attcttcgag gccaaggtgg tggacctgga caccggcaag 1140
accctgggag tgaaccagcg cggcgagctg tgtgtgcgcg gccctatgat tatgtccggc 1200
tacgtgaata accctgaggc cacaaacgcc ctgatcgaca aggacggctg gctgcactct 1260
ggcgacattg cctactggga cgaggacgag cacttcttca tcgtggaccg cctgaagtct 1320
ctgatcaagt acaagggcta ccaggtggcc ccagccgagc tggagtctat cctgctgcag 1380
caccctaaca ttttcgacgc cggagtggcc ggcctgcccg acgacgatgc cggcgagctg 1440
cctgccgccg tcgtcgtgct ggaacacggc aagaccatga ccgagaagga gatcgtggac 1500
tatgtggcca gccaggtgac aaccgccaag aagctgcgcg gcggagtggt gttcgtggac 1560
gaggtgccca agggcctgac cggcaagctg gacgcccgca agatccgcga gatcctgatc 1620
aaggctaaga aaggcggcaa gatcgccgtg tatcaggaag tacacgagaa gctccgagga 1680
tggctgaagt ccaacgtctc tgatgcggtg gctcagagca cccgtatcat ttatggaggt 1740
gagtggcttt ggttcccggc tgaggtggag tgggctgagg actagactga gccctcggac 1800
atggaggtgg ggatggggca gactcatccc attcttgacc aagcccttgt tctgctccct 1860
tcccaggctc tgtgactggg gcaacctgca aggagctggc cagcgcttcc aaggtgtacg 1920
accccgagca acgcaaacgc atgatcactg ggcctcagtg gtgggctcgc tgcaagcaaa 1980
tgaacgtgct ggactccttc atcaactact atgattccga gaagcacgcc gagaacgccg 2040
tgatttttct gcatggtaac gctgcctcca gctacctgtg gaggcacgtc gtgcctcaca 2100
tcgagcccgt ggctagatgc atcatccctg atctgatcgg aatgggtaag tccggcaaga 2160
gcgggaatgg ctcatatcgc ctcctggatc actacaagta cctcaccgct tggttcgagc 2220
tgctgaacct tccaaagaaa atcatctttg tgggccacga ctggggggct tgtctggcct 2280
ttcactactc ctacgagcac caagacaaga tcaaggccat cgtccatgct gagagtgtcg 2340
tggacgtgat cgagtcctgg gacgagtggc ctgacatcga ggaggatatc gccctgatca 2400
agagcgaaga gggcgagaaa atggtgcttg agaataactt cttcgtcgag accatgctcc 2460
caagcaagat catgcggaaa ctggagcctg aggagttcgc tgcctacctg gagccattca 2520
aggagaaggg cgaggttaga cggcctaccc tctcctggcc tcgcgagatc cctctcgtta 2580
agggaggcaa gcccgacgtc gtccagattg tccgcaacta caacgcctac cttcgggcca 2640
gcgacgatct gcctaagatg ttcatcgagt ccgaccctgg gttcttttcc aacgctattg 2700
tcgagggagc taagaagttc cctaacaccg agttcgtgaa ggtgaagggc ctccacttca 2760
gccaggagga cgctccagat gaaatgggta agtacatcaa gagcttcgtg gagcgcgtgc 2820
tgaagaacga gcagtaa 2837
<210>5
<211>8203
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60
ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120
cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180
ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240
gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300
tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360
cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420
attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480
atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540
atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600
tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660
actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720
aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780
gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840
ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900
gtttaaactt aagcttggta ccatggccga tgctaagaac attaagaagg gccctgctcc 960
cttctaccct ctggaggatg gcaccgctgg cgagcagctg cacaaggcca tgaagaggta 1020
tgccctggtg cctggcacca ttgccttcac cgatgcccac attgaggtgg acatcaccta 1080
tgccgagtac ttcgagatgt ctgtgcgcct ggccgaggcc atgaagaggt acggcctgaa 1140
caccaaccac cgcatcgtgg tgtgctctga gaactctctg cagttcttca tgccagtgct 1200
gggcgccctg ttcatcggag tggccgtggc ccctgctaac gacatttaca acgagcgcga 1260
gctgctgaac agcatgggca tttctcagcc taccgtggtg ttcgtgtcta agaagggcct 1320
gcagaagatc ctgaacgtgc agaagaagct gcctatcatc cagaagatca tcatcatgga 1380
ctctaagacc gactaccagg gcttccagag catgtacaca ttcgtgacat ctcatctgcc 1440
tcctggcttc aacgagtacg acttcgtgcc agagtctttc gacagggaca aaaccattgc 1500
cctgatcatg aacagctctg ggtctaccgg cctgcctaag ggcgtggccc tgcctcatcg 1560
caccgcctgt gtgcgcttct ctcacgcccg cgaccctatt ttcggcaacc agatcatccc 1620
cgacaccgct attctgagcg tggtgccatt ccaccacggc ttcggcatgt tcaccaccct 1680
gggctacctg atttgcggct ttcgggtggt gctgatgtac cgcttcgagg aggagctgtt 1740
cctgcgcagc ctgcaagact acaaaattca gtctgccctg ctggtgccaa ccctgttcag 1800
cttcttcgct aagagcaccc tgatcgacaa gtacgacctg tctaacctgc acgagattgc 1860
ctctggcggc gccccactgt ctaaggaggt gggcgaagcc gtggccaagc gctttcatct 1920
gccaggcatc cgccagggct acggcctgac cgagacaacc agcgccattc tgattacccc 1980
agagggcgac gacaagcctg gcgccgtggg caaggtggtg ccattcttcg aggccaaggt 2040
ggtggacctg gacaccggca agaccctggg agtgaaccag cgcggcgagc tgtgtgtgcg 2100
cggccctatg attatgtccg gctacgtgaa taaccctgag gccacaaacg ccctgatcga 2160
caaggacggc tggctgcact ctggcgacat tgcctactgg gacgaggacg agcacttctt 2220
catcgtggac cgcctgaagt ctctgatcaa gtacaagggc taccaggtgg ccccagccga 2280
gctggagtct atcctgctgc agcaccctaa cattttcgac gccggagtgg ccggcctgcc 2340
cgacgacgat gccggcgagc tgcctgccgc cgtcgtcgtg ctggaacacg gcaagaccat 2400
gaccgagaag gagatcgtgg actatgtggc cagccaggtg acaaccgcca agaagctgcg 2460
cggcggagtg gtgttcgtgg acgaggtgcc caagggcctg accggcaagc tggacgcccg 2520
caagatccgc gagatcctga tcaaggctaa gaaaggcggc aagatcgccg tgtatcagga 2580
agtacacgag aagctccgag gatggctgaa gtccaacgtc tctgatgcgg tggctcagag 2640
cacccgtatc atttatggag gtgagtggct ttggttcccg gctgaggtgg agtgggctga 2700
ggactagact gagccctcgg acatggaggt ggggatgggg cagactcatc ccattcttga 2760
ccaagccctt gttctgctcc cttcccaggc tctgtgactg gggcaacctg caaggagctg 2820
gccagcgctt ccaaggtgta cgaccccgag caacgcaaac gcatgatcac tgggcctcag 2880
tggtgggctc gctgcaagca aatgaacgtg ctggactcct tcatcaacta ctatgattcc 2940
gagaagcacg ccgagaacgc cgtgattttt ctgcatggta acgctgcctc cagctacctg 3000
tggaggcacg tcgtgcctca catcgagccc gtggctagat gcatcatccc tgatctgatc 3060
ggaatgggta agtccggcaa gagcgggaat ggctcatatc gcctcctgga tcactacaag 3120
tacctcaccg cttggttcga gctgctgaac cttccaaaga aaatcatctt tgtgggccac 3180
gactgggggg cttgtctggc ctttcactac tcctacgagc accaagacaa gatcaaggcc 3240
atcgtccatg ctgagagtgt cgtggacgtg atcgagtcct gggacgagtg gcctgacatc 3300
gaggaggata tcgccctgatcaagagcgaa gagggcgaga aaatggtgct tgagaataac 3360
ttcttcgtcg agaccatgct cccaagcaag atcatgcgga aactggagcc tgaggagttc 3420
gctgcctacc tggagccatt caaggagaag ggcgaggtta gacggcctac cctctcctgg 3480
cctcgcgaga tccctctcgt taagggaggc aagcccgacg tcgtccagat tgtccgcaac 3540
tacaacgcct accttcgggc cagcgacgat ctgcctaaga tgttcatcga gtccgaccct 3600
gggttctttt ccaacgctat tgtcgaggga gctaagaagt tccctaacac cgagttcgtg 3660
aaggtgaagg gcctccactt cagccaggag gacgctccag atgaaatggg taagtacatc 3720
aagagcttcg tggagcgcgt gctgaagaac gagcagtaac tcgagtctag agggcccgtt 3780
taaacccgct gatcagcctc gactgtgcct tctagttgcc agccatctgt tgtttgcccc 3840
tcccccgtgc cttccttgac cctggaaggt gccactccca ctgtcctttc ctaataaaat 3900
gaggaaattg catcgcattg tctgagtagg tgtcattcta ttctgggggg tggggtgggg 3960
caggacagca agggggagga ttgggaagac aatagcaggc atgctgggga tgcggtgggc 4020
tctatggctt ctgaggcgga aagaaccagc tggggctcta gggggtatcc ccacgcgccc 4080
tgtagcggcg cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt 4140
gccagcgccc tagcgcccgc tcctttcgct ttcttccctt cctttctcgc cacgttcgcc 4200
ggctttcccc gtcaagctct aaatcggggg ctccctttag ggttccgatt tagtgcttta 4260
cggcacctcg accccaaaaa acttgattag ggtgatggtt cacgtagtgg gccatcgccc 4320
tgatagacgg tttttcgccc tttgacgttg gagtccacgt tctttaatag tggactcttg 4380
ttccaaactg gaacaacact caaccctatc tcggtctatt cttttgattt ataagggatt 4440
ttgccgattt cggcctattg gttaaaaaat gagctgattt aacaaaaatt taacgcgaat 4500
taattctgtg gaatgtgtgt cagttagggt gtggaaagtc cccaggctcc ccagcaggca 4560
gaagtatgca aagcatgcat ctcaattagt cagcaaccag gtgtggaaag tccccaggct 4620
ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc atagtcccgc 4680
ccctaactcc gcccatcccg cccctaactc cgcccagttc cgcccattct ccgccccatg 4740
gctgactaat tttttttatt tatgcagagg ccgaggccgc ctctgcctct gagctattcc 4800
agaagtagtg aggaggcttt tttggaggcc taggcttttg caaaaagctc ccgggagctt 4860
gtatatccat tttcggatct gatcaagaga caggatgagg atcgtttcgc atgattgaac 4920
aagatggatt gcacgcaggt tctccggccg cttgggtgga gaggctattc ggctatgact 4980
gggcacaaca gacaatcggc tgctctgatg ccgccgtgtt ccggctgtca gcgcaggggc 5040
gcccggttct ttttgtcaag accgacctgt ccggtgccct gaatgaactg caggacgagg 5100
cagcgcggct atcgtggctg gccacgacgg gcgttccttg cgcagctgtg ctcgacgttg 5160
tcactgaagc gggaagggac tggctgctat tgggcgaagt gccggggcag gatctcctgt 5220
catctcacct tgctcctgcc gagaaagtat ccatcatggc tgatgcaatg cggcggctgc 5280
atacgcttga tccggctacc tgcccattcg accaccaagc gaaacatcgc atcgagcgag 5340
cacgtactcg gatggaagcc ggtcttgtcg atcaggatga tctggacgaa gagcatcagg 5400
ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgcg catgcccgac ggcgaggatc 5460
tcgtcgtgac ccatggcgat gcctgcttgc cgaatatcat ggtggaaaat ggccgctttt 5520
ctggattcat cgactgtggc cggctgggtg tggcggaccg ctatcaggac atagcgttgg 5580
ctacccgtga tattgctgaa gagcttggcg gcgaatgggc tgaccgcttc ctcgtgcttt 5640
acggtatcgc cgctcccgat tcgcagcgca tcgccttcta tcgccttctt gacgagttct 5700
tctgagcggg actctggggt tcgaaatgac cgaccaagcg acgcccaacc tgccatcacg 5760
agatttcgat tccaccgccg ccttctatga aaggttgggc ttcggaatcg ttttccggga 5820
cgccggctgg atgatcctcc agcgcgggga tctcatgctg gagttcttcg cccaccccaa 5880
cttgtttatt gcagcttata atggttacaa ataaagcaat agcatcacaa atttcacaaa 5940
taaagcattt ttttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta 6000
tcatgtctgt ataccgtcga cctctagcta gagcttggcg taatcatggt catagctgtt 6060
tcctgtgtga aattgttatc cgctcacaat tccacacaac atacgagccg gaagcataaa 6120
gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca ttaattgcgt tgcgctcact 6180
gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc 6240
ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg 6300
ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc 6360
cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag 6420
gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca 6480
tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca 6540
ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg 6600
atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag 6660
gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt 6720
tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca 6780
cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg 6840
cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa gaacagtatt 6900
tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc 6960
cggcaaacaa accaccgctg gtagcggttt ttttgtttgc aagcagcaga ttacgcgcag 7020
aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa 7080
cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat 7140
ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc 7200
tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc 7260
atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc 7320
tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc 7380
aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc 7440
catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt 7500
gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc 7560
ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa 7620
aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt 7680
atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg 7740
cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc 7800
gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa 7860
agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt 7920
gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt 7980
caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag 8040
ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta 8100
tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat 8160
aggggttccg cgcacatttc cccgaaaagt gccacctgac gtc 8203
Claims (6)
1. A double-reporter gene probe for monitoring the splicing efficiency of pre-mRNA is characterized by comprising a vector pcDNA3.1 and a gene segment A, B, C, wherein the gene segment A, B, C is recombined with the linearized pcDNA3.1 vector according to the sequence of A-B-C, the segment A is Fluc, the segment B consists of exon 1, Intron and exon 2, and the segment C is Rluc.
2. The dual-reporter gene probe for monitoring pre-mRNA splicing efficiency according to claim 1, wherein the nucleotide sequence of the fragment A is shown as SEQ ID No.1, the nucleotide sequence of the fragment B is shown as SEQ ID No.2, and the nucleotide sequence of the fragment C is shown as SEQ ID No. 3.
3. The dual reporter gene probe for monitoring pre-mRNA splicing efficiency according to claim 1, wherein the nucleotide sequence of the probe is shown as SEQ ID No. 5.
4. The method for preparing a dual-luciferase reporter gene imaging probe according to claim 1, comprising the steps of:
1) the vector pcDNA3.1 is digested by KpnI and XhoI, so that the vector is linearized;
2) a, B, C fragments are amplified by PCR;
3) the gene fragment A, B, C is recombined with the linearized pcDNA3.1 vector according to the sequence A-B-C;
4) and transforming the recombinant vector, extracting plasmid, and carrying out enzyme digestion identification to obtain the Dual-Luc reporter gene probe.
5. The method according to claim 5, wherein the fragment A is Fluc, the fragment B is exon 1, Intron, exon 2, and the fragment C is Rluc.
6. The method according to claim 5, wherein the nucleotide sequence of the gene fragment amplified in step (2) is represented by SEQ ID NO. 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911193339.7A CN110747204A (en) | 2019-11-28 | 2019-11-28 | Double-reporter gene probe for monitoring pre-mRNA splicing efficiency and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911193339.7A CN110747204A (en) | 2019-11-28 | 2019-11-28 | Double-reporter gene probe for monitoring pre-mRNA splicing efficiency and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110747204A true CN110747204A (en) | 2020-02-04 |
Family
ID=69284955
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911193339.7A Pending CN110747204A (en) | 2019-11-28 | 2019-11-28 | Double-reporter gene probe for monitoring pre-mRNA splicing efficiency and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110747204A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160040186A1 (en) * | 2014-08-07 | 2016-02-11 | Xiaoyun Liu | Dna construct and method for transgene expression |
| CN109679976A (en) * | 2019-01-04 | 2019-04-26 | 西北农林科技大学 | A kind of alternative splicing report carrier and preparation method thereof |
| CN110218739A (en) * | 2019-05-30 | 2019-09-10 | 西安电子科技大学 | A kind of monitoring pre-mRNA montage process report gene image probe and its construction method |
| CN110317806A (en) * | 2019-05-06 | 2019-10-11 | 西安电子科技大学 | A kind of composing type montage reporter gene image probe and preparation method thereof |
-
2019
- 2019-11-28 CN CN201911193339.7A patent/CN110747204A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160040186A1 (en) * | 2014-08-07 | 2016-02-11 | Xiaoyun Liu | Dna construct and method for transgene expression |
| CN109679976A (en) * | 2019-01-04 | 2019-04-26 | 西北农林科技大学 | A kind of alternative splicing report carrier and preparation method thereof |
| CN110317806A (en) * | 2019-05-06 | 2019-10-11 | 西安电子科技大学 | A kind of composing type montage reporter gene image probe and preparation method thereof |
| CN110218739A (en) * | 2019-05-30 | 2019-09-10 | 西安电子科技大学 | A kind of monitoring pre-mRNA montage process report gene image probe and its construction method |
Non-Patent Citations (4)
| Title |
|---|
| BIN GUO ET AL.: "A ratiometric dual luciferase reporter for quantitative monitoring of pre-mRNA splicing efficiency in vivo", 《J. BIOL. CHEM》 * |
| MONICA SALANI ET AL.: "Development of a Screening Platform to Identify Small Molecules That Modify ELP1 Pre-mRNA Splicing in Familial Dysautonomia", 《SLAS DISCOV》 * |
| 侯兵等: "正向和反向SV40 poly(A)信号序列对上游基因表达的影响", 《第二军医大学学报》 * |
| 史亚茹: "基于荧光素酶报告基因的pre-mRNA剪接的分子影像研究", 《中国优秀硕士学位论文全文数据库 医药卫生科技辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chorghade et al. | Poly (A) tail length regulates PABPC1 expression to tune translation in the heart | |
| Stavreva et al. | Dynamics of chromatin accessibility and long-range interactions in response to glucocorticoid pulsing | |
| Wagner et al. | HO-1 inhibits preadipocyte proliferation and differentiation at the onset of obesity via ROS dependent activation of Akt2 | |
| Liu et al. | As a novel p53 direct target, bidirectional gene HspB2/αB-crystallin regulates the ROS level and Warburg effect | |
| Mariappan et al. | Ribosomal biogenesis induction by high glucose requires activation of upstream binding factor in kidney glomerular epithelial cells | |
| Chen et al. | Inhibition of myocyte-specific enhancer factor 2A improved diabetic cardiac fibrosis partially by regulating endothelial-to-mesenchymal transition | |
| Nimura et al. | Regulation of alternative polyadenylation by Nkx2-5 and Xrn2 during mouse heart development | |
| CN110317806B (en) | Constitutive splicing reporter gene image probe and preparation method thereof | |
| CN107312782B (en) | Duck tembusu virus E protein truncation gene, recombinant duck plague virus, construction method and application | |
| KR100878959B1 (en) | Screening method | |
| Kang et al. | Therapeutic potential of miR-21 regulation by human peripheral blood derived-small extracellular vesicles in myocardial infarction | |
| Sakamoto et al. | R3hdml regulates satellite cell proliferation and differentiation | |
| CN117343957A (en) | Construction method of engineering cell for expressing recombinant humanized collagen | |
| CN110747204A (en) | Double-reporter gene probe for monitoring pre-mRNA splicing efficiency and preparation method thereof | |
| CN104096239B (en) | Application of human augmenter of liver regeneration (hALR) genetic micro-ring eukaryotic expression vector in aspect of reducing liver collagen synthesis | |
| CN112680462B (en) | Human papilloma virus 35/HPV 35 type L1/L2 and preparation and application thereof | |
| US20230192784A1 (en) | KLF Induced Cardiomyogenesis | |
| CN106566844B (en) | Method for down-regulating eukaryotic gene expression and kit thereof | |
| CN107384921B (en) | miR216a for inhibiting proliferation, invasion and migration of osteosarcoma cells | |
| KR20070002054A (en) | Dual-transfected cells lines as in vitro screening tools for pharmaceutical compound profiling: a model for heptobiliary elimination | |
| Albertin et al. | Gene silencing of human RAMP2 mediated by short-interfering RNA | |
| CN102698291A (en) | Brucella antigen gene combination ROB capable of improving cellullar immunologic response | |
| CN111358959B (en) | Application of Roquin1 protein and coding gene thereof in preparation of tumor inhibition drugs | |
| Shen et al. | BRD2 regulation of sigma-2 receptor expression upon cytosolic cholesterol deprivation | |
| Yu et al. | BAP1 deubiquitinase is a potent repressor of fetal hemoglobin biosynthesis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |