CN110699483A - LAMP (loop-mediated isothermal amplification) visualization-based primers for detecting isaria fumosorosea, detection method and application - Google Patents
LAMP (loop-mediated isothermal amplification) visualization-based primers for detecting isaria fumosorosea, detection method and application Download PDFInfo
- Publication number
- CN110699483A CN110699483A CN201911192900.XA CN201911192900A CN110699483A CN 110699483 A CN110699483 A CN 110699483A CN 201911192900 A CN201911192900 A CN 201911192900A CN 110699483 A CN110699483 A CN 110699483A
- Authority
- CN
- China
- Prior art keywords
- primer
- lamp
- concentration
- seq
- isaria fumosorosea
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer for visually detecting isaria fumosorosea based on LAMP, a detection method and application, belonging to the technical field of entomogenous fungi, wherein the primer comprises an F3 primer, a B3 primer, a FIP primer and a BIP primer; the nucleotide sequence of the F3 primer is shown as SEQ ID No. 1; the nucleotide sequence of the B3 primer is shown as SEQ ID No. 2; the nucleotide sequence of the FIP primer is shown as SEQ ID No. 3; the nucleotide sequence of the BIP primer is shown as SEQ ID No. 4. The primer combination detection method can realize visual detection of Isaria fumosorosea, has strong primer specificity and high sensitivity, and can detect the DNA content of a sample by more than 10 fg.
Description
Technical Field
The invention belongs to the technical field of entomogenous fungi diagnosis, and particularly relates to a primer for visually detecting isaria fumosorosea based on LAMP, a detection method and application.
Background
In recent years, China has paid great attention to the biological control of agricultural pests. However, the basic research on the biocontrol bacteria is weak at present, and particularly, the epidemic research on pathogenic fungi of target pests lacks an effective and reasonable technical means, which seriously hinders the utilization and development of the biocontrol bacteria.
Isaria fumosorosea (Wize) belongs to the Deuteromycetae, order Chimomycetales, family Calycopsidae. The insect pest control agent has wide geographical distribution and various insect hosts, and is a pathogenic fungus of important pests such as aphids, whiteflies and the like. Under natural conditions, epidemics can develop in pest populations such as vegetables, fruits and landscape plants. For example, in the population of the vegetable Bemisia tabaci in southern areas of China, the vegetable Bemisia tabaci can be continuously popularized in a large area and effectively controlled. However, epidemiological studies on the target pests by this biocontrol bacterium are still blank. Because the outdoor environment is complex, the types of microorganisms are multiple, the interference factors are multiple, the traditional form identification and the modern PCR molecular detection method at present are time-consuming and labor-consuming, and have high requirements on equipment.
Disclosure of Invention
In view of the above, the invention aims to provide a primer for detecting isaria fumosorosea based on LAMP visualization, a detection method and application thereof.
In order to achieve the above purpose, the invention provides the following technical scheme:
the invention provides a primer for visually detecting isaria fumosorosea based on LAMP, which comprises an F3 primer, a B3 primer, a FIP primer and a BIP primer;
the nucleotide sequence of the F3 primer is shown as SEQ ID No. 1;
the nucleotide sequence of the B3 primer is shown as SEQ ID No. 2;
the nucleotide sequence of the FIP primer is shown as SEQ ID No. 3;
the nucleotide sequence of the BIP primer is shown as SEQ ID No. 4.
The invention provides a method for visually detecting isaria fumosorosea by using the primers in the technical scheme, which comprises the following steps: extracting genome DNA of a sample, and carrying out LAMP reaction by using the primers in the technical scheme by using the genome DNA as a template to obtain an LAMP product;
when the LAMP product is green, the sample contains Isaria fumosorosea;
when the LAMP product is orange, the sample does not contain Isaria fumosorosea;
the system used in the LAMP reaction contains calcein and MnCl2。
Preferably, the LAMP reaction uses a system comprising, per 25. mu.l: 1. mu.l of F3 primer at a concentration of 5. mu.M, 1. mu.l of B3 primer at a concentration of 5. mu.M, 4. mu.l of FIP primer at a concentration of 10. mu.M, 4. mu.l of BIP primer at a concentration of 10. mu.M, 2.5. mu.l of 10 XThermopolyBuffer, 1. mu.l of dNTPs at a concentration of 10mM, 5. mu.l of Betaine at a concentration of 0.8M, and MgSO 5. mu.l at a concentration of 10mM4Solution 1. mu.l, calcein 1. mu.l at a concentration of 50. mu.M, MnCl 250. mu.M 21. mu.l of the solution, 1. mu.l of Bst DNA polymerase having an enzyme activity of 8U, 2. mu.l of sample genomic DNA having a concentration of 10 ng/. mu.l, ddH2O make up to 25. mu.l.
Preferably, the calcein is mixed with MnCl2Is 1: 5.
Preferably, the LAMP reaction conditions include: the system used for LAMP reaction is denatured at 95 ℃ for 5min, immediately placed on ice, kept at 65 ℃ for 40min and then at 80 ℃ for 2 min.
The invention also provides application of the primer in the technical scheme in visual detection of Isaria fumosorosea.
The invention provides a primer for visually detecting isaria fumosorosea based on LAMP, which comprises an F3 primer, a B3 primer, a FIP primer and a BIP primer; the nucleotide sequence of the F3 primer is shown as SEQ ID No. 1; the nucleotide sequence of the B3 primer is shown as SEQ ID No. 2; the nucleotide sequence of the FIP primer is shown as SEQ ID No. 3; the nucleotide sequence of the BIP primer is shown as SEQ ID No. 4.
The LAMP-based visual detection mechanism for Isaria fumosorosea is as follows:
using a metal ion indicator calcein, which reacts with Mn2+Binding without fluorescence signal, as the reaction proceeds, a large amount of more easily Mn is produced2+Bound pyrophosphate ions thereby releasing calcein, free calcein being able to fluoresce spontaneously, and this fluorescence signal being in Mg2+The principle of enhancement in the existing environment is that calcein + MnCl is used2And carrying out color development indication on the detection result by the mixed solution. calcein + MnCl2The mixed solution is added before the reaction, the whole operation process does not need to open the cover, the detection result (negative, orange, positive and green) can be judged by directly observing the color change through naked eyes, the visualization of the detection result is realized, and the false positive phenomenon caused by the pollution of reaction products due to the operation of opening the cover is avoided.
Drawings
FIG. 1 shows LAMP detection results of smoky rod bundles, wherein "+" is a positive reaction result and "-" is a negative reaction result;
fig. 2 is a visualized LAMP-specific detection result, wherein a in fig. 2: m is a standard Isaria fumosorosea strain; CK is clear water contrast; 1-10: isaria fumosorosea from different sources; b in fig. 2: m is a standard Isaria fumosorosea strain; CK is clear water contrast; 1-10: different pathogenic fungi;
FIG. 3 shows the result of the gradient PCR sensitivity assay for genomic DNA, where M is 100 bpMarker; 1-10: 10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10fg, 1fg, 100ag, 10 ag; 11: clear water control;
FIG. 4 shows the detection result of genomic DNA gradient LAMP sensitivity, wherein M is a standard strain; 1: clear water control; 2-11: 10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10fg, 1fg, 100ag, 10 ag;
FIG. 5 is the LAMP detection of a portion of field bemisia tabaci DNA against disease, wherein M is a standard Isaria fumosorosea strain; 1-13: different bemisia tabaci DNA were collected in the field.
Detailed Description
The invention provides a primer for visually detecting isaria fumosorosea based on LAMP, which comprises an F3 primer, a B3 primer, a FIP primer and a BIP primer; the nucleotide sequence of the F3 primer is shown as SEQ ID No. 1; the nucleotide sequence of the B3 primer is shown as SEQ ID No. 2; the nucleotide sequence of the FIP primer is shown as SEQ ID No. 3; the nucleotide sequence of the BIP primer is shown as SEQ ID No. 4.
In the invention, the design concept of the primer is as follows:
a plurality of sequences of Isaria fumosorosea and other related entomogenous fungi (Beauveria bassiana, Isaria farinosa, Isaria cicadae, Isaria cyclophora, Isaria subterrata, Isaria obliqua, Metarrhizium anisopliae, and Verticillium lecanii) were obtained from GENBANK by BLAST alignment using ITS sequences measured by the strain IMH02 through NCBI website, and sequence alignment was performed using DNA8.0 software to determine the specific and highly conserved ITS fragment of Isaria fumosorosea as a target sequence, and LAMP was designed using the on-line (http/primer. jp/inch/index). In the invention, the nucleotide sequence of the ITS fragment is shown as SEQ ID No.5, and specifically comprises the following steps:
atcattaacgagttttttcaactccctaaccctttgtgaacatacctatcgttgcttcggcggactcgccccggcgtccggacggccctgcgccgcccgcgacccggacccaggcggccgccggagacccacaaattctgtttctatcagtctttctgaatccgccgcaaggcaaaacaaatgaatcaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgcccgccagcattctggcgggcatgcctgttcgagcgtcatttcaaccctcgacaccccttcgggggagtcggcgttggggaccggcagcataccgccggccccgaaatacagtggcggcccgtccgcggcgacctctgcgtagtactccaacgcgcaccgggaacccgacgcggccacgccgtaaaacacccaacttctgaacgttgacctcggatcaggta。
in the invention, the nucleotide sequence of the F3 primer is shown as SEQ ID No.1, and is specifically shown as follows:
gcctgttcgagcgtcatt；
the nucleotide sequence of the B3 primer is shown as SEQ ID No.2, and is specifically shown as follows:
cgaggtcaacgttcagaagt。
in the present invention, the F3 primer and the B3 primer are the outer primers of LAMP.
In the invention, the nucleotide sequence of the FIP primer is shown as SEQ ID No.3, and is specifically shown as follows:
cactgtatttcggggccggc-aaccctcgacaccccttc；
in the invention, the nucleotide sequence of the BIP primer is shown as SEQ ID No.4, and is specifically shown as follows:
cggcgacctctgcgtagtact-gggtgttttacggcgtgg。
in the present invention, the FIP primer and the FIP primer are the inner primers of LAMP.
The invention also provides a method for visually detecting isaria fumosorosea by using the primer in the technical scheme, which comprises the following steps: extracting genome DNA of a sample, and carrying out LAMP reaction by using the primers in the technical scheme by using the genome DNA as a template to obtain an LAMP product;
when the LAMP product is green, the sample contains Isaria fumosorosea;
when the LAMP product is orange, the sample does not contain Isaria fumosorosea;
the system used in the LAMP reaction contains calcein and MnCl2。
The present invention is not particularly limited to the above-mentioned sample, but is preferably a patient infected with Isaria fumosorosea. The method for extracting the genomic DNA of the sample is not particularly limited, and the method can be used conventionally.
In the present invention, the system used for the LAMP reaction preferably includes, per 25. mu.l: 1. mu.l of F3 primer at a concentration of 5. mu.M, 1. mu.l of B3 primer at a concentration of 5. mu.M, 4. mu.l of FIP primer at a concentration of 10. mu.M, 4. mu.l of BIP primer at a concentration of 10. mu.M, 2.5. mu.l of 10 XThermopol Buffer, 1. mu.l of dNTPs at a concentration of 10mM, concentratedBetaine 5. mu.l at a concentration of 0.8M, MgSO 10mM4Solution 1. mu.l, calcein 1. mu.l at a concentration of 50. mu.M, MnCl 250. mu.M 21. mu.l of the solution, 1. mu.l of BstDNA polymerase having an enzyme activity of 8U, 2. mu.l of sample genomic DNA having a concentration of 10 ng/. mu.l, ddH2O make up to 25. mu.l. The source of the reagent is not particularly limited in the present invention, and a conventional commercially available product may be used.
In the present invention, the calcein is mixed with MnCl2The volume ratio of (a) to (b) is preferably 1: 5.
In the present invention, the conditions of the LAMP reaction preferably include: the system used for LAMP reaction is denatured at 95 ℃ for 5min, immediately placed on ice, kept at 65 ℃ for 40min and then at 80 ℃ for 2 min.
The invention also provides application of the primer in the technical scheme in visual detection of Isaria fumosorosea.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
LAMP system establishment and specificity detection:
establishment of LAMP System
The LAMP detection optimal reaction system for Isaria fumosorosea is 25 mu L: including 1.0uL each of the outer primers F3 (5. mu.M) and B3 (5. mu.M), 4.0uL each of the inner primers FIP (10. mu.M) and BIP (10. mu.M), 12.5uL of the reaction mixture [1 XThermopol Buffer, 1mM dNTPs, 0.8M beta-ine, 10mM MgSO 2. mu.M4]50 μ M Calcein, 250 μ MMnCl2(Calcein-MnCl2The ratio was 1:5), 1. mu.L (8U) of Bst DNA polymerase, 2. mu.L of LDNA template (250 ng/. mu.L), using d.d.H2O make up to 25.0 uL. The LAMP reaction condition is incubation for 60min at 65 ℃. The effect of the reaction is shown in FIG. 1.
And (4) carrying out specificity detection on all test strains according to the reaction system. The method comprises culturing 10 Isaria fumosorosea strains (provided by plant protection of academy of agricultural sciences) and 10 other pathogenic fungi (including Beauveria bassiana, Metarrhizium anisopliae, Verticillium lecanii, Anthragma colletotrichum, Soft rot pathogen, early-stage pathogen, Botrytis cinerea, powdery mildew, and late blight)Fusarium oxysporum, etc.) for specific detection in ddH2And O is negative control, a reaction system and reaction conditions are adopted to carry out LAMP reaction, and the specificity of the visual LAMP detection method is verified. After the reaction was completed, the color change of the reaction solution was visually observed for analysis.
The LAMP reaction was carried out in the same manner as above.
The nucleotide sequence of the F3 primer is shown as SEQ ID No.1, the nucleotide sequence of the B3 primer is shown as SEQ ID No.2, the nucleotide sequence of the FIP primer is shown as SEQ ID No.3, and the nucleotide sequence of the BIP primer is shown as SEQ ID No. 4.
The conditions of the LAMP reaction include: the system used for LAMP reaction is denatured at 95 ℃ for 5min, immediately placed on ice, kept at 65 ℃ for 40min and then at 80 ℃ for 2 min.
The specific detection result shows that the LAMP detection of 10 different host sources of the isaria fumosorosea shows green (shown as A in figure 2), and the LAMP detection of the negative control and 10 other pathogenic fungi shows orange (shown as B in figure 2). The result shows that the LAMP primer can specifically detect the Isaria fumosorosea.
Example 2
Visual LAMP and PCR sensitivity comparison:
the genomic DNA concentration was diluted in 10-fold gradient to 10-fold with an ultraviolet spectrophotometer (ND2000C, Thermo Scientific Co.) at 10 ng. mu.L each-1、1ng·μL-1、100pg·μL-1、10pg·μL-1、1pg·μL-1、100fg·μL-1、10fg·μL-1、1fg·μL-1、100ag·μL-1、10ag·μL-1(same below) for sensitivity verification of LAMP detection System, ddH2O as blank control. The detection result can be directly observed by naked eyes, the green is positive, the orange is negative, and the experiment is repeated for 3 times. The LAMP reaction system and conditions were the same as in example 1.
In the sensitive detection of different DNA concentrations, the result showed that the DNA concentration was 1 pg. mu.L-1The detection limit was determined by PCR, and below this concentration, no specific band could be detected by PCR (FIG. 3), and the DNA concentration was 10 fg. mu.L-1The LAMP reaction product can still show light green, and the LAMP reaction product shows orange yellow when the concentration is lower than the light green (figure 4), which shows that the detection limit of the LAMP reaction system is 10 fg. mu.L-1And the detection sensitivity is 2 orders of magnitude higher than that of PCR.
Example 3
And (3) field detection application:
24 strain DNA samples were taken from field Bemisia tabaci runcifera in different areas. The visual LAMP system and the PCR system are respectively adopted for detection, the sample detection rate of the 2 detection methods and the actual application effect of the visual LAMP technology are compared in the same embodiment 1, and ddH is used2O is a control. And meanwhile, the ITS sequencing identification and LAMP detection accuracy are carried out on 24 strains.
In order to visualize the actual application effect of the LAMP detection system, 24 different bemisia tabaci morbid bodies were collected from areas such as Fuzhou, Minhou and Nanping in Fujian province. The visual LAMP and PCR detection system is used for detection, the detection rate of the visual LAMP is 87.5 percent (21/24), and the detection rate of the visual LAMP by the PCR technology is 70.8 percent (17/24); meanwhile, the collected samples are separated by a conventional method, the strains are sequenced and identified, and the result shows that the isaria fumosorosea separated from the samples is consistent with the LAMP detection result, so that the visual LAMP detection method is accurate and reliable, does not need special equipment, and is suitable for visual rapid detection of the isaria fumosorosea in the field (figure 5).
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> institute of plant protection of academy of agricultural sciences of Fujian province
<120> primer for visually detecting Isaria fumosorosea based on LAMP, detection method and application
<160>5
<170>SIPOSequenceListing 1.0
<210>1
<211>18
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
gcctgttcga gcgtcatt 18
<210>2
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
cgaggtcaac gttcagaagt 20
<210>3
<211>38
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
cactgtattt cggggccggc aaccctcgac accccttc 38
<210>4
<211>39
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
cggcgacctc tgcgtagtac tgggtgtttt acggcgtgg 39
<210>5
<211>526
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
atcattaacg agttttttca actccctaac cctttgtgaa catacctatc gttgcttcgg 60
cggactcgcc ccggcgtccg gacggccctg cgccgcccgc gacccggacc caggcggccg 120
ccggagaccc acaaattctg tttctatcag tctttctgaa tccgccgcaa ggcaaaacaa 180
atgaatcaaa actttcaaca acggatctct tggttctggc atcgatgaag aacgcagcga 240
aatgcgataa gtaatgtgaa ttgcagaatt cagtgaatca tcgaatcttt gaacgcacat 300
tgcgcccgcc agcattctgg cgggcatgcc tgttcgagcg tcatttcaac cctcgacacc 360
ccttcggggg agtcggcgtt ggggaccggc agcataccgc cggccccgaa atacagtggc 420
ggcccgtccg cggcgacctc tgcgtagtac tccaacgcgc accgggaacc cgacgcggcc 480
acgccgtaaa acacccaact tctgaacgtt gacctcggat caggta 526
Claims (6)
1. A primer for visually detecting Isaria fumosorosea based on LAMP is characterized by comprising an F3 primer, a B3 primer, an FIP primer and a BIP primer;
the nucleotide sequence of the F3 primer is shown as SEQ ID No. 1;
the nucleotide sequence of the B3 primer is shown as SEQ ID No. 2;
the nucleotide sequence of the FIP primer is shown as SEQ ID No. 3;
the nucleotide sequence of the BIP primer is shown as SEQ ID No. 4.
2. A method for visually detecting Isaria fumosorosea by using the primer of claim 1, which comprises: extracting genome DNA of a sample, and carrying out LAMP reaction by using the genome DNA as a template and the primer of claim 1 to obtain an LAMP product;
when the LAMP product is green, the sample contains Isaria fumosorosea;
when the LAMP product is orange, the sample does not contain Isaria fumosorosea;
the system used in the LAMP reaction contains calcein and MnCl2。
3. The method of claim 2, wherein the LAMP reaction uses a system comprising, per 25. mu.l: mu.l of F3 primer at a concentration of 5. mu.M, 1. mu.l of B3 primer at a concentration of 5. mu.M, 4. mu.l of FIP primer at a concentration of 10. mu.M, 4. mu.l of BIP primer at a concentration of 10. mu.M, 10 XThermopol B2.5. mu.l of buffer, 1. mu.l of dNTPs at a concentration of 10mM, 5. mu.l of Betaine at a concentration of 0.8M, and MgSO at a concentration of 10mM4Solution 1. mu.l, calcein 1. mu.l at a concentration of 50. mu.M, MnCl 250. mu.M21. mu.l of the solution, 1. mu.l of Bst DNA polymerase having an enzyme activity of 8U, 2. mu.l of sample genomic DNA having a concentration of 10 ng/. mu.l, ddH2O make up to 25. mu.l.
4. The method of claim 3, wherein said calcein is mixed with MnCl2Is 1: 5.
5. The method of claim 2 or 3, wherein the conditions of the LAMP reaction include: the system used for LAMP reaction is denatured at 95 ℃ for 5min, immediately placed on ice, kept at 65 ℃ for 40min and then at 80 ℃ for 2 min.
6. Use of the primers of claim 1 for the visual detection of isaria fumosorosea.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911192900.XA CN110699483B (en) | 2019-11-28 | 2019-11-28 | Primer for visually detecting isaria fumosorosea based on LAMP (loop-mediated isothermal amplification), detection method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911192900.XA CN110699483B (en) | 2019-11-28 | 2019-11-28 | Primer for visually detecting isaria fumosorosea based on LAMP (loop-mediated isothermal amplification), detection method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110699483A true CN110699483A (en) | 2020-01-17 |
| CN110699483B CN110699483B (en) | 2022-07-19 |
Family
ID=69208028
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911192900.XA Active CN110699483B (en) | 2019-11-28 | 2019-11-28 | Primer for visually detecting isaria fumosorosea based on LAMP (loop-mediated isothermal amplification), detection method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110699483B (en) |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010115156A2 (en) * | 2009-04-03 | 2010-10-07 | Synthetic Genomics, Inc. | Endophytic fungus and uses therefor |
| CN102134590A (en) * | 2010-12-07 | 2011-07-27 | 浙江省质量技术监督检测研究院 | Fast detection method for clostridium perfringens, detection primer group and detection kit |
| CN102220424A (en) * | 2011-05-10 | 2011-10-19 | 浙江省质量技术监督检测研究院 | Rapid detection method for enterococcus, detection primer group and detection kit |
| US20130005595A1 (en) * | 2006-05-02 | 2013-01-03 | Wako Pure Chemical Industries, Ltd. | Primer And Probe For Detection Of Mycobacterium Intracellulare, And Method For Detection Of Mycobacterium Intracellulare Using The Same |
| CN105132297A (en) * | 2015-10-15 | 2015-12-09 | 福建省农业科学院植物保护研究所 | Application of biocontrol strain FZ01-GFP capable of expressing GFP to targeted pest epidemiology |
| CN105331714A (en) * | 2015-11-24 | 2016-02-17 | 福建省农业科学院植物保护研究所 | Peronophythora litchii LAMP (loop-mediated isothermal amplification) primer and rapid detection method thereof |
| CN108588250A (en) * | 2018-06-26 | 2018-09-28 | 浙江大学 | A kind of LAMP primer and its detection method for detecting Acidovorax Avenae Subsp |
| CN110468054A (en) * | 2019-05-28 | 2019-11-19 | 华南农业大学 | A kind of application of entomogenous fungi fumosorosea SP535 in p- chloroaniline biodegrade |
-
2019
- 2019-11-28 CN CN201911192900.XA patent/CN110699483B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130005595A1 (en) * | 2006-05-02 | 2013-01-03 | Wako Pure Chemical Industries, Ltd. | Primer And Probe For Detection Of Mycobacterium Intracellulare, And Method For Detection Of Mycobacterium Intracellulare Using The Same |
| WO2010115156A2 (en) * | 2009-04-03 | 2010-10-07 | Synthetic Genomics, Inc. | Endophytic fungus and uses therefor |
| CN102134590A (en) * | 2010-12-07 | 2011-07-27 | 浙江省质量技术监督检测研究院 | Fast detection method for clostridium perfringens, detection primer group and detection kit |
| CN102220424A (en) * | 2011-05-10 | 2011-10-19 | 浙江省质量技术监督检测研究院 | Rapid detection method for enterococcus, detection primer group and detection kit |
| CN105132297A (en) * | 2015-10-15 | 2015-12-09 | 福建省农业科学院植物保护研究所 | Application of biocontrol strain FZ01-GFP capable of expressing GFP to targeted pest epidemiology |
| CN105331714A (en) * | 2015-11-24 | 2016-02-17 | 福建省农业科学院植物保护研究所 | Peronophythora litchii LAMP (loop-mediated isothermal amplification) primer and rapid detection method thereof |
| CN108588250A (en) * | 2018-06-26 | 2018-09-28 | 浙江大学 | A kind of LAMP primer and its detection method for detecting Acidovorax Avenae Subsp |
| CN110468054A (en) * | 2019-05-28 | 2019-11-19 | 华南农业大学 | A kind of application of entomogenous fungi fumosorosea SP535 in p- chloroaniline biodegrade |
Non-Patent Citations (1)
| Title |
|---|
| 王定峰等: ""一株寄生茶大灰象甲的棒束孢菌的分子鉴定"", 《茶叶学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110699483B (en) | 2022-07-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Böhm et al. | Real‐time quantitative PCR: DNA determination in isolated spores of the mycorrhizal fungus Glomus mosseae and monitoring of Phytophthora infestans and Phytophthora citricola in their respective host plants | |
| Crossay et al. | New method for the identification of arbuscular mycorrhizal fungi by proteomic-based biotyping of spores using MALDI-TOF-MS | |
| JP2010523076A (en) | Fungal infection assays | |
| Yao et al. | Rapid and sensitive detection of Didymella bryoniae by visual loop-mediated isothermal amplification assay | |
| Huang et al. | Loop-mediated isothermal amplification method for the rapid detection of Ralstonia solanacearum phylotype I mulberry strains in China | |
| CN106011246B (en) | 5 kinds of root-knot nematode isothermal duplication detection primer sequences and its application based on microfluidic chip technology | |
| Bonants et al. | A combination of baiting and different PCR formats, including measurement of real-time quantitative fluorescence, for the detection of Phytophthora fragariae in strawberry plants | |
| Lu et al. | Rapid diagnosis of Fusarium root rot in soybean caused by Fusarium equiseti or Fusarium graminearum using loop-mediated isothermal amplification (LAMP) assays | |
| CN109868329B (en) | Screening, quarantine and identification method of colletotrichum specific primers | |
| CN110699483B (en) | Primer for visually detecting isaria fumosorosea based on LAMP (loop-mediated isothermal amplification), detection method and application | |
| CN111088395A (en) | LAMP (loop-mediated isothermal amplification) detection primer group and method for gaeumannomyces graminis gaeumannomyces | |
| CN111088394A (en) | LAMP (loop-mediated isothermal amplification) detection primer group for Helminthosporium funiculosum of rhizoctonia solani and application of LAMP detection primer group | |
| CN104946637B (en) | A kind of multiple DPO PCR detection kits of two kinds of wheel branch germs of sunflower verticillium wilt and its application | |
| CN111733271B (en) | Composition for detecting drug resistance of anthrax bacteria to QOI-type bactericides and application thereof | |
| Hynes et al. | Development of AFLP-derived, functionally specific markers for environmental persistence studies of fungal strains | |
| CN102605069B (en) | Enterohemorrhagic Escherichia coli O104: H4 detection kit and use method thereof | |
| Mahadevakumar et al. | Diagnosis of Pythium by classical and molecular approaches | |
| CN114164296B (en) | Primer probe composition for detecting pythium oligandrum, kit and application and detection method | |
| CN114107539B (en) | LAMP primer composition for detecting pythium delicicola and application thereof | |
| CN114317796B (en) | LAMP primer composition for detecting pythium admittedly and detection method thereof | |
| CN114438257B (en) | Primer group and kit for simultaneously detecting 5 pathogenic bacteria of tobacco and application of primer group and kit | |
| CN114107526B (en) | RPA primer pair and crRNA for detecting acidophilic bacteria of watermelons, kit and use method thereof | |
| CN117511934B (en) | LAMP (loop-mediated isothermal amplification) detection primer and rapid detection method for pepper anthracnose based on SOD2 | |
| Guo et al. | CRISPR/Cas12a-based approaches for efficient and accurate detection of Phytophthora ramorum | |
| CN111944919B (en) | Banana fusarium wilt tropical No.4 small species visual detection technology system capable of being operated in field and at normal temperature |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |