CN110714015A

CN110714015A - mRNA rabies vaccine

Info

Publication number: CN110714015A
Application number: CN201911042634.2A
Authority: CN
Inventors: 刘隽; 彭育才; 向晟楠; 苏晓晔; 刘琪; 雷奕欣; 李爽
Original assignee: Zhuhai Lifanda Biotechnology Co Ltd
Current assignee: Zhuhai Lifanda Biotechnology Co Ltd
Priority date: 2019-10-29
Filing date: 2019-10-29
Publication date: 2020-01-21
Anticipated expiration: 2039-10-29
Also published as: CN110714015B

Abstract

The invention relates to the field of nucleic acid vaccines, and particularly provides an mRNA rabies vaccine. The invention provides an optimized RVG mRNA, and the nucleotide sequence transcribed by the optimized RVG mRNA is shown in SEQ ID NO. 1. The inventor obtains a sequence of optimized RVG mRNA with a nucleotide sequence shown as SEQ ID NO.1 by optimizing a rabies virus CTN-1 strain G protein (RVG) coding region. The nucleotide sequence makes the transcribed mRNA structure more stable and the target protein translation efficiency in mammals and human bodies higher. The rabies virus nucleic acid vaccine provided by the invention comprises a vaccine vector and optimized RVG mRNA, can achieve a sufficient protection effect by using a very small dose, and is superior to the existing rabies vaccine technology in the aspects of safety and effectiveness.

Description

mRNA rabies vaccine

Technical Field

The invention relates to the field of nucleic acid vaccines, in particular to an mRNA rabies vaccine.

Background

Rabies is one of the oldest diseases affecting human health in the world, and the earliest record is found 4300 years ago, and is a viral animal infectious disease caused by Rabies Virus (RV). The virus transmission route mainly passes through animals such as dogs and cats which are not inoculated or failed to be inoculated, at present, the veterinary rabies vaccine is mainly a Vero cell inactivated vaccine, although the occurrence rate of rabies can be greatly reduced by the emergence of the vaccines, the production process of the vaccine still has a plurality of technical difficulties, such as a large-scale cell suspension culture technology, the expanded production of viruses and the like, and therefore, the novel rabies vaccine is widely developed in the world.

The current market rabies vaccine is mainly rabies virus inactivated vaccine, the production cost of the vaccine is high, and the main reason is that the produced rabies virus has low titer, and the effective antigen content in each milliliter of vaccine is high, so the rabies virus with higher titer needs to be produced.

Rabies virus is a single-stranded RNA virus with two major antigens: one is glycoprotein antigen on the outer membrane of the virus, which can combine with acetylcholine receptor to make the virus have neurotoxicity and produce neutralizing antibody and hemagglutination inhibiting antibody in vivo, and the neutralizing antibody has protective effect; the other is an inner nucleoprotein antigen, which can generate complement-binding antibody and precipitin in vivo without protection. Although functional glycoprotein antigens can be immunized, not only nonspecific immunity but also production cost can be reduced. However, at present, in the process of in vitro production of subunit vaccines, how to select a proper expression system and a purification process of an expression product becomes a technical difficulty in the whole research and development and production processes, so that similar vaccines are not seen in the market at present.

Rabies virus vaccines currently available on the market often have a number of disadvantages in their use, in particular: 1) the preparation process is complex, a cell culture method is needed for producing the virus, and certain potential safety hazards exist. 2) The requirements of quality control and process amplification are high, and product quality accidents can be caused by poor control. 3) The effective antigen amount produced by the virus is low, and the virus titer is required to be improved in order to ensure the effect, so that the production cost is increased.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The first purpose of the invention is to provide a method for optimizing RVG mRNA to relieve the technical problems of low antigen activity, poor translation efficiency and stability to be improved in the prior art for nucleic acid vaccines.

The second objective of the invention is to provide the above-mentioned use for optimizing RVG mRNA.

The third purpose of the invention is to provide a rabies virus nucleic acid vaccine to solve the problems of low virus titer, small effective antigen amount and high production cost of the rabies vaccine in the prior art.

The fourth purpose of the invention is to provide a preparation method of the rabies virus nucleic acid vaccine, which is simple and convenient to operate and high in yield.

In order to achieve the above purpose of the present invention, the following technical solutions are adopted:

an optimized RVG mRNA, the nucleotide sequence for transcribing the optimized RVG mRNA is shown as SEQ ID No. 1.

Further, transcribing the nucleotide sequence of the optimized RVG mRNA also includes the following elements: at least one of a 5 '-cap structure, a 5' -UTR, a 3 '-polyadenylation sequence, and a 3' -UTR;

preferably, the 5' -UTR is 10-200 nucleotides, more preferably 15-100 nucleotides;

preferably, the 5 '-UTR is a DNAH 25' -UTR sequence or a KOZAK sequence;

preferably, the KOZAK sequence is as shown in SEQ ID NO. 3:

5’-GGCTAGCGCCGCCACC-3’(SEQ ID NO.3)；

preferably, the DNAH 25' -UTR sequence is shown in SEQ ID NO. 4:

5’-GAGACCCAAGCTGGCTAGCGGGAGAAAGCTTACC-3’(SEQ ID NO.4)；

preferably, the 3' -poly A sequence is preferably 60 to 120A, more preferably 80 to 110A, and further preferably 100A;

preferably, the 3 ' -UTR comprises a β -globin 3 ' -UTR sequence or a hemoglobin HBA23 ' -UTR sequence;

preferably, the sequence of the hemoglobin HBA 23' -UTR is shown in SEQ ID NO. 5:

5’-GCTGGAGCCTCGGTAGCCGTTCCTCCTGCCCGCTGGGCCTCCC AACGGGCCCTCCTCCCCTCCTTGCACCGGCCCTTCCTGGTCTTTGAATAAAGTCTGAGTGGGCAGC-3’(SEQ ID NO.5)。

further, the sequence of the optimized RVG mRNA is shown as SEQ ID NO. 2.

The optimized RVG mRNA is applied to preparing rabies virus nucleic acid vaccines.

A rabies virus nucleic acid vaccine comprises a vaccine vector and optimized RVG mRNA provided by the invention.

Further, the vaccine carrier comprises one of cationic liposome, cationic protein, cationic polymer or cationic lipid nanoparticle, preferably cationic liposome or cationic lipid nanoparticle;

preferably, the mass ratio of cationic lipid nanoparticles to optimized RVG mRNA is 10-30:1, preferably 15-25:1, more preferably 20: 1;

preferably, the mass ratio of cationic liposome to optimized RVG mRNA is 1-8:1, preferably 1-4:1, more preferably 2: 1.

Further, the vaccine carrier is a cationic lipid nanoparticle which comprises 20-50% of protonatable cationic lipid, 20-50% of structural lipid, 5-20% of auxiliary lipid and 1-5% of surfactant in terms of molar percentage, wherein the molar contents of the protonatable cationic lipid, the structural lipid, the auxiliary lipid and the surfactant are 100% in total;

preferably, the protonatable cationic lipid comprises Dlin-MC3-DMA, Dlin-KC2-DMA, DODMA, c12-200 or DlinDMA, preferably Dlin-MC 3-DMA;

preferably, the structural lipid comprises cholesterol, cholesterol esters, steroid hormones, steroid vitamins or bile acids, preferably cholesterol;

preferably, the helper lipid comprises DSPC, DOPE, DOPC or DOPS, preferably DSPC;

preferably, the surfactant comprises PEG-DMG or PEG-DSPE, preferably PEG-DMG;

preferably, the administration mode of the rabies virus nucleic acid vaccine comprises intravenous injection, intramuscular injection or intradermal injection, and preferably intramuscular injection.

The preparation method of the rabies virus nucleic acid vaccine mixes the vaccine vector and the optimized RVG mRNA provided by the invention to obtain the rabies virus nucleic acid vaccine.

Further, the vaccine vector is a cationic lipid nanoparticle in the rabies virus nucleic acid vaccine, and the preparation method comprises the following steps:

(a) dissolving protonatable cationic lipid, structural lipid, auxiliary lipid and surfactant in an organic solution according to a formula ratio to obtain an organic phase;

(b) dissolving optimized RVG mRNA in PBS or citrate solution to obtain a water phase;

(c) uniformly mixing the organic phase obtained in the step (a) and the water phase obtained in the step (b) to obtain a mixed solution, and replacing a solvent in the mixed solution to obtain a buffer solution to obtain the rabies virus nucleic acid vaccine;

preferably, the organic solution comprises absolute ethanol, tetrahydrofuran, acetone or DMSO, preferably absolute ethanol;

preferably, the total concentration of the protonatable cationic lipid, structural lipid, helper lipid and surfactant in the organic phase is from 5 to 7 mg/ml;

preferably, the optimized RVG mRNA concentration in the water phase is 0.8-1.2 mg/ml;

preferably, the volume ratio of the organic phase to the aqueous phase is 1: 2-4;

preferably, the mixing is carried out by adopting a micro-fluidic device, and the flow rate ranges from 6 ml/min to 24ml/min, preferably 12.0 ml/min;

preferably, replacing the solvent in the mixture with a buffer comprises: the mixture was diluted 50-100 times with buffer and concentrated.

Further, the preparation method also comprises the process of preparing the liquid rabies virus nucleic acid vaccine into a freeze-dried preparation;

preferably, 5-30 w/v% of pharmaceutically acceptable freeze-drying protective agent is added into the rabies virus nucleic acid vaccine to obtain a preparation to be freeze-dried, and the preparation to be freeze-dried is freeze-dried to obtain a freeze-dried preparation;

preferably, the preparation to be lyophilized also comprises 0.005-0.05 w/v% of pharmaceutically acceptable surfactant;

preferably, the lyophilization process comprises: under the condition that the vacuum degree is 20-80 μ bar, the temperature is kept for 1-8h at-40 ℃ to-60 ℃, 10-30h at-30 ℃ to-50 ℃ and 10-30h at 4 ℃ to 20 ℃ in sequence.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides an optimized RVG mRNA, and the nucleotide sequence transcribed by the optimized RVG mRNA is shown in SEQ ID NO. 1. The inventor optimizes the G protein (RVG) coding region of rabies virus CTN-1 strain, and the sequence optimization comprises the following steps: adjusting codon preference during expression in human body, adjusting the use frequency of common codons, improving GC content of the sequence and the like to obtain the optimized RVG mRNA sequence with the nucleotide sequence shown as SEQ ID NO. 1. The nucleotide sequence makes the transcribed mRNA structure more stable and the target protein translation efficiency in mammals and human bodies higher.

The rabies virus nucleic acid vaccine provided by the invention comprises a vaccine vector and optimized RVG mRNA. The nucleic acid vaccine transfers optimized RVG mRNA synthesized by in vitro transcription to in vivo to generate rabies virus glycoprotein (namely antigen protein), achieves the effect of achieving enough protection by using a very small dose, reduces the production cost, and is superior to the prior rabies vaccine technology in effectiveness.

The invention provides a preparation method of the rabies virus nucleic acid vaccine, which mixes a vaccine vector and optimized RVG mRNA to obtain the rabies virus nucleic acid vaccine. The method is simple and easy to operate, reduces the process difficulty of vaccine production, can realize large-scale production, is easy to control the batch difference, and greatly reduces the production cost.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 shows the results of expression levels of HEK293 cells transfected with different RVG mRNAs in example 3;

FIG. 2 is a graph showing the results of different modes of administration for delivering mRNA in example 5;

FIG. 3 shows the results of neutralizing antibody titers against the nucleic acid vaccine against rabies virus in the beagle test in example 7;

FIG. 4 is a graph showing the effect of the rabies virus nucleic acid vaccine on the production of antibodies before and after lyophilization in example 8.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer.

Unless otherwise defined, technical and scientific terms used herein have the same meaning as is familiar to those skilled in the art. In addition, any methods or materials similar or equivalent to those described herein can also be used in the present invention.

An optimized RVG mRNA, the nucleotide sequence of the transcription optimized RVG mRNA is shown as SEQ ID NO. 1:

5’-ATGATTCCTCAGGCTCTGCTGTTCGTCCCACTGCTGGTCTTCCCACTGTGCTTCGGCAAGTTCCCCATCTACACTATTCCTGACAAACTGGGCCCTTGGTCCCCAATCGACATCCACCACCTGTCCTGTCCCAACAATCTGGTGGTGGAGGACGAGGGCTGTACCAATCTGAGCGGCTTCTCCTACATGGAGCTGAAGGTGGGCTACATCTCCGCCATCAAGGTGAACGGCTTCACATGTACCGGCGTGGTGACAGAGGCCGAGACATACACCAACTTCGTGGGCTATGTGACCACAACCTTCAAGCGGAAGCACTTCAGACCAACCCCTGATGCCTGTCGGTCCGCCTATAACTGGAAGATGGCCGGCGACCCACGGTATGAGGAGAGCCTGCACAACCCATACCCCGATTACCACTGGCTGAGGACAGTGAAGACAACCAAGGAGTCCGTGGTAATCATCTCTCCAAGCGTGGCCGATCTGGACCCATACGATAAGTCCCTGCACAGCAGAGTGTTCCCCCGCGGCAAGTGTTCTGGCATCACAGTGAGCTCCGCCTATTGCTCTACCAACCACGACTACACCATCTGGATGCCTGAGAATCCAAGACTGGGCACCTCCTGTGACATCTTTACCAACTCTCGGGGCAAGAGAGCCTCCAAGGGCTCCAAGACATGTGGCTTCGTGGACGAGAGAGGCCTGTATAAGTCCCTGAAGGGCGCCTGCAAGCTGAAGCTGTGCGGCGTGCTGGGCCTGAGGCTGATGGACGGCACCTGGGTGGCCATCCAGACATCCAACGAGACCAAGTGGTGCCCTCCTGATCAGCTGGTGAACCTGCACGACTTTCACAGCGACGAGATCGAGCACCTGGTGGTGGAGGAGCTGGTGAAGAAGAGAGAGGAGTGCCTGGATGCCCTGGAGTCCATCATGACCACCAAGAGCGTGTCCTTTAGACGGCTGAGCCACCTGAGAAAGCTGGTGCCCGGCTTTGGCAAGGCCTACACCATCTTCAACAAGACACTGATGGAGGCCGATGCCCACTACAAGTCCGTGAGAACCTGGAACGAGATCATCCCTAGCAAGGGCTGTCTGAGGGTGGGCGGCAGATGTCACCCTCACGTGAATGGCGTGTTCTTTAATGGCATCATCCTGGGCCCAGATGGCCACGTGCTGATCCCAGAGATGCAGTCCTCTCTGCTGCAGCAGCACATGGAGCTGCTGGAGTCTAGCGTGATCCCTCTGATGCACCCACTGGCCGATCCAAGCACAGTGTTCAAGGACGGCGACGAGGTGGAGGACTTTGTGGAGGTGCACCTGCCAGATGTGCACAAGCAGGTGTCCGGCGTGGATCTGGGCCTGCCAAATTGGGGCAAGGACGTGCTGATGGGCGCCGGCGTGCTGACCGCCCTGATGCTGATGATCTTCCTGATGACCTGCTGTAGACGGACAAATAGAGCCGAGAGCATCCAGCACTCCCTGGGCGAGACAGGCCGGAAGGTGTCTGTGACCAGCCAGAGTGGACGAGTGATCTCCTCATGGGAATCCTACAAAAGCGGCGGCGAGACCAAACTGTGA-3’(SEQ IDNO.1)。

the inventor optimizes the G protein (RVG) coding region of rabies virus CTN-1 strain, and the sequence optimization comprises the following steps: adjusting the codon preference during expression in human body, adjusting the use frequency of common codons, improving the GC content of the sequence and the like to obtain the sequence of the transcription optimized RVG mRNA with the nucleotide sequence shown as SEQ ID NO. 1. The nucleotide sequence makes the transcribed mRNA structure more stable and the target protein translation efficiency in mammals and human bodies higher.

In a preferred embodiment, the nucleotide sequence of the transcription optimized RVG mRNA further comprises the following elements: at least one of a 5 '-cap structure, a 5' -UTR, a 3 '-polyadenylation sequence, and a 3' -UTR. The addition of 5 '-cap structure, 5' -UTR, 3 '-polyadenylation sequence and 3' -UTR sequence elements can further improve the stability of the sequence and avoid degradation.

In a preferred embodiment, the 5' -UTR is 10-200 nucleotides, more preferably 15-100 nucleotides.

In preferred embodiments, the 5 '-UTR is a DNAH 25' -UTR sequence or a KOZAK sequence;

in a preferred embodiment, the KOZAK sequence is as shown in SEQ ID NO. 3:

5’-GGCTAGCGCCGCCACC-3’(SEQ ID NO.3)。

in a preferred embodiment, the DNAH 25' -UTR sequence is as shown in SEQ ID No. 4:

5’-GAGACCCAAGCTGGCTAGCGGGAGAAAGCTTACC-3’(SEQ ID NO.4)。

in a preferred embodiment, the 3' -poly A sequence is preferably 60 to 120A, more preferably 80 to 110A, and still more preferably 100A.

In a preferred embodiment, the 3 ' -UTR comprises a beta-globin 3 ' -UTR sequence or a hemoglobin HBA23 ' -UTR sequence.

In a preferred embodiment, the sequence of the haemoglobin HBA 23' -UTR is as shown in SEQ ID NO. 5:

5’-GCTGGAGCCTCGGTAGCCGTTCCTCCTGCCCGCTGGGCCTCCCAACGGGCCCTCCTCCCCTCCTTGCACCGGCCCTTCCTGGTCTTTGAATAAAGTCTGAGTGGGCAGC-3’(SEQ ID NO.5)。

in a preferred embodiment, the optimized RVG mRNA has the sequence shown in SEQ ID No. 2:

5’-GGGAGACCCAAGCUGGCUAGCGUUUAAACUUAAGCUUGGUACCGAGCUCGGAUCCACUAGUCCAGUGUGGUGGAAUUCGGGAGAAAGCUUACCAUGAUUCCUCAGGCUCUGCUGUUCGUCCCACUGCUGGUCUUCCCACUGUGCUUCGGCAAGUUCCCCAUCUACACUAUUCCUGACAAACUGGGCCCUUGGUCCCCAAUCGACAUCCACCACCUGUCCUGUCCCAACAAUCUGGUGGUGGAGGACGAGGGCUGUACCAAUCUGAGCGGCUUCUCCUACAUGGAGCUGAAGGUGGGCUACAUCUCCGCCAUCAAGGUGAACGGCUUCACAUGUACCGGCGUGGUGACAGAGGCCGAGACAUACACCAACUUCGUGGGCUAUGUGACCACAACCUUCAAGCGGAAGCACUUCAGACCAACCCCUGAUGCCUGUCGGUCCGCCUAUAACUGGAAGAUGGCCGGCGACCCACGGUAUGAGGAGAGCCUGCACAACCCAUACCCCGAUUACCACUGGCUGAGGACAGUGAAGACAACCAAGGAGUCCGUGGUAAUCAUCUCUCCAAGCGUGGCCGAUCUGGACCCAUACGAUAAGUCCCUGCACAGCAGAGUGUUCCCCCGCGGCAAGUGUUCUGGCAUCACAGUGAGCUCCGCCUAUUGCUCUACCAACCACGACUACACCAUCUGGAUGCCUGAGAAUCCAAGACUGGGCACCUCCUGUGACAUCUUUACCAACUCUCGGGGCAAGAGAGCCUCCAAGGGCUCCAAGACAUGUGGCUUCGUGGACGAGAGAGGCCUGUAUAAGUCCCUGAAGGGCGCCUGCAAGCUGAAGCUGUGCGGCGUGCUGGGCCUGAGGCUGAUGGACGGCACCUGGGUGGCCAUCCAGACAUCCAACGAGACCAAGUGGUGCCCUCCUGAUCAGCUGGUGAACCUGCACGACUUUCACAGCGACGAGAUCGAGCACCUGGUGGUGGAGGAGCUGGUGAAGAAGAGAGAGGAGUGCCUGGAUGCCCUGGAGUCCAUCAUGACCACCAAGAGCGUGUCCUUUAGACGGCUGAGCCACCUGAGAAAGCUGGUGCCCGGCUUUGGCAAGGCCUACACCAUCUUCAACAAGACACUGAUGGAGGCCGAUGCCCACUACAAGUCCGUGAGAACCUGGAACGAGAUCAUCCCUAGCAAGGGCUGUCUGAGGGUGGGCGGCAGAUGUCACCCUCACGUGAAUGGCGUGUUCUUUAAUGGCAUCAUCCUGGGCCCAGAUGGCCACGUGCUGAUCCCAGAGAUGCAGUCCUCUCUGCUGCAGCAGCACAUGGAGCUGCUGGAGUCUAGCGUGAUCCCUCUGAUGCACCCACUGGCCGAUCCAAGCACAGUGUUCAAGGACGGCGACGAGGUGGAGGACUUUGUGGAGGUGCACCUGCCAGAUGUGCACAAGCAGGUGUCCGGCGUGGAUCUGGGCCUGCCAAAUUGGGGCAAGGACGUGCUGAUGGGCGCCGGCGUGCUGACCGCCCUGAUGCUGAUGAUCUUCCUGAUGACCUGCUGUAGACGGACAAAUAGAGCCGAGAGCAUCCAGCACUCCCUGGGCGAGACAGGCCGGAAGGUGUCUGUGACCAGCCAGAGUGGACGAGUGAUCUCCUCAUGGGAAUCCUACAAAAGCGGCGGCGAGACCAAACUGUGAGGACUAGUUAUAAGACUGACUAGCCCGAUGGGCCUCCCAACGGGCCCUCCUCCCCUCCUUGCACCGAGAUUAAUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAU-3’(SEQ ID NO.2)。

the invention provides application of the optimized RVG mRNA in preparation of a rabies virus nucleic acid vaccine.

The rabies virus nucleic acid vaccine delivers optimized RVG mRNA synthesized by in vitro transcription to in vivo to generate rabies virus glycoprotein (namely antigen protein), achieves enough protection effect by using a very small dose, and is superior to the existing veterinary rabies vaccine technology in the aspects of safety and effectiveness. It will be appreciated that the vaccine vector may be one commonly used in the art for the preparation of nucleic acid vaccines.

In a preferred embodiment, the vaccine carrier comprises one of a cationic liposome, a cationic protein, a cationic polymer or a cationic lipid nanoparticle, preferably a cationic liposome or a cationic lipid nanoparticle.

In a preferred embodiment, the mass ratio of cationic lipid nanoparticles to optimized RVGmRNA is 10-30:1, preferably 15-25:1, more preferably 20: 1. The mass ratio of cationic lipid nanoparticles to optimized RVG mRNA is typically, but not limited to, 10:1, 15:1, 20:1, 25:1, or 30: 1.

In a preferred embodiment, the mass ratio of cationic liposomes to optimized RVG mRNA is 1-8:1, preferably 1-4:1, more preferably 2: 1. The mass ratio of cationic liposomes to optimized RVG mRNA is typically, but not limited to, 1:1, 3:1, 5:1, 7:1, or 8: 1.

In a preferred embodiment, the vaccine carrier is a cationic lipid nanoparticle comprising, in mole percent, 20-50% protonatable cationic lipid, 20-50% structural lipid, 5-20% helper lipid and 1-5% surfactant, wherein the mole content of protonatable cationic lipid, structural lipid, helper lipid and surfactant add up to 100%. It is noted that the protonatable cationic lipid is typically, but not limited to, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by mole; structural lipids are typically, but not limited to, 20%, 25%, 30%, 35%, 40%, 45% or 50%; helper lipids are typically, but not limited to, 5%, 10%, 15% or 20%; the surfactant is typically, but not limited to, 1%, 2%, 3%, 4%, or 5%.

In preferred embodiments, the protonatable cationic lipid comprises Dlin-MC3-DMA, Dlin-KC2-DMA, DODMA, c12-200 or DlinDMA, preferably Dlin-MC 3-DMA.

In a preferred embodiment, the structural lipid comprises cholesterol, cholesterol esters, steroid hormones, steroid vitamins or bile acids, preferably cholesterol.

In a preferred embodiment, the helper lipid comprises DSPC, DOPE, DOPC or DOPS, preferably DSPC. It should be noted that DOPE is named 1, 2-dioleoyl-sn-glycerol-3-phosphoethanomine as dioleoyl phosphatidylethanolamine; DOPC is named as 1, 2-dioleoyl-sn-glycerol-3-phosphocholine with the Chinese name of dioleoyl lecithin and cholestrol as cholesterol; DSPC is distearoylphosphatidylcholine; DOPS dioleoyl phosphatidylserine.

In a preferred embodiment, the surfactant comprises PEG-DMG or PEG-DSPE, preferably PEG-DMG; it should be noted that PEG-DMG is a polyethylene glycol (PEG) derivative of 1, 2-dimyristate glyceride, PEG length is 2000 or 5000, preferably 2000; PEG-DSPE is a polyethylene glycol (PEG) derivative of distearoylphosphatidylethanolamine, the PEG being 2000 or 5000, preferably 2000, in length.

In a preferred embodiment, the administration of the rabies virus nucleic acid vaccine comprises intravenous, intramuscular or intradermal injection, preferably intramuscular injection.

The invention provides a preparation method of the rabies virus nucleic acid vaccine, and a vaccine vector is mixed with the optimized RVG mRNA provided by the invention to obtain the rabies virus nucleic acid vaccine. The method is simple and easy to operate, and greatly reduces the production cost.

In a preferred embodiment, the vaccine vector is a cationic lipid nanoparticle in the rabies virus nucleic acid vaccine provided by the invention, and the preparation method of the rabies virus nucleic acid vaccine comprises the following steps:

(c) and (c) uniformly mixing the organic phase obtained in the step (a) and the water phase obtained in the step (b) to obtain a mixed solution, and replacing a solvent in the mixed solution to obtain a buffer solution to obtain the rabies virus nucleic acid vaccine. It is understood that the solvent in (c) refers to the solvent in the organic phase and the aqueous phase, and the buffer may be a buffer commonly used in the art, preferably a PBS solution with pH value of 7-8.

In a preferred embodiment, the organic solution comprises absolute ethanol, tetrahydrofuran, acetone or DMSO, preferably absolute ethanol. The effect of absolute ethyl alcohol is best.

In a preferred embodiment, the total concentration of the protonatable cationic lipid, structural lipid, helper lipid, and surfactant in the organic phase is from 5 to 7 mg/ml.

In a preferred embodiment, the optimal RVG mRNA concentration in the aqueous phase is between 0.8 and 1.2 mg/ml.

In a preferred embodiment, the volume ratio of the organic phase to the aqueous phase is 1: 2-4.

In a preferred embodiment, the mixing is performed using a microfluidic device with a flow rate in the range of 6-24ml/min, preferably 12.0 ml/min.

In a preferred embodiment, replacing the solvent in the mixture with a buffer comprises: the mixture was diluted 50-100 times with buffer and concentrated. It should be noted that, as the solvent in the mixture, a method conventional in the art for displacing a buffer, such as tangential flow filtration, can be used. Finally, the concentration of the obtained rabies virus nucleic acid vaccine is adjusted to the concentration which is conventional in the field.

In a preferred embodiment, the preparation method further comprises a process of preparing the liquid rabies virus nucleic acid vaccine into a freeze-dried preparation. The freeze-dried preparation is beneficial to prolonging the effective period of the product.

In a preferred embodiment, 5-30 w/v% of pharmaceutically acceptable freeze-drying protective agent is added into the rabies virus nucleic acid vaccine to obtain a preparation to be freeze-dried, and the preparation to be freeze-dried is freeze-dried to obtain a freeze-dried preparation. The lyoprotectant may be a lyoprotectant commonly used in the art, but is not particularly limited in the present application, and is preferably sucrose or trehalose.

In a preferred embodiment, the formulation to be lyophilized further comprises 0.005-0.05 w/v% of a pharmaceutically acceptable surfactant. The surfactant may be a surfactant commonly used in the art, and is not particularly limited in this application, and preferably tween 20 or tween 80.

In a preferred embodiment, the lyophilization process comprises: under the condition that the vacuum degree is 20-80 μ bar, the temperature is kept for 1-8h at-40 ℃ to-60 ℃, 10-30h at-30 ℃ to-50 ℃ and 10-30h at 4 ℃ to 20 ℃ in sequence.

The invention is further illustrated by the following specific examples, which, however, are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.

Example 1 preparation of rabies virus nucleic acid vaccine

mRNA of SEQ ID NO.2 was dissolved in citrate buffer of pH4, and the concentration was adjusted to 0.1mg/ml to obtain an aqueous phase.

The formulation proportions Dlin-MC3-DMA, cholesterol, DSPC and PEG-DMG were dissolved in absolute ethanol and the total lipid concentration was adjusted to 6mg/ml to give an organic phase.

The organic phase was mixed with the aqueous phase in a volume ratio of 1:3 using a microfluidic device. The flow rate for mixing was 12.0ml/min using a microfluidic device.

The mixed solution is immediately diluted by 50-100 times by PBS (phosphate buffer solution) with pH7.4, ethanol in the solution is removed by Tangential Flow Filtration (TFF), and the solution is concentrated to the concentration of mRNA (messenger ribonucleic acid) of about 100 mu g/ml, so that the lipid nanoparticles wrapping the mRNA, namely the rabies virus nucleic acid vaccine, are obtained.

EXAMPLE 2 lyophilized preparation

The rabies virus nucleic acid vaccine in example 1 is prepared into a freeze-dried preparation, and freeze-drying protective agents of sucrose and surfactant Tween 20 are added, and the process comprises prefreezing, primary freeze-drying and secondary freeze-drying: the prefreezing temperature was-50 ℃ and the temperature was maintained for 5 hours. The temperature of the first freeze-drying is-40 ℃ for 24 hours, the temperature of the second freeze-drying is 10 ℃ for 17 hours, and the vacuum degree in the freeze-drying process is 40 mu bar.

Example 3 sequence optimization of RVG mRNA

The sequence optimization scheme for the RVG mRNA in this example is shown in table 1, specifically as follows:

the RVG-A mRNA sequence key elements are the open reading frame nucleotide (called 'natural sequence' in Table 1 and shown as SEQ ID NO. 6) of coding G protein of DNAH 25 'UTR and CTN-1 strain, HBA 23' UTR and polyA sequence and subsequent elements (including 64 poly A, 36 poly C and histone stem-loop structure, refer to Curevec rabies virus mRNA vaccine patent (CN 105517569A)).

The RVG-B mRNA and RVG-C mRNA are identical to the non-coding region (UTR) part of the RVG-A mRNA, but optimized sequences are used in the ORF part (respectively corresponding to 'optimized ORF-1' and 'optimized ORF-2' in the table 1), and the protein sequences finally translated from the 3 ORFs are identical and are the G protein of the CTN-1 strain, and are shown as SEQ NO.7 in particular.

RVG-D mRNA is based on the sequence of RVG-C mRNA and has 100 polyadenylic acids substituted for polyA and subsequent element portions.

TABLE 1

The RVG-A mRNA, the RVG-B mRNA, the RVG-C mRNA and the RVG-DmRNA prepared by the in vitro transcription process are respectively transfected into HEK293 cells. First, adopt 4X 10⁵HEK293 cells were plated at a density of one cell/ml and transfected at approximately 80% cell confluence after 24 hours. Transfection system in HEK293 cells added to 1 well of 6-well plates for transfection included 2. mu.g mRNA and the transfection reagent Lipofectamine MessageMax (ThermoFisher scientific), with the specific transfection protocol being performed according to the transfection reagent product instructions. HEK293 cells transfected 24 hours were immunolabeled with rabies virus G protein antibody, and then the amount of G protein expression was detected using a flow cytometer. Fluorescein mRNA (Luc mRNA) transfected cells served as negative control. As shown in FIG. 1, it can be seen from the results shown in the figure that the expression amount of G protein in the cells transfected by RVG-B mRNA and RVG-C mRNA is higher than that in the RVG-A transfection group, it can be seen that the protein expression amount can be increased by optimizing ORF codon, and the G protein content in the cells transfected by RVG-D mRNA is much higher than that in the RVG-C transfection group, and it can be seen that 100A can increase the expression amount of the target protein more than that in the cells transfected by 64A +36C + histidine stem loop under the condition that other elements are not changed. The RVG-DmRNA is mRNA with a sequence of SEQ ID NO.2 provided by the invention.

Note that the "native sequence" in Table 1 is identical to GenBank JN 234418.1:

5’-ATGATTCCTCAAGCTCTGTTGTTTGTACCTCTTCTGGTTTTTCCATTGTGTTTCGGGAAATTCCCCATTTACACGATACCAGACAAACTCGGCCCCTGGAGTCCCATCGATATACATCACCTCAGCTGTCCGAACAATCTGGTTGTGGAGGACGAAGGATGTACCAATCTGTCAGGATTCTCATACATGGAGCTTAAAGTAGGATATATTTCGGCCATAAAGGTGAACGGGTTCACTTGTACGGGTGTGGTAACGGAAGCAGAAACCTACACTAACTTTGTCGGTTATGTCACCACCACGTTTAAGAGAAAGCACTTCCGACCAACACCGGATGCATGCAGATCAGCATACAATTGGAAGATGGCAGGTGACCCCAGATATGAAGAGTCTCTGCACAATCCCTATCCTGATTATCATTGGCTCCGGACTGTAAAAACCACCAAAGAGTCTGTTGTTATCATATCTCCAAGTGTGGCAGACTTAGACCCGTACGATAAATCACTTCATTCGAGAGTTTTTCCTAGAGGAAAATGCTCAGGAATAACGGTGTCTTCTGCCTACTGCTCTACCAACCATGATTATACCATCTGGATGCCTGAAAATCCTAGACTGGGGACCTCTTGTGATATTTTCACCAACAGCAGAGGGAAGAGAGCATCCAAAGGGAGCAAGACCTGTGGATTTGTGGATGAGAGAGGCTTGTACAAATCTCTAAAAGGAGCATGCAAACTGAAGCTGTGTGGAGTTCTTGGACTTAGGCTTATGGACGGAACCTGGGTCGCGATTCAGACATCAAACGAGACCAAGTGGTGCCCTCCTGATCAACTAGTGAATCTACATGACTTTCATTCAGATGAGATTGAACATCTTGTTGTGGAGGAGTTGGTTAAGAAGAGGGAGGAGTGTCTAGATGCACTGGAGTCCATCATGACCACCAAGTCCGTGAGTTTCAGACGTCTCAGTCACTTGAGGAAGCTTGTGCCTGGATTTGGAAAAGCATACACCATATTCAACAAGACCTTAATGGAGGCTGATGCTCACTACAAATCGGTCCGAACTTGGAATGAGATCATCCCCTCGAAAGGGTGTTTAAGAGTCGGGGGGAGATGTCATCCTCATGTGAACGGAGTATTTTTCAATGGTATCATCCTAGGCCCTGACGGCCATGTCTTAATCCCGGAAATGCAGTCATCCCTCCTCCAGCAGCATATGGAGTTGTTGGAATCCTCGGTCATCCCCTTAATGCATCCCTTGGCAGATCCATCAACGGTTTTTAAAGATGGTGACGAGGTGGAGGATTTTGTTGAGGTTCACCTTCCAGATGTGCATAAGCAGGTCTCAGGGGTTGATCTCGGTCTCCCAAACTGGGGGAAGGATGTGTTGATGGGCGCAGGCGTTTTGACGGCACTGATGTTGATGATTTTCCTAATGACGTGTTGCCGAAGGACTAATAGAGCAGAATCAATACAACACAGTCTTGGAGAGACAGGGAGGAAAGTGTCGGTGACCTCCCAAAGCGGGAGGGTCATATCTTCATGGGAGTCATATAAAAGCGGAGGTGAGACCAAGCTGTAA-3’(SEQ IDNO.6)。

the G protein of the CTN-1 strain is similar to that of GenBank ACR 39382.1:

MIPQALLFVPLLVFPLCFGKFPIYTIPDKLGPWSPIDIHHLSCPNNLVVEDEGCTNLSGFSYMELKVGYISAIKVNGFTCTGVVTEAETYTNFVGYVTTTFKRKHFRPTPDACRSAYNWKMAGDPRYEESLHNPYPDYHWLRTVKTTKESVVIISPSVADLDPYDKSLHSRVFPRGKCSGITVSSAYCSTNHDYTIWMPENPRLGTSCDIFTNSRGKRASKGSKTCGFVDERGLYKSLKGACKLKLCGVLGLRLMDGTWVAIQTSNETKWCPPDQLVNLHDFHSDEIEHLVVEELVKKREECLDALESIMTTKSVSFRRLSHLRKLVPGFGKAYTIFNKTLMEADAHYKSVRTWNEIIPSKGCLRVGGRCHPHVNGVFFNGIILGPDGHVLIPEMQSSLLQQHMELLESSVIPLMHPLADPSTVFKDGDEVEDFVEVHLPDVHKQVSGVDLGLPNWGKDVLMGAGVLTALMLMIFLMTCCRRTNRAESIQHSLGETGRKVSVTSQSGRVISSWESYKSGGETKL(SEQ NO.7)。

EXAMPLE 4 optimization of vaccine vectors

The efficiency of delivering mRNA encoding a luciferase gene (RVG-DmRNA in example 3) in mice was tested by in vivo fluorescence imaging technology using luciferase as a reporter gene to study the formulation of various vaccine vectors (as shown in Table 2 below, "MC 3" means Dlin-MC3-DMA, "+"; luciferase expression in mice was detected by a small animal in vivo fluorescence imaging system after administration) and the physicochemical indices of various complex formulations (see example 1 for the preparation method) were examined, and the results are shown in Table 2. Through research, the improvement of the lipid-to-mRNA mass ratio is beneficial to increasing the encapsulation rate of mRNA in lipid nanoparticles so as to enable the mRNA to have higher stability, and in addition, the moderate improvement of the content of polyethylene glycol (PEG) in the formula is beneficial to improving the expression efficiency of the mRNA in vivo. Therefore, factors such as mRNA encapsulation efficiency, mRNA in-vivo delivery efficiency and the like are comprehensively considered, and the No.4 formula is selected for the subsequent research of the mRNA rabies vaccine.

TABLE 2

EXAMPLE 5 Effect of different modes of administration

Luciferase mRNA was encapsulated by the formulation No.4 of example 4 and administered to mice by different routes of administration (intravenous, intramuscular, and intradermal) 2 hours later, and the expression of luciferase gene was detected at different tissue sites of the mice, respectively, using a fluorescence in vivo imaging technique. The results are shown in fig. 2 (in the figure, i.v.: intravenous injection, i.m.: intramuscular injection, i.d.: intradermal injection), indicating that the nucleic acid vaccine provided by the present invention can deliver mRNA to mice through various administration routes. The leg intramuscular injection delivery effect of the mouse is high, and factors such as administration difficulty, drug development difficulty, patient feeling and the like are considered, so that the intramuscular injection administration is finally selected as the optimal administration mode for the development of the subsequent rabies vaccine.

Example 6 neutralizing antibody Titers assay

The RVG-D mRNA in example 3 is selected as mRNA for mouse immunization experiment, and vaccine vectors are respectively selected as follows: the cationic lipid nanoparticles were prepared using the formulation No.4 in example 4, and the commercial reagent used in the preparation of the cationic liposome preparation using the corresponding commercial reagent as a positive control was lipofectamine2000, and in the preparation, referring to the relevant product instructions, mRNA was diluted to 0.1mg/ml using OptiMEM, and then the lipofectamine2000 reagent was prepared in a ratio of lipofectamine2000/mRNA (v/w) ═ 2:1 and diluted to the same volume as the mRNA diluent using OptiMEM, and the two were mixed slowly and left to stand at room temperature for 15min for mouse administration experiment, and each mouse was injected at an administration amount of 5 μ g, and the injection volume was 100 μ l/mouse. The commercial vaccine is inactivated whole virus vaccine (rebick) as positive control (more than or equal to 10)^6.3FAID₅₀Per ml, administration volume 100 μ l/mouse), protamine formulations were prepared according to the prior art protamine-delivered mRNA method (protamine/mRNA (w/w) ═ 2:1, injected per mouse at 5 μ g dose, injection volume 100 μ l/mouse. ) And the negative control is equal volume of normal saline injection. The results of detecting the neutralizing antibody titer against rabies virus in the mouse serum 14 days after one-time administration of each of the above vaccine preparations are shown in the following table 3:

the results in the table show that the cationic liposome preparation and the lipid nanoparticle preparation are induced to generate neutralizing antibody titer which is far higher than that of the commercially available rabies vaccine after single injection, and experiments show that the protamine preparation cannot induce effective neutralizing antibody under the administration dosage, which indicates that the technology of the invention is superior to the prior art.

Example 7 animal experiments

The rabies virus nucleic acid vaccine prepared by the formula No.4 in the example 4 is used, and the mRNA adopts the RVG-D mR in the example 3And (4) NA. The prepared vaccine formulation was tested for concentration and finally concentrated for target animals: in the immunization experiment of beagle dogs, the dosage is 20 mug/dog and the dosage volume is 500 mug/dog. The commercial vaccine is inactivated whole virus vaccine (rebick) as positive control (more than or equal to 10)^6.3FAID₅₀Per ml, administration volume 1 ml/tube), negative control was an equal volume of saline injection. The results of the change of the neutralizing antibody titer in beagle dogs after one administration are shown in fig. 3, wherein RNA001 is the nucleic acid vaccine provided by the present invention. As can be seen from the figure, the nucleic acid vaccine provided by the invention can induce higher neutralizing antibody titer compared with the commercial whole virus vaccine after 6 months of detection after administration, and can be always above the marked line within 6 months.

EXAMPLE 8 Freeze drying Process

In order to realize long-term storage of the nucleic acid vaccine preparation, the nucleic acid vaccine provided by the invention (the nucleic acid vaccine prepared by the formula No.4 in the example 4) is developed into a freeze-dried preparation so as to realize long-term storage at low temperature. The biggest difficulty of the freeze-dried preparation of the nano-particles is that the freeze-drying process can affect the quality of the nano-particles, so that the physicochemical properties and the drug effect of the freeze-dried preparation after rehydration are different from those of a sample before freeze-drying. Therefore, in order to reduce the influence of the freeze-drying process on the physicochemical and drug effects of the nucleic acid vaccine, a freeze-drying prescription and a freeze-drying process are independently developed, the specific process refers to example 2, and the change of the drug effects of the nucleic acid vaccine before and after freeze-drying is verified through animal experiments, and the result is shown in fig. 4. As can be seen from the figure, the drug effects of the nucleic acid vaccine before and after freeze-drying are not obviously different, in addition, the particle size of the nucleic acid vaccine after freeze-drying and rehydration is increased by about 20-60nm compared with that before freeze-drying, and the mRNA entrapment rate is reduced by about 2% -15%, which indicates that the development of the freeze-drying process is successful.

While particular embodiments of the present invention have been illustrated and described, it would be obvious that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.

SEQUENCE LISTING

<110> Zhuhai livan der Biotechnology Ltd

<120> an mRNA rabies vaccine

<160>7

<170>PatentIn version 3.5

<210>1

<211>1575

<212>DNA

<213> Artificial sequence

<400>1

atgattcctc aggctctgct gttcgtccca ctgctggtct tcccactgtg cttcggcaag 60

ttccccatct acactattcc tgacaaactg ggcccttggt ccccaatcga catccaccac 120

ctgtcctgtc ccaacaatct ggtggtggag gacgagggct gtaccaatct gagcggcttc 180

tcctacatgg agctgaaggt gggctacatc tccgccatca aggtgaacgg cttcacatgt 240

accggcgtgg tgacagaggc cgagacatac accaacttcg tgggctatgt gaccacaacc 300

ttcaagcgga agcacttcag accaacccct gatgcctgtc ggtccgccta taactggaag 360

atggccggcg acccacggta tgaggagagc ctgcacaacc cataccccga ttaccactgg 420

ctgaggacag tgaagacaac caaggagtcc gtggtaatca tctctccaag cgtggccgat 480

ctggacccat acgataagtc cctgcacagc agagtgttcc cccgcggcaa gtgttctggc 540

atcacagtga gctccgccta ttgctctacc aaccacgact acaccatctg gatgcctgag 600

aatccaagac tgggcacctc ctgtgacatc tttaccaact ctcggggcaa gagagcctcc 660

aagggctcca agacatgtgg cttcgtggac gagagaggcc tgtataagtc cctgaagggc 720

gcctgcaagc tgaagctgtg cggcgtgctg ggcctgaggc tgatggacgg cacctgggtg 780

gccatccaga catccaacga gaccaagtgg tgccctcctg atcagctggt gaacctgcac 840

gactttcaca gcgacgagat cgagcacctg gtggtggagg agctggtgaa gaagagagag 900

gagtgcctgg atgccctgga gtccatcatg accaccaaga gcgtgtcctt tagacggctg 960

agccacctga gaaagctggt gcccggcttt ggcaaggcct acaccatctt caacaagaca 1020

ctgatggagg ccgatgccca ctacaagtcc gtgagaacct ggaacgagat catccctagc 1080

aagggctgtc tgagggtggg cggcagatgt caccctcacg tgaatggcgt gttctttaat 1140

ggcatcatcc tgggcccaga tggccacgtg ctgatcccag agatgcagtc ctctctgctg 1200

cagcagcaca tggagctgct ggagtctagc gtgatccctc tgatgcaccc actggccgat 1260

ccaagcacag tgttcaagga cggcgacgag gtggaggact ttgtggaggtgcacctgcca 1320

gatgtgcaca agcaggtgtc cggcgtggat ctgggcctgc caaattgggg caaggacgtg 1380

ctgatgggcg ccggcgtgct gaccgccctg atgctgatga tcttcctgat gacctgctgt 1440

agacggacaa atagagccga gagcatccag cactccctgg gcgagacagg ccggaaggtg 1500

tctgtgacca gccagagtgg acgagtgatc tcctcatggg aatcctacaa aagcggcggc 1560

gagaccaaac tgtga 1575

<210>2

<211>1843

<212>RNA

<213> Artificial sequence

<400>2

gggagaccca agcuggcuag cguuuaaacu uaagcuuggu accgagcucg gauccacuag 60

uccagugugg uggaauucgg gagaaagcuu accaugauuc cucaggcucu gcuguucguc 120

ccacugcugg ucuucccacu gugcuucggc aaguucccca ucuacacuau uccugacaaa 180

cugggcccuu gguccccaau cgacauccac caccuguccu gucccaacaa ucugguggug 240

gaggacgagg gcuguaccaa ucugagcggc uucuccuaca uggagcugaa ggugggcuac 300

aucuccgcca ucaaggugaa cggcuucaca uguaccggcg uggugacaga ggccgagaca 360

uacaccaacu ucgugggcua ugugaccaca accuucaagc ggaagcacuu cagaccaacc 420

ccugaugccu gucgguccgc cuauaacugg aagauggccg gcgacccacg guaugaggag 480

agccugcaca acccauaccc cgauuaccac uggcugagga cagugaagac aaccaaggag 540

uccgugguaa ucaucucucc aagcguggcc gaucuggacc cauacgauaa gucccugcac 600

agcagagugu ucccccgcgg caaguguucu ggcaucacag ugagcuccgc cuauugcucu 660

accaaccacg acuacaccau cuggaugccu gagaauccaa gacugggcac cuccugugac 720

aucuuuacca acucucgggg caagagagcc uccaagggcu ccaagacaug uggcuucgug 780

gacgagagag gccuguauaa gucccugaag ggcgccugca agcugaagcu gugcggcgug 840

cugggccuga ggcugaugga cggcaccugg guggccaucc agacauccaa cgagaccaag 900

uggugcccuc cugaucagcu ggugaaccug cacgacuuuc acagcgacga gaucgagcac 960

cugguggugg aggagcuggu gaagaagaga gaggagugcc uggaugcccu ggaguccauc 1020

augaccacca agagcguguc cuuuagacgg cugagccacc ugagaaagcu ggugcccggc 1080

uuuggcaagg ccuacaccau cuucaacaag acacugaugg aggccgaugc ccacuacaag 1140

uccgugagaa ccuggaacga gaucaucccu agcaagggcu gucugagggu gggcggcaga 1200

ugucacccuc acgugaaugg cguguucuuu aauggcauca uccugggccc agauggccac 1260

gugcugaucc cagagaugca guccucucug cugcagcagc acauggagcu gcuggagucu 1320

agcgugaucc cucugaugca cccacuggcc gauccaagca caguguucaa ggacggcgac 1380

gagguggagg acuuugugga ggugcaccug ccagaugugc acaagcaggu guccggcgug 1440

gaucugggcc ugccaaauug gggcaaggac gugcugaugg gcgccggcgu gcugaccgcc 1500

cugaugcuga ugaucuuccu gaugaccugc uguagacgga caaauagagc cgagagcauc 1560

cagcacuccc ugggcgagac aggccggaag gugucuguga ccagccagag uggacgagug 1620

aucuccucau gggaauccua caaaagcggc ggcgagacca aacugugagg acuaguuaua 1680

agacugacua gcccgauggg ccucccaacg ggcccuccuc cccuccuugc accgagauua 1740

auaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1800

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aau 1843

<210>3

<211>16

<212>DNA

<213> Artificial sequence

<400>3

ggctagcgcc gccacc 16

<210>4

<211>34

<212>DNA

<213> Artificial sequence

<400>4

gagacccaag ctggctagcg ggagaaagct tacc 34

<210>5

<211>109

<212>DNA

<213> Artificial sequence

<400>5

gctggagcct cggtagccgt tcctcctgcc cgctgggcct cccaacgggc cctcctcccc 60

tccttgcacc ggcccttcct ggtctttgaa taaagtctga gtgggcagc 109

<210>6

<211>1575

<212>DNA

<213> CTN-1 Strain

<400>6

atgattcctc aagctctgtt gtttgtacct cttctggttt ttccattgtg tttcgggaaa 60

ttccccattt acacgatacc agacaaactc ggcccctgga gtcccatcga tatacatcac 120

ctcagctgtc cgaacaatct ggttgtggag gacgaaggat gtaccaatct gtcaggattc 180

tcatacatgg agcttaaagt aggatatatt tcggccataa aggtgaacgg gttcacttgt 240

acgggtgtgg taacggaagc agaaacctac actaactttg tcggttatgt caccaccacg 300

tttaagagaa agcacttccg accaacaccg gatgcatgca gatcagcata caattggaag 360

atggcaggtg accccagata tgaagagtct ctgcacaatc cctatcctga ttatcattgg 420

ctccggactg taaaaaccac caaagagtct gttgttatca tatctccaag tgtggcagac 480

ttagacccgt acgataaatc acttcattcg agagtttttc ctagaggaaa atgctcagga 540

ataacggtgt cttctgccta ctgctctacc aaccatgatt ataccatctg gatgcctgaa 600

aatcctagac tggggacctc ttgtgatatt ttcaccaaca gcagagggaa gagagcatcc 660

aaagggagca agacctgtgg atttgtggat gagagaggct tgtacaaatc tctaaaagga 720

gcatgcaaac tgaagctgtg tggagttctt ggacttaggc ttatggacgg aacctgggtc 780

gcgattcaga catcaaacga gaccaagtgg tgccctcctg atcaactagt gaatctacat 840

gactttcatt cagatgagat tgaacatctt gttgtggagg agttggttaa gaagagggag 900

gagtgtctag atgcactgga gtccatcatg accaccaagt ccgtgagttt cagacgtctc 960

agtcacttga ggaagcttgt gcctggattt ggaaaagcat acaccatatt caacaagacc 1020

ttaatggagg ctgatgctca ctacaaatcg gtccgaactt ggaatgagat catcccctcg 1080

aaagggtgtt taagagtcgg ggggagatgt catcctcatg tgaacggagt atttttcaat 1140

ggtatcatcc taggccctga cggccatgtc ttaatcccgg aaatgcagtc atccctcctc 1200

cagcagcata tggagttgtt ggaatcctcg gtcatcccct taatgcatcc cttggcagat 1260

ccatcaacgg tttttaaaga tggtgacgag gtggaggatt ttgttgaggt tcaccttcca 1320

gatgtgcata agcaggtctc aggggttgat ctcggtctcc caaactgggg gaaggatgtg 1380

ttgatgggcg caggcgtttt gacggcactg atgttgatga ttttcctaat gacgtgttgc 1440

cgaaggacta atagagcaga atcaatacaa cacagtcttg gagagacagg gaggaaagtg 1500

tcggtgacct cccaaagcgg gagggtcata tcttcatggg agtcatataa aagcggaggt 1560

gagaccaagc tgtaa 1575

<210>7

<211>524

<212>PRT

<213> CTN-1 Strain

<400>7

Met Ile Pro Gln Ala Leu Leu Phe Val Pro Leu Leu Val Phe Pro Leu

1 5 10 15

Cys Phe Gly Lys Phe Pro Ile Tyr Thr Ile Pro Asp Lys Leu Gly Pro

20 25 30

Trp Ser Pro Ile Asp Ile His His Leu Ser Cys Pro Asn Asn Leu Val

35 40 45

Val Glu Asp Glu Gly Cys Thr Asn Leu Ser Gly Phe Ser Tyr Met Glu

50 55 60

Leu Lys Val Gly Tyr Ile Ser Ala Ile Lys Val Asn Gly Phe Thr Cys

65 70 75 80

Thr Gly Val Val Thr Glu Ala Glu Thr Tyr Thr Asn Phe Val Gly Tyr

85 90 95

Val Thr Thr Thr Phe Lys Arg Lys His Phe Arg Pro Thr Pro Asp Ala

100 105 110

Cys Arg Ser Ala Tyr Asn Trp Lys Met Ala Gly Asp Pro Arg Tyr Glu

115 120 125

Glu Ser Leu His Asn Pro Tyr Pro Asp Tyr His Trp Leu Arg Thr Val

130 135 140

Lys Thr Thr Lys Glu Ser Val Val Ile Ile Ser Pro Ser Val Ala Asp

145 150 155 160

Leu Asp Pro Tyr Asp Lys Ser Leu His Ser Arg Val Phe Pro Arg Gly

165 170 175

Lys Cys Ser Gly Ile Thr Val Ser Ser Ala Tyr Cys Ser Thr Asn His

180 185 190

Asp Tyr Thr Ile Trp Met Pro Glu Asn Pro Arg Leu Gly Thr Ser Cys

195 200 205

Asp Ile Phe Thr Asn Ser Arg Gly Lys Arg Ala Ser Lys Gly Ser Lys

210 215 220

Thr Cys Gly Phe Val Asp Glu Arg Gly Leu Tyr Lys Ser Leu Lys Gly

225 230 235 240

Ala Cys Lys Leu Lys Leu Cys Gly Val Leu Gly Leu Arg Leu Met Asp

245 250 255

Gly Thr Trp Val Ala Ile Gln Thr Ser Asn Glu Thr Lys Trp Cys Pro

260 265 270

Pro Asp Gln Leu Val Asn Leu His Asp Phe His Ser Asp Glu Ile Glu

275 280 285

His Leu Val Val Glu Glu Leu Val Lys Lys Arg Glu Glu Cys Leu Asp

290 295 300

Ala Leu Glu Ser Ile Met Thr Thr Lys Ser Val Ser Phe Arg Arg Leu

305 310 315 320

Ser His Leu Arg Lys Leu Val Pro Gly Phe Gly Lys Ala Tyr Thr Ile

325 330 335

Phe Asn Lys Thr Leu Met Glu Ala Asp Ala His Tyr Lys Ser Val Arg

340 345 350

Thr Trp Asn Glu Ile Ile Pro Ser Lys Gly Cys Leu Arg Val Gly Gly

355 360 365

Arg Cys His Pro His Val Asn Gly Val Phe Phe Asn Gly Ile Ile Leu

370 375 380

Gly Pro Asp Gly His Val Leu Ile Pro Glu Met Gln Ser Ser Leu Leu

385 390 395 400

Gln Gln His Met Glu Leu Leu Glu Ser Ser Val Ile Pro Leu Met His

405 410 415

Pro Leu Ala Asp Pro Ser Thr Val Phe Lys Asp Gly Asp Glu Val Glu

420 425 430

Asp Phe Val Glu Val His Leu Pro Asp Val His Lys Gln Val Ser Gly

435 440 445

Val Asp Leu Gly Leu Pro Asn Trp Gly Lys Asp Val Leu Met Gly Ala

450 455 460

Gly Val Leu Thr Ala Leu Met Leu Met Ile Phe Leu Met Thr Cys Cys

465 470 475 480

Arg Arg Thr Asn Arg Ala Glu Ser Ile Gln His Ser Leu Gly Glu Thr

485 490 495

Gly Arg Lys Val Ser Val Thr Ser Gln Ser Gly Arg Val Ile Ser Ser

500 505 510

Trp Glu Ser Tyr Lys Ser Gly Gly Glu Thr Lys Leu

515 520

Claims

1. An optimized RVG mRNA, wherein the nucleotide sequence of transcription of said optimized RVG mRNA is shown in SEQ id No. 1.

2. The optimized RVG mRNA of claim 1, wherein the nucleotide sequence for transcribing the optimized RVG mRNA further comprises the following elements: at least one of a 5 '-cap structure, a 5' -UTR, a 3 '-polyadenylation sequence, and a 3' -UTR;

preferably, the 5 '-UTR is a DNAH 25' -UTR sequence or a KOZAK sequence;

preferably, the KOZAK sequence is shown in SEQ ID NO. 3;

preferably, the DNAH 25' -UTR sequence is shown in SEQ ID NO. 4;

preferably, the sequence of the hemoglobin HBA 23' -UTR is shown in SEQ ID NO. 5.

3. The optimized RVG mRNA of claim 2, wherein the sequence of the optimized RVG mRNA is shown as SEQ ID No. 2.

4. Use of the optimized RVG mRNA of any one of claims 1-3 for the preparation of a rabies virus nucleic acid vaccine.

5. A rabies virus nucleic acid vaccine comprising a vaccine vector and the optimized RVG mRNA of any one of claims 1-3.

6. The rabies virus nucleic acid vaccine according to claim 5, wherein the vaccine vector comprises one of cationic liposomes, cationic proteins, cationic polymers or cationic lipid nanoparticles, preferably cationic liposomes or cationic lipid nanoparticles;

7. The rabies virus nucleic acid vaccine according to claim 5 or 6, wherein the vaccine vector is a cationic lipid nanoparticle comprising, in mole percent, 20-50% of the protonatable cationic lipid, 20-50% of the structural lipid, 5-20% of the helper lipid, and 1-5% of the surfactant, wherein the mole contents of the protonatable cationic lipid, the structural lipid, the helper lipid, and the surfactant add up to 100%;

preferably, the surfactant comprises PEG-DMG or PEG-DSPE, preferably PEG-DMG;

8. The method for preparing the rabies virus nucleic acid vaccine according to claim 5, wherein the optimized RVG mRNA according to any one of claims 1-3 is mixed with a vaccine vector to obtain the rabies virus nucleic acid vaccine.

9. The method for preparing the rabies virus nucleic acid vaccine according to claim 8, wherein the vaccine vector is the cationic lipid nanoparticle in the rabies virus nucleic acid vaccine according to claim 7, and the method for preparing the rabies virus nucleic acid vaccine comprises the following steps:

10. The method according to claim 8 or 9, wherein the method further comprises a step of preparing the liquid rabies virus nucleic acid vaccine into a lyophilized preparation;