CN110714009A - Male macrobrachium rosenbergii sex-converted siRNA-IR sequence and application thereof - Google Patents
Male macrobrachium rosenbergii sex-converted siRNA-IR sequence and application thereof Download PDFInfo
- Publication number
- CN110714009A CN110714009A CN201911143098.5A CN201911143098A CN110714009A CN 110714009 A CN110714009 A CN 110714009A CN 201911143098 A CN201911143098 A CN 201911143098A CN 110714009 A CN110714009 A CN 110714009A
- Authority
- CN
- China
- Prior art keywords
- sirna
- macrobrachium rosenbergii
- sequence
- male
- sex
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 241001327110 Macrobrachium rosenbergii Species 0.000 title claims abstract description 49
- 238000002347 injection Methods 0.000 claims abstract description 26
- 239000007924 injection Substances 0.000 claims abstract description 26
- 241000238557 Decapoda Species 0.000 claims abstract description 25
- 238000006243 chemical reaction Methods 0.000 claims abstract description 16
- 238000000520 microinjection Methods 0.000 claims abstract description 7
- 230000001568 sexual effect Effects 0.000 claims abstract description 7
- 238000013518 transcription Methods 0.000 claims description 13
- 230000035897 transcription Effects 0.000 claims description 13
- 238000000034 method Methods 0.000 claims description 11
- 238000000338 in vitro Methods 0.000 claims description 10
- 230000037396 body weight Effects 0.000 claims description 5
- 239000002773 nucleotide Substances 0.000 claims description 4
- 125000003729 nucleotide group Chemical group 0.000 claims description 4
- 108091081021 Sense strand Proteins 0.000 claims description 2
- 230000000692 anti-sense effect Effects 0.000 claims description 2
- 239000012528 membrane Substances 0.000 claims description 2
- 108020004459 Small interfering RNA Proteins 0.000 abstract description 15
- 230000014509 gene expression Effects 0.000 abstract description 11
- 230000009368 gene silencing by RNA Effects 0.000 abstract description 10
- 108090000623 proteins and genes Proteins 0.000 abstract description 10
- 238000005516 engineering process Methods 0.000 abstract description 9
- 230000009466 transformation Effects 0.000 abstract description 8
- 230000032678 sex differentiation Effects 0.000 abstract description 4
- 238000013461 design Methods 0.000 abstract description 3
- 239000012634 fragment Substances 0.000 abstract description 2
- 230000008799 immune stress Effects 0.000 abstract description 2
- 230000004083 survival effect Effects 0.000 abstract description 2
- 108010001127 Insulin Receptor Proteins 0.000 description 14
- 239000000243 solution Substances 0.000 description 13
- 230000001548 androgenic effect Effects 0.000 description 8
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 7
- 238000012228 RNA interference-mediated gene silencing Methods 0.000 description 7
- 238000000137 annealing Methods 0.000 description 7
- 238000011161 development Methods 0.000 description 6
- 210000004907 gland Anatomy 0.000 description 6
- 241000238424 Crustacea Species 0.000 description 5
- 102000003746 Insulin Receptor Human genes 0.000 description 5
- 230000018109 developmental process Effects 0.000 description 5
- 230000002452 interceptive effect Effects 0.000 description 5
- 239000000203 mixture Substances 0.000 description 5
- 239000013505 freshwater Substances 0.000 description 4
- 230000030279 gene silencing Effects 0.000 description 4
- 238000012216 screening Methods 0.000 description 4
- 108020004414 DNA Proteins 0.000 description 3
- 238000012408 PCR amplification Methods 0.000 description 3
- 108010083644 Ribonucleases Proteins 0.000 description 3
- 102000006382 Ribonucleases Human genes 0.000 description 3
- 230000015572 biosynthetic process Effects 0.000 description 3
- 239000003153 chemical reaction reagent Substances 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 230000002608 insulinlike Effects 0.000 description 3
- 230000000877 morphologic effect Effects 0.000 description 3
- 238000003786 synthesis reaction Methods 0.000 description 3
- 210000001550 testis Anatomy 0.000 description 3
- 210000001519 tissue Anatomy 0.000 description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 3
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- 238000011529 RT qPCR Methods 0.000 description 2
- 239000012295 chemical reaction liquid Substances 0.000 description 2
- 239000002552 dosage form Substances 0.000 description 2
- 229940088597 hormone Drugs 0.000 description 2
- 239000005556 hormone Substances 0.000 description 2
- 230000001404 mediated effect Effects 0.000 description 2
- 238000002360 preparation method Methods 0.000 description 2
- 238000003762 quantitative reverse transcription PCR Methods 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- 230000009182 swimming Effects 0.000 description 2
- 102000040650 (ribonucleotides)n+m Human genes 0.000 description 1
- USFZMSVCRYTOJT-UHFFFAOYSA-N Ammonium acetate Chemical compound N.CC(O)=O USFZMSVCRYTOJT-UHFFFAOYSA-N 0.000 description 1
- 239000005695 Ammonium acetate Substances 0.000 description 1
- 241000238421 Arthropoda Species 0.000 description 1
- 241000238097 Callinectes sapidus Species 0.000 description 1
- 102000007260 Deoxyribonuclease I Human genes 0.000 description 1
- 108010008532 Deoxyribonuclease I Proteins 0.000 description 1
- 102000014150 Interferons Human genes 0.000 description 1
- 108010050904 Interferons Proteins 0.000 description 1
- 241000238559 Macrobrachium Species 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 108091034117 Oligonucleotide Proteins 0.000 description 1
- 108700026244 Open Reading Frames Proteins 0.000 description 1
- 241000238057 Pandalidae Species 0.000 description 1
- ISWSIDIOOBJBQZ-UHFFFAOYSA-N Phenol Chemical compound OC1=CC=CC=C1 ISWSIDIOOBJBQZ-UHFFFAOYSA-N 0.000 description 1
- 108010046983 Ribonuclease T1 Proteins 0.000 description 1
- 101710137500 T7 RNA polymerase Proteins 0.000 description 1
- 230000002378 acidificating effect Effects 0.000 description 1
- 239000004480 active ingredient Substances 0.000 description 1
- 229940043376 ammonium acetate Drugs 0.000 description 1
- 235000019257 ammonium acetate Nutrition 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 239000003098 androgen Substances 0.000 description 1
- 229940030486 androgens Drugs 0.000 description 1
- 238000013459 approach Methods 0.000 description 1
- 210000002469 basement membrane Anatomy 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000001413 cellular effect Effects 0.000 description 1
- 230000019522 cellular metabolic process Effects 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000003111 delayed effect Effects 0.000 description 1
- 239000012153 distilled water Substances 0.000 description 1
- 238000001035 drying Methods 0.000 description 1
- 230000002124 endocrine Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 230000004720 fertilization Effects 0.000 description 1
- 230000002401 inhibitory effect Effects 0.000 description 1
- 230000005764 inhibitory process Effects 0.000 description 1
- 230000003993 interaction Effects 0.000 description 1
- 229940079322 interferon Drugs 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 230000020033 male sex differentiation Effects 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 230000013011 mating Effects 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 230000007246 mechanism Effects 0.000 description 1
- 210000004379 membrane Anatomy 0.000 description 1
- 210000000056 organ Anatomy 0.000 description 1
- 230000005305 organ development Effects 0.000 description 1
- 230000021368 organ growth Effects 0.000 description 1
- 230000017448 oviposition Effects 0.000 description 1
- 230000001124 posttranscriptional effect Effects 0.000 description 1
- 239000002244 precipitate Substances 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 230000001850 reproductive effect Effects 0.000 description 1
- 239000003161 ribonuclease inhibitor Substances 0.000 description 1
- 229920006395 saturated elastomer Polymers 0.000 description 1
- 230000008771 sex reversal Effects 0.000 description 1
- 239000004055 small Interfering RNA Substances 0.000 description 1
- 230000021595 spermatogenesis Effects 0.000 description 1
- 230000002194 synthesizing effect Effects 0.000 description 1
- 238000001890 transfection Methods 0.000 description 1
- 230000007704 transition Effects 0.000 description 1
- 238000002054 transplantation Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/033—Rearing or breeding invertebrates; New breeds of invertebrates
- A01K67/0333—Genetically modified invertebrates, e.g. transgenic, polyploid
- A01K67/0337—Genetically modified Arthropods
- A01K67/0338—Genetically modified Crustaceans
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/05—Animals modified by non-integrating nucleic acids, e.g. antisense, RNAi, morpholino, episomal vector, for non-therapeutic purpose
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/70—Invertebrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Environmental Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Animal Behavior & Ethology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Biophysics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses a siRNA-IR sequence for sex transformation of male macrobrachium rosenbergii and application thereof; the siRNA interference technology is utilized to inhibit the expression of IR genes, so that the male Macrobrachium rosenbergii is promoted to generate the sexual transformation, and the pseudo female Macrobrachium rosenbergii is obtained; the invention screens and obtains the IR gene fragment of the Macrobrachium rosenbergii from the Macrobrachium rosenbergii transcriptome, designs and synthesizes siRNA according to the Macrobrachium rosenbergii IR gene sequence, and the siRNA is named as siRNA-IR. Is introduced into the Macrobrachium rosenbergii body by microinjection before sex differentiation stage, and interferes and inhibits the expression of IR gene in the Macrobrachium rosenbergii body, so as to promote the sex transformation of the Macrobrachium rosenbergii. Compared with the dsRNA interference technology, the siRNA technology has smaller injection dosage, can reduce the cost, can effectively reduce the immune stress reaction of the larvae of the macrobrachium rosenbergii in the later period, and improves the survival rate of the pseudo female shrimps.
Description
Technical Field
The invention relates to the field of sex transformation of Macrobrachium rosenbergii (Macrobrachium rosenbergii), in particular to a siRNA-IR sequence for sex transformation of male Macrobrachium rosenbergii and application thereof.
Background
Macrobrachium rosenbergii (Macrobrachium rosenbergii) belongs to Arthropoda, Crustacea, Pandalidae, Macrobrachium, and is a large freshwater prawn. Macrobrachium rosenbergii belongs to tropical and subtropical shrimps, is distributed in fresh water and brackish water areas in Indian ocean and Pacific ocean, is mainly distributed in Asia, especially southeast Asia countries, such as India, Thailand, Burma, Indonesia, Malaysia and the like. The macrobrachium rosenbergii is one of the most important freshwater prawn culture varieties in the world at present.
The Androgenic Gland (AG) is a specific endocrine organ of male crustaceans and was first found in blue crabs (Callinassacidus)[1]. Further studies have found that removal or transplantation of the androgenic gland in the early stages of decapod animal development leads to sex reversal, suggesting that the androgenic gland plays an important role in sex differentiation[2-4]. Furthermore, there is increasing evidence that the androgenic gland plays a critical role in maintaining male sex differentiation and male characteristics[5]. To date, the most intensive study of crustacean sex differentiation genes has been insulin-like androgenic hormones (IAGs). Studies have shown that insulin-like androgenic hormones play a key role in Macrobrachium rosenbergii, especially the generation and development of sperm, primary and secondary sex characteristics[6]. Similarly, Insulin Receptors (IR) and insulin-like androgens have a direct interaction. Studies have shown that silencing of IR by dsRNA interference techniques results in delayed spermatogenesis, with observation of tissue sections showing high numbers of spermatocytes and very low numbers of spermatozoa[9]. Up to now, the sexual transition achieved by RNAi technology has been by dsRNA method. Although the method can interfere and inhibit the expression of the gene, the injection dosage is higher, the required sequence is longer, the synthesis kit is more expensive, and the cost is high. There are also cost factors for this approach to be applied to production practice.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides a male macrobrachium rosenbergii sex-transformed siRNA sequence and application thereof; the siRNA interference technology is utilized to inhibit the expression of IR genes, so that the male Macrobrachium rosenbergii is promoted to generate the sexual transformation, and the pseudo-female shrimp (neo-female) is obtained.
In order to achieve the aim, the invention designs a male Macrobrachium rosenbergii sex-transformed siRNA-IR sequence; the nucleotide sequence of the siRNA-IR sense strand is GGGAGAACAUCACCCUUAAGU, and is shown as SEQ ID NO. 1; the nucleotide sequence of the siRNA-IR antisense chain is ACUUAAGGGUGAUGUUCUCCC, and is shown as SEQ ID NO. 2.
The invention also provides an application of the siRNA-IR sequence in sex conversion of male Macrobrachium rosenbergii into pseudo-female Macrobrachium rosenbergii.
Further, the application method comprises the following steps:
1) obtaining siRNA-IR through in vitro transcription,
2) microinjection is carried out at the joint membrane of the base part of the fifth step, the injected shrimp larvae are later larvae, and the culture is carried out after the injection treatment course is finished until pseudo-female macrobrachium rosenbergii appears; wherein the injection course is once every five days, the injection times are five times, and the concentration dose of each siRNA-IR injection is 0.4-0.7 mug/g body weight.
Preferably, in the step 1), the concentration dose of siRNA-IR injection is 0.5 μ g/g body weight (by concentration measurement screening). The dose at which the optimum injection concentration is obtained is 0.5. mu.g/g body weight).
The invention also provides a male macrobrachium rosenbergii sex transformation kit containing the siRNA-IR sequence.
The principle of the invention is as follows:
RNA interference (RNAi) is a highly specific method of post-transcriptional interference or silencing of cellular gene expression. A significant active ingredient is small interfering rna (sirna), which can inhibit or interfere with the activity of a gene by endogenous synthesis. siRNA can be generated by in vitro transcription. The synthesized siRNA can enter cells by microinjection or transfection. RNAi is capable of transiently silencing or interfering with specific gene expression without genetically modifying the target organism. Microinjection of RNAi has been successfully demonstrated in the laboratory and has been proven to be the most efficient and cost effective method to induce silent gene expression in crustaceans. In crustaceans, RNAi technology is used to interfere or silence a gene, thereby interfering with the function of the gene in embryonic or organ growth and development, cell metabolism and reproductive mechanisms[7]. The function of IAG gene in macrobrachium rosenbergii is revealed through RNAi mediated silencing technology[6]. Injecting dsRNA-IAG in early male development stage of Macrobrachium rosenbergii can cause sex conversion, and obtain male offspring[2,8]。
The invention has the beneficial effects that:
the invention screens and obtains the IR gene segment of the macrobrachium rosenbergii from the transcriptome of the macrobrachium rosenbergii. siRNA is designed and synthesized according to the IR gene sequence of the macrobrachium rosenbergii and is named as siRNA-IR. Is introduced into Macrobrachium rosenbergii by microinjection before sex differentiation stage, and interferes and inhibits the expression of IR gene in Macrobrachium rosenbergii to promote the sexual transformation of Macrobrachium rosenbergii. Compared with the dsRNA interference technology, the siRNA technology has smaller injection dosage, can reduce the cost, can effectively reduce the immune stress reaction of the larvae of the macrobrachium rosenbergii in the later period, and improves the survival rate of the pseudo female shrimps.
Drawings
FIG. 1 is a graph of IR transcript levels in the testis and the androgenic gland of Macrobrachium rosenbergii after different doses of siRNA-IR injection (screening for optimal injection doses);
FIG. 2 is a sectional view of the testis tissue of Macrobrachium rosenbergii at various doses after injection of different doses of siRNA-IR mediated IR intervention;
FIG. 3 is a graph comparing the sexual and morphological characteristics of the ventral surface of Macrobrachium rosenbergii, the second footpad (paw) and the second swimming paw (ventral paw) among male, female and pseudo-female shrimps.
FIG. 4 shows the oviposition shrimp of the pseudo female giant freshwater shrimp after successful fertilization.
Detailed Description
The present invention is described in further detail below with reference to specific examples so as to be understood by those skilled in the art.
Example 1 siRNA screening for interference and inhibition of IR genes
Designing and synthesizing an interference sequence named siRNA-IR according to the sequence of the Macrobrachium rosenbergii IR gene (accession number: FJ 409645); alternative siRNA-IR sequences were designed using on-line siRNA design software (https:// www.invivogen.com/sirnawizard/design. php) (see Table 1). The fragments containing SNP sites and located in non-open reading frames were excluded from the alternative siRNA-IR, and the sequences with too high and too low GC content were removed, and finally Blast analysis was performed and the non-specifically bound sequences were discarded. After obtaining the desired siRNA-IR sequence, four oligo's were designed according to the TaKaRa siRNA in vitro transcription synthesis kit requirements, named oligo 1, oligo 2, oligo 3 and oligo 4 (see Table 1). These four oligo sequences were synthesized by Wuhan Pongzhike biology Inc.
TABLE 1 sequences of siRNA-IR and four oligos
EXAMPLE 2 preparation of siRNA-IR double-stranded Oligo DNA
The synthesized single-stranded Oligo DNA was dissolved in sterilized distilled water to prepare a DNA solution of 100 pmol/. mu.l and an annealing reaction solution of Oligo DNA was prepared according to the compositions shown in tables 2 and 3. The prepared Oligo DNA annealing reaction solution is placed in a PCR amplification instrument, treated at 95 ℃ for 2 minutes, cooled to 25 ℃ over 45 minutes, and then kept at 25 ℃ for 10 minutes. This step enables a stack of single-stranded Oligo DNAs to be annealed to form a double-stranded Oligo DNA. Two sets of Oligo DNAs will eventually be obtained and named Oligo A and Oligo B.
TABLE 2 annealing reaction solution of Oligo A
| Reagent | Dosage form |
| 10X Annealing Buffer | 2μl |
| 100pmol/μl Oligo 1 | 2μl |
| 100pmol/μl Oligo 2 | 2μl |
| Rnase free dH2O | 14μl |
TABLE 3 annealing reaction solution of Oligo B
| Reagent | Dosage form |
| 10X Annealing Buffer | 2μl |
| 100pmol/μl Oligo 3 | 2μl |
| 100pmol/μl Oligo 4 | 2μl |
| Rnase free dH2O | 14μl |
Example 3 siRNA-IR in vitro transcription
RNA in vitro transcription reaction liquid is prepared by the Oligo A and the Oligo B formed by annealing reaction according to the components in the table 4, and the RNA in vitro transcription reaction liquid is slightly centrifuged after being uniformly mixed so as to be collected at the bottom of an EP tube. The prepared transcription reaction solution is placed in a PCR amplification instrument and reacted for 4 hours at 42 ℃. After 4 hours, the transcription reaction solution was taken out, and 2. mu.l of RNase DNase I (5U/. mu.l) and 1. mu.l of RNase T1 (5U/. mu.l) were added to the original reaction tube. After being mixed slightly and evenly, the mixture is put into a PCR amplification instrument and reacts for 2 hours at 37 ℃. After the in vitro transcription is finished,purification of siRNA-IR will be performed. To the in vitro transcription reaction solution, 23. mu.l of acidic phenol/chloroform/isopropanol (25:24:1) saturated with water was added, and the mixture was inverted and mixed at 25 ℃ and centrifuged at 10000rpm for 5 minutes. The upper layer was transferred to another new EP tube, and an equal amount of 5M ammonium acetate (pH5.6) and four times the amount of 99.5% absolute ethanol were added, and after standing at room temperature for 5 minutes, it was centrifuged at 25 ℃ and 15000rpm for 10 minutes. After removing the supernatant, 100. mu.l of 80% absolute ethanol was added, and the mixture was centrifuged at 15000rpm at 25 ℃ for 5 minutes. Removing supernatant, drying, and adding 50 μ l of RNase free dH2And dissolving the precipitate by using O. The purified siRNA-IR was stored in a freezer at-80 ℃.
TABLE 4 preparation of RNA in vitro transcription reaction solution
| Reagent | Amount of the composition used |
| 10X Transcription Buffer | 2μl |
| ATP Solution | 2μl |
| GTP Solution | 2μl |
| CTP Solution | 2μl |
| UTP Solution | 2μl |
| RNase Inhibitor | 2μl |
| T7RNA Polymerase | 4μl |
| RNase free dH2O | 2μl |
| Oligo A | 1μl |
| Oligo B | 1μl |
Example 4 siRNA-IR Interferon dose screening
In order to screen out the optimal interfering dose of siRNA-IR, injection doses of 0.1. mu.g/g, 0.5. mu.g/g, 1.5. mu.g/g and 3.0. mu.g/g were set. Each injection dosage is respectively introduced into male Macrobrachium rosenbergii with the body length of 9.0 +/-0.6 centimeters by means of microinjection. Each injected dose of male macrobrachium rosenbergii was 10 tails. Dissecting Macrobrachium rosenbergii after 24 hours of injection, collecting spermary and androgenesis, extracting total RNA, and quantitatively detecting each injection dosage by using an RT-qPCR method. The results obtained by the RT-qPCR method showed that both 0.1. mu.g/g and 0.5. mu.g/g had the effect of interfering with and inhibiting the expression of the IR gene. However, an injection dose of 0.5. mu.g/g gives better results, which dose maximizes interference and suppresses the expression of the IR gene. FIG. 1 shows that each injected dose acts to suppress and interfere with the expression of the IR gene in the testis and the androgenic gland. In addition, it was found that 0.5. mu.g/g could inhibit and interfere with the development of spermatocyte by observation in tissue section. FIG. 2 shows the effect of different injected doses on spermatocyte development. From this experiment, it was determined that 0.5. mu.g/g was the most effective interfering dose.
Example 5 siRNA-IR Long-term interference
Post-larval stage 10 was given as a bolus injection at 0.5. mu.g/g. Introduction of siRNA-IR into the body was performed by the fifth step at the basal lamina joint. The injection course is once every five days, and the injection times are five times. After five injections were completed, the culture was carried out until false female macrobrachium rosenbergii appeared. After 60 days of cultivation, female shrimps are screened out, and pseudo female shrimps are screened out by utilizing molecular markers. Finally 2 false female shrimps are obtained. Figure 3 shows a comparison of the sexual morphological characteristics of the ventral surfaces, second footage (paw) and second swimming feet (ventral foot) of male, female and pseudo-female shrimps between male, female and pseudo-female shrimps. As a result, it was found that the sex morphological characteristics of the pseudo female shrimp were similar to those of the female shrimp, but the second step (paw) of the pseudo female shrimp was shorter than that of the male shrimp and longer than that of the female shrimp. FIG. 4 shows successful acquisition of fertilized egg-carrying shrimp after mating of pseudofemale shrimp with male shrimp.
Other parts not described in detail are prior art. Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive step according to the embodiments, and the embodiments are within the scope of the present invention.
Reference documents:
1.Cronin LE.Anatomy and histology of the male reproductive system ofCallinectes sapidus Rathbun.Journal of Morphology,1947,81(2):209-239.
2.Aflalo,E.D.,Hoang,T.T.T.,Nguyen,V.H.,Lam,Q.,Nguyen,D.M.,Trinh,Q.S.,Raviv,S.,Sagi,A.,2006.A novel two-step procedure for mass production of all-male populations of the giant freshwater prawn Macrobrachiumrosenbergii.Aquaculture 256,468–478.
3.Manor R,Aflalo ED,Segall C.Androgenic gland implantation promotesgrowth and inhibits vitellogenesis in Cherax quadricarinatus females held inindividual compartments.Invertebrate Reproduction and Development,2004,45(2):151-159.
4.Barki A,Karplus I,Manor R,Sagi A.Intersexuality and behavior incrayfish:the de-masculinization effects of androgenic gland ablation.Hormonesand Behavior,2006,50,322-331.
5.Ventura T,Aflalo ED,Weil S,Kashkush K,Sagi A.Isolation andcharacterization of a female-specific DNA marker in the giant freshwaterprawn Macrobrachium rosenbergii.Heredity,2011b,107(5):456–461.
6.Ventura T,Manor R,Aflalo ED,Weil S,Raviv S,Glazer L,Sagi A.Temporalsilencing of an androgenic gland-specific insulin-like gene affectingphenotypical gender differences and spermatogenesis.Endocrinology,2009,150(3):1278-1286.
7.Kato Y,Kobayashi K,Watanabe H,Iguchi T.Environmental sexdetermination in the branchiopod crustacean Daphnia magna:deep conservationof a Doublesexgene in the sex-determining pathway.PloS Genetics,2011,7(3):e1001345.
8.Ventura T,Manor R,Aflalo ED,Weil S,Rosen O,Sagi A.Timing sexualdifferentiation:full functional sex reversal achieved through silencing of asingle insulin-like gene in the prawn,Macrobrachium rosenbergii.Biology ofReproduction,2012,86(3):86-90.
9.Qing Guo,Shihao Li,Xinjia Lv,Jianhai Xiang,Amir Sagi,Rivka Manor,Fuhua Li.A putative insulin-like androgenic gland hormone receptor genespecifically expressed in male Chinese shrimp.Endocrinology,2018,159(5):2173-2185.
sequence listing
<110> university of agriculture in Huazhong
<120> male Macrobrachium rosenbergii sex-transformed siRNA-IR sequence and application thereof
<160>2
<170>SIPOSequenceListing 1.0
<210>1
<211>21
<212>RNA
<213> Synthetic sequence (Synthetic sequence)
<400>1
gggagaacau cacccuuaag u 21
<210>2
<211>21
<212>RNA
<213> Synthetic sequence (Synthetic sequence)
<400>2
acuuaagggu gauguucucc c 21
Claims (5)
1. A male macrobrachium rosenbergii sex-converted siRNA-IR sequence, characterized in that: the nucleotide sequence of the siRNA-IR sense strand is GGGAGAACAUCACCCUUAAGU, and is shown as SEQ ID NO. 1; the nucleotide sequence of the siRNA-IR antisense chain is ACUUAAGGGUGAUGUUCUCCC, and is shown as SEQ ID NO. 2.
2. Use of the siRNA-IR sequence of claim 1 for sexual conversion of male macrobrachium rosenbergii into pseudo female shrimp.
3. The use according to claim 2; the method is characterized in that: the application method comprises the following steps:
1) obtaining siRNA-IR through in vitro transcription,
2) microinjection is carried out at the joint membrane of the base part of the fifth step, the injected shrimp larvae are later larvae, and the culture is carried out after the injection treatment course is finished until the pseudo-female macrobrachium rosenbergii appears; wherein the injection course is once every five days, the injection times are five times, and the concentration dose of each siRNA-IR injection is 0.4-0.7 mug/g body weight.
4. The use according to claim 3; the method is characterized in that: in the step 1), the concentration dose of siRNA-IR injection is 0.5 mug/g body weight.
5. A male macrobrachium rosenbergii sex conversion kit comprising a sequence encoding the siRNA-IR of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911143098.5A CN110714009B (en) | 2019-11-20 | 2019-11-20 | Male macrobrachium rosenbergii sex-converted siRNA-IR sequence and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911143098.5A CN110714009B (en) | 2019-11-20 | 2019-11-20 | Male macrobrachium rosenbergii sex-converted siRNA-IR sequence and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110714009A true CN110714009A (en) | 2020-01-21 |
| CN110714009B CN110714009B (en) | 2021-04-06 |
Family
ID=69216305
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911143098.5A Active CN110714009B (en) | 2019-11-20 | 2019-11-20 | Male macrobrachium rosenbergii sex-converted siRNA-IR sequence and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110714009B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111387105A (en) * | 2020-03-12 | 2020-07-10 | 浙江省淡水水产研究所 | Method for producing seeds of all-male macrobrachium rosenbergii |
| CN112841096A (en) * | 2020-12-31 | 2021-05-28 | 浙江省淡水水产研究所 | Breeding method of all-male macrobrachium rosenbergii rapid-growth strain |
| CN113930429A (en) * | 2021-11-11 | 2022-01-14 | 上海海洋大学 | Short-chain ribonucleic acid for interfering IAG gene expression of macrobrachium rosenbergii and application thereof |
| CN115281151A (en) * | 2022-07-27 | 2022-11-04 | 广东省科学院动物研究所 | Application of miR-34b/c gene inhibitor in regulation and control of early sex differentiation of Acipenser schrenki |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104745628A (en) * | 2015-04-16 | 2015-07-01 | 浙江万里学院 | Method for sex induction of hermaphrodite shrimps |
| CN106434680A (en) * | 2016-10-24 | 2017-02-22 | 浙江万里学院 | Masculinization gene of shrimps and application of masculinization gene |
-
2019
- 2019-11-20 CN CN201911143098.5A patent/CN110714009B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104745628A (en) * | 2015-04-16 | 2015-07-01 | 浙江万里学院 | Method for sex induction of hermaphrodite shrimps |
| CN106434680A (en) * | 2016-10-24 | 2017-02-22 | 浙江万里学院 | Masculinization gene of shrimps and application of masculinization gene |
Non-Patent Citations (2)
| Title |
|---|
| QING GUO等: "A Putative Insulin-like Androgenic Gland Hormone Receptor Gene Specifically Expressed in Male Chinese Shrimp", 《ENDOCRINOLOGY》 * |
| 姜建萍等: "罗氏沼虾性别相关基因研究进展及其单性化养殖现状", 《南方农业学报》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111387105A (en) * | 2020-03-12 | 2020-07-10 | 浙江省淡水水产研究所 | Method for producing seeds of all-male macrobrachium rosenbergii |
| CN111387105B (en) * | 2020-03-12 | 2022-02-15 | 浙江省淡水水产研究所 | Method for producing seeds of all-male macrobrachium rosenbergii |
| CN112841096A (en) * | 2020-12-31 | 2021-05-28 | 浙江省淡水水产研究所 | Breeding method of all-male macrobrachium rosenbergii rapid-growth strain |
| CN112841096B (en) * | 2020-12-31 | 2022-08-05 | 浙江省淡水水产研究所 | Breeding method of all-male macrobrachium rosenbergii rapid-growth strain |
| CN113930429A (en) * | 2021-11-11 | 2022-01-14 | 上海海洋大学 | Short-chain ribonucleic acid for interfering IAG gene expression of macrobrachium rosenbergii and application thereof |
| CN113930429B (en) * | 2021-11-11 | 2023-10-27 | 上海海洋大学 | Short-chain ribonucleic acid for interfering expression of macrobrachium rosenbergii IAG gene and application thereof |
| CN115281151A (en) * | 2022-07-27 | 2022-11-04 | 广东省科学院动物研究所 | Application of miR-34b/c gene inhibitor in regulation and control of early sex differentiation of Acipenser schrenki |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110714009B (en) | 2021-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110714009B (en) | Male macrobrachium rosenbergii sex-converted siRNA-IR sequence and application thereof | |
| Li et al. | Two spliced variants of insulin-like androgenic gland hormone gene in the Chinese shrimp, Fenneropenaeus chinensis | |
| Lezer et al. | On the safety of RNAi usage in aquaculture: The case of all-male prawn stocks generated through manipulation of the insulin-like androgenic gland hormone | |
| Yu et al. | Molecular cloning and sexually dimorphic expression of two Dmrt genes in the giant freshwater prawn, Macrobrachium rosenbergii | |
| Lehnert et al. | Transmission of lungworms of harbour porpoises and harbour seals: molecular tools determine potential vertebrate intermediate hosts | |
| Tan et al. | siRNA-mediated MrIAG silencing induces sex reversal in Macrobrachium rosenbergii | |
| Tan et al. | Sex reversal and the androgenic gland (AG) in Macrobrachium rosenbergii: A review | |
| Tan et al. | siRNA knockdown of MrIR induces sex reversal in Macrobrachium rosenbergii | |
| CN108795934B (en) | SiRNA of schistosoma japonicum SjELAV-like 2 gene and application thereof | |
| Palstra et al. | Temporal expression of hepatic estrogen receptor 1, vitellogenin1 and vitellogenin2 in European silver eels | |
| Fu et al. | Expression of let-7 microRNAs that are involved in Japanese flounder (Paralichthys olivaceus) metamorphosis | |
| CN103210088A (en) | Target genes for control of plant parasitic nematodes and use of same | |
| Sun et al. | A sex‐reversing factor: insulin‐like androgenic gland hormone in decapods | |
| CN104745628A (en) | Method for sex induction of hermaphrodite shrimps | |
| Jin et al. | Recent progress of male sexual differentiation and development in the oriental river prawn (Macrobrachium nipponense): A review | |
| CN113846073B (en) | Nilaparvata lugens NlLIPH gene and application thereof | |
| Jin et al. | Identification of androgenic gland microRNA and their target genes to discover sex-related microRNA in the oriental river prawn, Macrobrachium nipponense | |
| Thepsuwan et al. | Long non-coding RNA profile in banana shrimp, Fenneropenaeus merguiensis and the potential role of lncPV13 in vitellogenesis | |
| CN114058713A (en) | Acquisition method of Y chromosome sequence of Pseudobagrus ussuriensis | |
| US11060090B2 (en) | Method of releasing the suppression of egg maturation in economically-important prawn/shrimp species | |
| Dung et al. | Identification of RNAi-related genes and transgenerational efficiency of RNAi in Artemia franciscana | |
| Jia et al. | Regulation of VIH by miR-277 in the eyestalk of mud crab Scylla paramamosain | |
| Lee et al. | Estradiol-17β treatment induces intersexual gonadal development in the pufferfish, Takifugu rubripes | |
| Guan et al. | Participation of calmodulin in ovarian maturation induced by eyestalk ablation in red swamp crayfish P rocambarus clarkii | |
| JP2009219487A (en) | Growth-related gene of germ line of pinctada fucata, and method for inhibiting growth of germ cell line |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |