CN110746485A - Screening of novel alkaline protease inhibitory peptides - Google Patents
Screening of novel alkaline protease inhibitory peptides Download PDFInfo
- Publication number
- CN110746485A CN110746485A CN201910952532.8A CN201910952532A CN110746485A CN 110746485 A CN110746485 A CN 110746485A CN 201910952532 A CN201910952532 A CN 201910952532A CN 110746485 A CN110746485 A CN 110746485A
- Authority
- CN
- China
- Prior art keywords
- alkaline protease
- amino acid
- polypeptide
- screening
- tyrosine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1062—Isolating an individual clone by screening libraries mRNA-Display, e.g. polypeptide and encoding template are connected covalently
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
- C12N9/54—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B30/00—Methods of screening libraries
- C40B30/08—Methods of screening libraries by measuring catalytic activity
Abstract
The invention relates to screening of novel alkaline protease inhibitory peptides, and the novel octapeptide inhibitory peptides of alkaline protease from bacillus are obtained by an in vitro RNA display screening technology, can enhance the stability of the alkaline protease in a liquid preparation, and are expected to be applied to the liquid enzyme preparation and an enzyme-added liquid detergent.
Description
Technical Field
The invention belongs to the field of enzyme engineering, and particularly relates to screening of novel inhibitory peptides of alkaline protease derived from bacillus.
Background
Alkaline protease hydrolyzes protein most efficiently under alkaline conditions. The method is widely applied to industries such as washing, food, medicine, tanning and the like, wherein the consumption of the washing industry accounts for the global alkaline protease demand. The microbial alkaline protease mainly from bacillus is an enzyme for adding a main liquid detergent, has high dirt-removing capacity under alkaline conditions, and has the best effect on protein dirt such as blood stains, sweat stains, oil stains and the like. Protease is inactivated by autogenous cleavage, so that the liquid enzyme-containing detergent needs to be added with an inhibitor during storage to avoid degradation of the washing performance by hydrolysis of the alkaline protease itself. The protease inhibitor widely used in the liquid detergent at present is a boric acid inhibitor, is not friendly to the environment and human health, and animal toxicity tests show that the boric acid compound is a second class of reproductive toxicity compound, so that a very large reproductive toxicity risk exists after long-term use. Therefore, there is an urgent need to develop novel alkaline protease inhibitors that are green, environmentally friendly and safe, and polypeptide inhibitors are currently a major research direction.
The work of the present invention attempted to obtain inhibitory peptides of alkaline protease by screening through the mRNA in vitro display technique. The mRNA in vitro display technology has the advantages of high library capacity, high sensitivity and the like on the screening efficiency. The core technology is characterized in that an RNA sequence of a peptide library and a translated corresponding amino acid sequence form mRNA-linker-polypeptide fusion molecules through a linker (linker), the mRNA-linker-polypeptide fusion molecules are used for affinity peptide screening, and the obtained affinity peptide sequence can realize ultrahigh-sensitivity identification through PCR amplification and high-throughput sequencing of covalently linked cDNA. During the screening process, mRNA is covalently bound to its encoded polypeptide or protein to form mRNA-protein fusions that can be used in large-capacity polypeptide libraries (10)13～1015) Screening for polypeptides and proteins having specific biological functions. However, successful establishment and application of mRNA in vitro display technology is extremely challenging. No report on screening the inhibitory peptide of the alkaline protease by using the mRNA in vitro display technology exists at home and abroad.
Disclosure of Invention
The present invention aims to screen novel polypeptide inhibitors for bacillus-derived alkaline proteases by an mRNA in vitro display screening technique.
The technical scheme for realizing the purpose of the invention is as follows:
primarily screening candidate inhibitory peptides of the alkaline protease by an mRNA in vitro display method, and determining and verifying the inhibitory peptides of the alkaline protease by measuring the enzyme activity inhibition rate, which comprises the following steps:
(1) a specially designed and synthesized DNA library is subjected to steps of in vitro transcription, linker photocrosslinking, in vitro translation, purification, reverse transcription and the like to obtain a genotype phenotype fusion molecule library, namely an mRNA-linker-polypeptide fusion molecule library;
(2) immobilizing biotin-modified bacillus-derived alkaline protease by streptavidin magnetic beads;
(3) and then, carrying out incubation screening on the mRNA-linker-polypeptide fusion molecule library and magnetic bead immobilized alkaline protease, amplifying DNA of the screened affinity peptide through PCR, and then carrying out next screening.
(4) And finally obtaining the high-affinity fusion molecules by multi-round screening, and realizing the sequence identification of the candidate inhibitory peptides through PCR amplification and DNA sequencing.
(5) And (3) measuring the inhibition rate of the inhibitory peptide on the enzyme activity of the spore-derived alkaline protease, and confirming the inhibition performance of the inhibitory peptide on the alkaline protease.
The inhibitory peptide of bacillus-derived alkaline protease obtained by mRNA in vitro display screening is characterized in that the amino acid at the N1 position from the N terminal is tyrosine or histidine; position N2, cysteine or tryptophan; the amino acid types contained in the N1-N7 positions comprise histidine, leucine, cysteine, arginine, serine, proline, tyrosine, phenylalanine, asparagine, glycine, threonine, tryptophan and glutamic acid, and the carboxyl terminal position C1 of the polypeptide sequence is tyrosine, leucine or histidine. The amino acid positions in the octapeptide sequence were designated: the amino acid positions are N1, N2, N3, N4, N5, N6, N7 and C1 in sequence from the N segment.
Wherein the following ten octapeptides have high inhibitory activity against alkaline protease, including YCLSRDWH, HCLSRDWH, YCLSRDCH, YCLSRDWY, HCNNNNNNH, HWNNNNNH, YCLSRDWH, YCLSHDWH, YCLSRAWH and YCNNNNNNNH. The corresponding relation of amino acid abbreviations is as follows: arginine, R; aspartic acid, D; cysteine, C; histidine, H; asparagine, N; leucine, L; tryptophan, W; tyrosine, Y. The amino acid sequence is written from N-terminus to C-terminus.
The invention has the beneficial effects that:
(1) a plurality of rounds of screening of mRNA in vitro display successfully obtain novel octapeptide inhibitors of a plurality of alkaline proteases. The polypeptide inhibitor has high biological safety and small environment pollution. The protease inhibitor widely used in the liquid detergent at present is a boric acid inhibitor, is not friendly to the environment and human health, and animal toxicity tests show that the boric acid substance has a very large reproductive toxicity risk.
(2) The inhibition rate of inhibitory peptides such as YCLSRDWY and the like on the activity of alkaline protease from spores is close to the performance of the existing inhibitor 4-formylphenylboronic acid (4-FPBA), and the inhibitor is expected to be applied to liquid enzyme preparations and enzyme-added liquid detergents in the future.
Drawings
FIG. 1 is a diagram showing the distribution of amino acid species at different sites in octapeptide sequences screened by RNA in vitro display technology
FIG. 2 shows the inhibition rate of peptide fragments on the enzyme activity of alkaline protease
Detailed Description
The technical content of the present invention is further illustrated by the following examples, but the present invention is not limited to these examples, and the following examples should not be construed as limiting the scope of the present invention.
Example 1: mRNA in vitro display multi-round screening to obtain inhibitory peptide of alkaline protease
Construction of mRNA display DNA library
A DNA library encoding random octapeptides is chemically synthesized, and sequences such as T7 polymerase promoter, translation enhancer and translation initiation codon are added to the 5 'end, and an affinity purification tag is added to the 3' end. The specific sequence of the DNA library is as follows:
a primer sequence F:
(5 'TTCTAATACGACTCACTATAGGGACAATTACTATTTACAATTACA 3') R: (5 'ATAGCCGGTGATGATGAT GATGATGATGGC 3'), DNA libraries and primers were synthesized by Soviet Kirgiz Biotechnology, Inc. And (3) carrying out PCR amplification on the DNA library, wherein the amplification procedure is as follows: 5min at 95 ℃; 45s at 95 ℃, 45s at 55 ℃ and 10s at 72 ℃ for 30 cycles; 10min at 72 ℃.
2. Transcription
The PCR product was purified with the Cycle-Pure Kit DNA purification Kit (OMEGA) and eluted with DEPC water. Purified DNA (10 ng/. mu.L) 1. mu.L, 75mM T7 ATP Solution 2. mu.L, 75mM T7 UTP Solution 2. mu.L, 75mM T7 CTP Solution 2. mu.L, 75mM T7 GTP Solution 2. mu.L, T710 × Reaction Buffer 2. mu.L, T7 Enzyme Mix 2. mu.L, mixed and incubated at 37 ℃ for 4h in water. Adding 1 mu L of DNase after the water bath reaction, carrying out the water bath reaction at 37 ℃ for 15min, then immediately placing on ice for 2min after carrying out the water bath reaction at 65 ℃ for 5min, and eliminating the RNA secondary structure. The transcription product purified by the column type RNA rapid concentration and purification kit is used for detecting the generation of RNA by using 5 percent denatured acrylamide gel.
Linking mRNA to Linker
The sequence of the Linker (Linker) is: psoralen (psoralen) -TAGCCGGTGAAAAAAAAAAAAAAA- (PEG)2-ACC-puromycin (puromycin). 60. mu.L of RNA (500 ng/. mu.L), 30. mu.L of Tris-HCl (pH7.4, 250mM), 30. mu.L of NaCl (1M), 30. mu.L of Linker (50mM) and 150. mu.L of DEPC water were mixed, and the mixture was subjected to a water bath at 80 ℃ for 5 minutes and then allowed to stand at room temperature for 15 minutes. And then transferring the reaction solution into a 96-well plate by using a pipette gun, irradiating the 96-well plate for 15min under 365nm ultraviolet light, precipitating and recovering a product by using ethanol, loading the product to 5% denatured acrylamide gel, cutting an RNA-Linker strip, and recovering the cut gel by using a UNIQ-10 column type PAGE gel DNA recovery kit.
4. In vitro translation to obtain mRNA-polypeptide fusion molecules
Using an in vitro translation kit (Rabbit recombinant Lysate System, Promega), 24.5. mu.L of mRNA-Linker complex and 1.5. mu.L of RNA inhibitor RNase were added, and 1M MgCl was added after 1h water bath at 30 ℃25μL，2M CH3COOK 17. mu.L, mix well, centrifuge gently, incubate on ice for 15min, overnight at-20 ℃, purify the translation product using Oligo-dTcellulose method.
5. Reverse transcription to obtain cDNA-mRNA-polypeptide fusion molecule
Reverse transcription was performed using the purified mRNA-polypeptide library, and 1. mu.L of the downstream primer, 2. mu.L of the mRNA-polypeptide library, 4. mu.L of dNTP, and 5. mu.L of DEPC water were added in this order. Denaturation at 70 ℃ for 5min, quick cooling on ice, addition of: 4. mu.L of 5 Xfirst-stand buffer, 2. mu.L of 0.1M DTT and 1. mu.L of RNA inhibitor RNase. After incubation at 42 ℃ for 2min, 1. mu.L of reverse transcriptase was added and mixed well. Incubation was carried out at 25 ℃ for 2min and at 42 ℃ for 50 min. Subsequently, His-Tag purification was performed, 100. mu.L of resin Ni-superflow was transferred to a column, 200. mu.L of lysine Buffer (pH7.4) activated resin Ni-superflow was centrifuged at 12000rpm for 2min and the filtrate was discarded, and repeated once and discarded. Adding reverse transcription complex system, ice-cooling for 30min, adding 200 μ L wash Buffer (pH7.4) to the column to wash off nonspecific binding, centrifuging at 12000rpm for 2min, discarding filtrate, and repeating once. A further 100. mu.L of precipitation Buffer (pH7.4) was placed in a small column, centrifuged at 12000rpm for 2min and the filtrate collected and repeated once.
6. Magnetic bead immobilization of alkaline protease
Alkaline protease derived from Bacillus clausii (Bacillus clausii) or Bacillus lentus (Bacillus lentus) was biotinylated using a biotin labeling kit (Fuyin Dekkonid Co., Ltd.), 500. mu.L of a commercial alkaline protease solution was transferred to an ultrafiltration tube, and 300. mu.L of a labeling buffer was added. Centrifuging at 12000r/min for 10min, discarding the filtrate, repeating for 2 times, adding 200 μ L of labeling buffer solution and 13.3 μ L of dissolved super biotin into the ultrafiltration tube after the final ultrafiltration, mixing, and incubating in 37 deg.C incubator for 30min in dark. Centrifuging at 12000r/min for 10min, and discarding the filtrate. Adding 300 μ L of labeled buffer solution into the ultrafiltration tube, mixing, centrifuging at 12000r/min for 10min, discarding the waste liquid, repeating for 2 times, and collecting the trapped fluid at the last time. Then, magnetic bead immobilization was performed by streptavidin magnetic beads (Stannless Baimeige Biotech Co., Ltd.). After 100. mu.L (1mg) of streptavidin magnetic beads were thoroughly mixed, the mixture was placed on a magnetic stand, and after magnetic liquid separation, the supernatant was discarded. The 500. mu.L PBS (pH7.4) resuspended beads were removed, placed in a magnetic rack, and after magnetic separation, the supernatant was discarded and repeated twice. Then, 100 mu L PBS is used for resuspending the magnetic beads, biotinylation modified alkaline protease is added into the magnetic bead tube, the magnetic bead tube is oscillated at room temperature for 30min, the magnetic beads are kept in a suspension state in the process, then the magnetic frame is used for separating magnetic liquid, the supernatant is transferred into a clean centrifugal tube, 1mL PBS is added into the magnetic bead tube for resuspending the magnetic beads, the supernatant is removed after the magnetic liquid is separated, the operation is repeated twice, and finally 80 mu L PBS is added for resuspending the magnetic beads, and the screening of the affinity peptides is carried out.
7. Screening and sequencing of affinity peptides
Mixing biotinylated alkaline protease and cDNA-mRNA-polypeptide product, oscillating at room temperature for 30min, separating by magnetic liquid on a magnetic frame, removing supernatant, repeatedly washing magnetic beads for 3 times by 300 mu L of PBS (pH7.4), adding 100 mu L of PBS solution for resuspension of magnetic beads after the last washing, adding 2 mu L of RNase A, incubating at 37 ℃ for 1h, and extracting DNA by phenol chloroform method. And the obtained DNA enters the next round of screening after PCR amplification, and the target protein and the gene sequence coded by the target protein are finally enriched and separated after 3 consecutive rounds of screening. The finally obtained DNA was subjected to high throughput (Illumina GA Pipeline v1.8) sequencing (Jinzhi Biotech, Suzhou).
The amino acid distribution characteristics of the sequence obtained by sequencing the screened polypeptide are shown in figure 1, the abscissa represents the position of the amino acid phase in the screened octapeptide sequence, and the ordinate represents the proportion of different amino acids appearing at the position. As can be seen, the sequence has distinct characteristics, the amino acid at position N1 from the N-terminus is mostly tyrosine or histidine; the majority of the N2 positions are either cysteine or tryptophan; the amino acid types contained in the N1-N7 positions comprise histidine, leucine, cysteine, arginine, serine, proline, tyrosine, phenylalanine, asparagine, glycine, threonine, tryptophan and glutamic acid, and the carboxyl terminal position C1 of the polypeptide sequence is mostly tyrosine, leucine or histidine. The amino acid positions in the octapeptide sequence were designated: the amino acid positions are N1, N2, N3, N4, N5, N6, N7 and C1 in sequence from the N segment. Screening ten octapeptide sequences with highest affinity in the polypeptide, including YCLSRDWH, HCLSRDWH, YCLSRDCH, YCLSRDWY, HCNNNNNNH, HWNNNNNH, YCLSRDWH, YCLSHDWH, YCLSRAWH and YCNNNNNH. The corresponding relation of amino acid abbreviations is as follows: arginine, R; aspartic acid, D; cysteine, C; histidine, H; asparagine, N; leucine, L; tryptophan, W; tyrosine, Y. The amino acid sequence is written from N-terminus to C-terminus.
Example 2: inhibitory Effect of octapeptide inhibitor on alkaline protease
1. Octapeptide inhibitors YCLSRDWH, HCLSRDWH, YCLSRDCH, YCLSRDWY and HCNNNNNNH obtained by chemical synthesis screening;
2. after 2 ten thousand times of alkaline protease zymogen liquid is diluted by boric acid buffer solution (pH 10.5), the five inhibitory peptides are respectively added, and the final concentration is 0.17 mg/mL; 4-FPBA was added to the control group at a final concentration of 0.17mg/mL, and no inhibitor was added to the blank group. The enzyme activity inhibition rate is calculated after the enzyme activity of the alkaline protease is determined according to the national standard GBT 23527-2009.
3. The results of the enzyme activity inhibition assay are shown in FIG. 2. When the final concentration of the added inhibitory peptide is 0.17mg/mL, the inhibition rate of the polypeptide YCLSRDWH on the alkaline protease activity is 8%, the inhibition rate of the polypeptide HCLSRDWH is 14%, the inhibition rate of the polypeptide YCLSRDCH is 22%, the inhibition rate of the polypeptide HCNNNNH sequence peptide segment is 16%, and the inhibition rate of the polypeptide YCLSRDWY reaches 40%, which is close to the inhibition rate (51%) of the positive control 4-FPBA. 4-FPBA is a novel high-efficiency alkaline protease competitive inhibitor discovered and applied by Novixin. The results also demonstrate that the mRNA in vitro display technology can effectively screen peptide inhibitors of alkaline protease.
Claims (4)
1. Novel alkaline protease inhibiting peptides characterized by: the inhibitor is polypeptide consisting of 8 amino acids.
2. The polypeptide inhibitor of claim 1, wherein: in the octapeptide sequence obtained by screening through an RNA in-vitro display technology, from an amino terminal, the first amino acid site is tyrosine or histidine, the second amino acid site is cysteine or tryptophan, the types of amino acids contained in the third to fourth amino acid sites comprise histidine, leucine, cysteine, arginine, serine, proline, tyrosine, phenylalanine, asparagine, glycine, threonine, tryptophan and glutamic acid, and the carboxyl terminal site of the polypeptide sequence is tyrosine, leucine or histidine.
3. The polypeptide inhibitor of claim 1, wherein: the following ten octapeptides have significant inhibitory activity against Bacillus-derived alkaline proteases, including YCLSRDWH, HCLSRDWH, YCLSRDCH, YCLSRDWY, HCNNNNNNH, HWNNNNNH, YCLSRDWH, YCLSHDWH, YCLSRAWH and YCNNNNNH. The corresponding relation of amino acid abbreviations is as follows: arginine, R; aspartic acid, D; cysteine, C; histidine, H; asparagine, N; leucine, L; tryptophan, W; tyrosine, Y. The amino acid sequence is written from N-terminus to C-terminus.
4. The polypeptide inhibitor of alkaline protease according to claim 1, characterized in that: the alkaline protease is bacillus-derived alkaline protease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910952532.8A CN110746485A (en) | 2019-10-09 | 2019-10-09 | Screening of novel alkaline protease inhibitory peptides |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910952532.8A CN110746485A (en) | 2019-10-09 | 2019-10-09 | Screening of novel alkaline protease inhibitory peptides |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110746485A true CN110746485A (en) | 2020-02-04 |
Family
ID=69277745
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910952532.8A Pending CN110746485A (en) | 2019-10-09 | 2019-10-09 | Screening of novel alkaline protease inhibitory peptides |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110746485A (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1724683A (en) * | 2005-07-15 | 2006-01-25 | 中国海洋大学 | Method of preparing peptide having trypsin inhibition activity by using complex enzyme enzymolysis oyster |
| WO2009121848A2 (en) * | 2008-03-31 | 2009-10-08 | Umc Utrecht Holding B.V. | Use of pseudomonas aeruginosa alkaline protease (apra) and inhibitors thereof in medicine and agriculture |
| CN102667487A (en) * | 2009-12-10 | 2012-09-12 | 希森美康株式会社 | Method for detection of basic peptide and reagent for detection of basic peptide |
| JP2012180514A (en) * | 2011-02-10 | 2012-09-20 | Sanyo Chem Ind Ltd | Liquid detergent composition |
| US20120245081A1 (en) * | 2002-05-23 | 2012-09-27 | Trustees Of The University Of Pennsylvania | Fas peptide mimetics and uses thereof |
| CN103122022A (en) * | 2013-01-31 | 2013-05-29 | 陕西科技大学 | Angiotensin converting enzyme inhibitory peptide derived from bitter almond protein and preparation method thereof |
| CN108472332A (en) * | 2015-11-13 | 2018-08-31 | 汉阳大学校产学协力团 | Composition for treating apoplexy by nasal administration |
-
2019
- 2019-10-09 CN CN201910952532.8A patent/CN110746485A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120245081A1 (en) * | 2002-05-23 | 2012-09-27 | Trustees Of The University Of Pennsylvania | Fas peptide mimetics and uses thereof |
| CN1724683A (en) * | 2005-07-15 | 2006-01-25 | 中国海洋大学 | Method of preparing peptide having trypsin inhibition activity by using complex enzyme enzymolysis oyster |
| WO2009121848A2 (en) * | 2008-03-31 | 2009-10-08 | Umc Utrecht Holding B.V. | Use of pseudomonas aeruginosa alkaline protease (apra) and inhibitors thereof in medicine and agriculture |
| CN102667487A (en) * | 2009-12-10 | 2012-09-12 | 希森美康株式会社 | Method for detection of basic peptide and reagent for detection of basic peptide |
| JP2012180514A (en) * | 2011-02-10 | 2012-09-20 | Sanyo Chem Ind Ltd | Liquid detergent composition |
| CN103122022A (en) * | 2013-01-31 | 2013-05-29 | 陕西科技大学 | Angiotensin converting enzyme inhibitory peptide derived from bitter almond protein and preparation method thereof |
| CN108472332A (en) * | 2015-11-13 | 2018-08-31 | 汉阳大学校产学协力团 | Composition for treating apoplexy by nasal administration |
Non-Patent Citations (3)
| Title |
|---|
| BART W.BARDOEL等: "Inhibition of Pseudomonas aeruginosa Virulence: Characterization of the AprA–AprI Interface and Species Selectivity", 《JMB》 * |
| HONGBINWANG等: "Screening of the candidate inhibitory peptides of subtilisin by in vitro RNA display technique", 《INTERNATIONAL JOURNAL OF BIOLOGICAL MACROMOLECULES》 * |
| 阎松等: "胸苷酸合成酶mRNA亲和多肽的鉴定及其对翻译过程的抑制作用", 《中国科学C辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Labrou | Design and selection of ligands for affinity chromatography | |
| KR100713953B1 (en) | Selection of proteins using rna-protein fusions | |
| JP7429765B2 (en) | Peptide libraries expressed or displayed in yeast and their uses | |
| US5780221A (en) | Identification of enantiomeric ligands | |
| EP1073730A1 (en) | Use of a ribozyme to join nucleic acids and peptides | |
| CN109072203B (en) | Mirror image nucleic acid replication system | |
| JP6357154B2 (en) | Method for producing charged non-protein amino acid-containing peptide | |
| CN110637086A (en) | Method for producing complex of RNA molecule and peptide, and use thereof | |
| JP4959226B2 (en) | Three finger-like protein library | |
| JPWO2014119600A1 (en) | Flexible display method | |
| WO2020221255A1 (en) | Rna-binding fusion protein and use thereof | |
| EP0804559A1 (en) | Enzyme for cleavage of the anchor region of surface proteins from gram positive bacteria | |
| WO2017066907A1 (en) | Method of building hi-c library having high usable data ratio | |
| CN114127281A (en) | Proximity interaction analysis | |
| CN111500583B (en) | Aptamer for specifically recognizing bovine pregnancy-associated glycoprotein 4 and application thereof | |
| CN111868253A (en) | Method for extracting nucleic acid | |
| CN110746485A (en) | Screening of novel alkaline protease inhibitory peptides | |
| US6861403B2 (en) | Method and device for improving protein stability and solubility | |
| JP2004097213A (en) | Method for selecting nucleic acid and/or protein | |
| WO2021169980A1 (en) | Compositions and methods for detecting nucleic acid-protein interactions | |
| WO2003062417A1 (en) | Rna-dna ligation product and utilization thereof | |
| EP1894939A1 (en) | Novel supertag and its use | |
| WO2019112567A1 (en) | Methods and compositions related to selecting variant proteases | |
| JP2008193923A (en) | Protein library | |
| CN111138513B (en) | Screening of Cross-Linked peptides of Glutamine transaminase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20200204 |