CN110699370A - Method for adopting green alga PMI as tomato genetic transformation screening marker gene - Google Patents
Method for adopting green alga PMI as tomato genetic transformation screening marker gene Download PDFInfo
- Publication number
- CN110699370A CN110699370A CN201911015798.6A CN201911015798A CN110699370A CN 110699370 A CN110699370 A CN 110699370A CN 201911015798 A CN201911015798 A CN 201911015798A CN 110699370 A CN110699370 A CN 110699370A
- Authority
- CN
- China
- Prior art keywords
- pmi
- tomato
- marker gene
- transgenic
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8209—Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
- C12N15/821—Non-antibiotic resistance markers, e.g. morphogenetic, metabolic markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for selecting a marker gene by using green alga PMI as tomato genetic transformation. The method comprises the steps of cloning green alga PMI, constructing a plant binary expression vector, transforming tomato, identifying transgenic tomato and the like. The gene can replace the currently widely used antibiotic gene, herbicide resistance gene, escherichia coli source PMI and other heterologous genes as marker genes to be applied to genetic transformation of tomatoes, and the transgenic tomatoes with higher food safety, biological safety and ecological safety are obtained.
Description
Technical Field
The invention relates to the field of genetic engineering, in particular to screening and application of a safety screening marker gene in transgenic plants.
Background
Tomato, originally produced in central and south america, is an annual or perennial herb of the solanaceae family, also known as tomato and persimmons. The tomato is rich in lycopene, beta-carotene and other various nutritional ingredients, is very beneficial to body health, and is one of the most widely planted vegetables and fruits in the world. Since the first transgenic tomato variety "Flavr-Savr" was approved for marketing in the United states in 1994, transgenic tomatoes have been approved for marketing in various countries and regions of the United states, European Union, Japan, Latin America, and the like. The transgenic tomato is developed vigorously, various storage-resistant, high-nutrition, disease-resistant, salt-resistant, cold-resistant and drought-resistant transgenic tomato varieties are successfully developed in succession, the excellent varieties are the basis of the development of the tomato industry, more and more transgenic tomatoes with excellent characters are planted commercially, and the commercial opportunity of the transgenic tomato industry is unlimited.
With the vigorous development of transgenic biotechnology, commercial transgenic tomatoes are continuously appeared, and people pay more and more attention to the safety problem of transgenic foods. The resistance marker gene derived from pathogenic bacteria contained in the transgenic plant is seriously attacked by people and becomes an important factor for restricting the development of the transgenic organism. Transgenic screening generally uses antibiotics and herbicides as screening markers, and the risks are mainly as follows: whether the resistance markers induce broad-spectrum resistance of microorganisms and plants, and generate 'super bacteria' and 'super weeds' which cannot be killed by the existing antibiotics and herbicides; whether the use of resistance markers affects ecological balance and other potential negative effects. At present, people mainly solve the safety problem of the selection marker in transgenic plants from two directions: firstly, the mark is avoided or eliminated, the process is complex and difficult, and the mark cannot be generally adopted. The second is the development of a biologically safe selection marker. In recent years, scientists also propose to utilize the plant gene and the regulation and control original as selection markers of transgenic crops as much as possible, develop the green selection markers, eliminate the worry of people about the potential safety hazard of transgenic plants, and have good development prospects. For example, mannose-6-phosphate isomerase (PMI) derived from Escherichia coli converts mannose-6-phosphate into fructose-6-phosphate, and the PMI gene can be used as a potential selection marker gene.
The tomato transgenic industry is developed rapidly, people obviously have higher requirements on the safety of a marker gene, but no excellent and safe genetic transformation screening system exists at present, and the development of a safety marker gene derived from green algae for applying to tomato transgenic engineering is an urgent need.
Disclosure of Invention
The technical problem to be solved by the invention is as follows: provides a method and application of using green algae gene as tomato genetic transformation safety screening marker.
In order to achieve the above purpose of the present invention, the present invention provides the following technical solutions:
a method for adopting green alga PMI as a tomato genetic transformation screening marker gene, wherein the marker gene is the origin of green alga, and a screening agent is safe and nontoxic mannose, comprises the following steps:
cloning of PMI
Cloning a PMI phosphomannose isomerase gene from Chlorococcumsp by a PCR technology to obtain a safety marker gene, wherein the nucleotide sequence is shown as SEQ ID No. 1;
construction of expression vectors
After enzyme digestion, the marker gene is connected and introduced into a binary vector PBI121 to replace the original kana resistance gene NPT II, the new vector has no NPT II mark and carries a safety screening marker PMI, is named as PMI-pBI121, and is introduced into agrobacterium LBA4404 by adopting an electric shock transformation method;
genetic transformation of tomato
Transforming tomatoes by adopting an agrobacterium-mediated leaf disc method, culturing for 2 days, transferring into screening culture mediums containing mannose with different concentrations for screening culture, transferring into a rooting culture medium after budding, and rooting to obtain transgenic plants;
identification of transgenic tomato
PCR identification is carried out to determine whether the plant is a transgenic plant; chlorophenol red experiments verify whether the plants are transgenic plants.
According to the method for adopting the green alga PMI as the tomato genetic transformation screening marker gene, the green alga is Chlorococcumpsp.
According to the method for adopting the green alga PMI as the tomato genetic transformation screening marker gene, the antibiotic marker gene is deleted in the construction of the expression vector.
According to the method for adopting the green alga PMI as the tomato genetic transformation screening marker gene, the expression vector is PMI-PBI 121.
According to the method for adopting the green alga PMI as the tomato genetic transformation screening marker gene, the screening concentration of mannose is 6 g/L.
The invention also provides application of the method for adopting the green alga PMI as the tomato genetic transformation screening marker gene in establishment of transgenic tomatoes.
According to the application, the transgenic tomato is established by adopting the following method:
cloning of PMI: cloning a PMI phosphomannose isomerase gene from Chlorococcumsp by a PCR technology to obtain a safety marker gene, wherein the nucleotide sequence is shown as SEQ ID No. 1;
construction of expression vector: after enzyme digestion, the marker gene is connected and introduced into a binary vector PBI121 to replace the original kana resistance gene NPT II, the new vector has no NPT II mark and carries a safety screening marker PMI, is named as PMI-pBI121, and is introduced into agrobacterium LBA4404 by adopting an electric shock transformation method;
genetic transformation of tomato: transforming tomatoes by adopting an agrobacterium-mediated leaf disc method, culturing for 2 days, transferring into screening culture mediums containing mannose with different concentrations for screening culture, transferring into a rooting culture medium after budding, and rooting to obtain transgenic plants;
identification of transgenic tomato: identifying whether the plant is a transgenic plant by using PCR; chlorophenol red experiments verify whether the plants are transgenic plants.
The invention also provides a safety marker gene with a nucleotide sequence shown as SEQ ID NO.1, which is obtained by cloning PMI phosphomannose isomerase gene from Chlorococcums sp.
Compared with the prior art, the invention has the advantages that:
firstly, an ecological environment-friendly tomato genetic transformation safety screening and marking system originated from green algae is established: the PMI gene is amplified from green algae to construct a plant binary expression vector, then tomato is transformed, and a new tomato transformation system is established by taking edible mannose as a screening agent to obtain a transformed plant. Compared with the screening marker gene derived from other microorganisms, the PMI is derived from edible green algae, and the screening agent is safe and nontoxic, so that the PMI has food safety and ecological safety.
And secondly, the antibiotic marker gene is removed from the transformation vector, and the multiple cloning sites are reserved, so that the cloning of the exogenous gene is facilitated, and the transformation vector is a pure natural plant gene expression vector which can be used for genetic engineering.
Thirdly, as the tomato is used as a model plant, the high-efficiency broad-spectrum plant screening method can be applied to screening and transformation of other plants, and has wide prospect.
In a word, the PMI gene is cloned from unicellular chlorenchucumsp of a plant ancestor to be used as a selective marker gene of a new generation of a plant gene transfer technology, a novel screening method for positively screening transformed cells by taking mannose as a screening agent is established, the defects existing in the way that currently widely used antibiotics or herbicide-resistant genes and PMI genes derived from escherichia coli are used as marker genes can be replaced, the safety of food, biology and ecology is better possessed, the public worry about the safety of the marker genes can be relieved, and the development of the transgenic tomato industry is promoted.
Drawings
FIG. 1 is a schematic representation of the intermediate vector PTZ 57-P-T;
FIG. 2 is a schematic diagram of plant binary vector pBI 121;
FIG. 3 is a schematic diagram of the vector PTZ57-P-PMI-T after cloning of PMI into FIG. 1;
FIG. 4 is a schematic diagram of the PMI-pBI121 vector after cloning of PMI into FIG. 2;
FIG. 5 is a graph showing the effect of tomato cotyledons after 6 weeks growth on MS-induced recovery medium with different mannose concentrations: the a-d culture media respectively contain 0, 3, 6 and 9g/L mannose;
FIG. 6 is a schematic diagram of PMI-pBI121 transgenic tomato seedling cultivation: a is a growth diagram of cotyledons in a mannose induced germination MS culture medium of 6 g/L; b is 1-2cm bud; c is rooted positive bud; d is the transgenic tomato seedlings in the soil;
FIG. 7 is a schematic diagram of PCR detection of PMI-pBI121 transgenic tomato seedlings: WT is wild tomato, and 1-10 is transformed tomato;
FIG. 8 is a schematic diagram of chlorophenol red detection of PMI activity in transgenic leaves of PMI-pBI121 tomato.
Detailed Description
The present invention will be further described with reference to the following examples, which are not intended to limit the scope of the present invention.
Unless otherwise specified, the primer synthesis and DNA sequencing in the present invention were carried out by Shanghai Czeri bioengineering, Inc.; restriction enzyme, ligase, high purity plasmid miniprep kit, and DNA fragment recovery kit used in the present invention were purchased from NEB and operated according to the methods described in the specification.
Example 1
And (3) constructing a plant expression vector.
The intermediate vectors PTZ57-P-T (FIG. 1) and pBI121 (FIG. 2) into which NOS Promoter and NOS Terminator had been inserted in the multiple cloning site were preserved in this experiment.
Cloning of 1PMI Gene
According to the data of the green alga Chlorococcum sp after transcriptome sequencing in the laboratory, a full-length primer is designed by using software genetools: PMI F5 'GCGTCGACATGCTATCACTGGTGTGCCCAGCA3' PMI R5 'TTCGAGCTCCTACAGCTGGCGCGAACACCTTG 3' uses cDNA of chlorecoccumsp as a template, utilizes high fidelity enzyme to amplify a full-length gene, recovers a DNA fragment, sequences and identifies the DNA fragment for later use.
2 construction of transformation vector
The PMI recovered fragment and the intermediate vector PTZ57-P-T are recovered after double digestion by SalI and SacI respectively, are connected and transformed into Escherichia coli DH5 alpha, and a positive plasmid PTZ57-P-PMI-T (shown in figure 3) is extracted after PCR detection of bacterial liquid. PTZ57-P-PMI-T and pBI121 are respectively recovered after double enzyme digestion by Nhe I and Cla I, are connected and transformed into escherichia coli DH5 alpha, and positive plasmid PMI-pBI121 is extracted after PCR detection of bacterial liquid (figure 4). And after sequencing and identification, the PMI-pBI121 is transformed into an agrobacterium strain LBA4404, and tomato infection is reserved. The electric conversion instrument adopts a Bio-RadGene Pulser X cellTMThe electrotransfer conditions are as follows: 2.5KV, 25 muF capacitance, 400 omega resistance.
Example 2
And (4) determining the mannose concentration of tomato transformation screening.
Sterile cotyledons of tomatoes were cut to 0.5X 0.4cm in size and cultured in MS (Murashige and Skoog) callus induction medium (containing 0.05mg/L IAA +2mg/L ZT) supplemented with 0, 3, 6, 9g/L mannose, and the results showed that 6g/L mannose could significantly inhibit the occurrence of cotyledon callus without damaging the cotyledons themselves (FIG. 5), and this concentration was used as the selection concentration for tomato transformation.
Example 3
Genetic transformation of tomato.
1-leaf disc method for transforming tomato
The plasmid PMI-pBI121 is transformed into tomato by agrobacterium-mediated leaf disc transformation. Cutting sterile tomato cotyledon into size of 0.5 × 0.4cm, and pre-culturing on MS minimal medium for 2 days; infecting the pre-cultured cotyledon with Agrobacterium containing plasmid PMI-pBI121 for 10min, draining the filter paper, transferring the infected cotyledon into MS co-culture medium (containing 0.05mg/L IAA, 2mg/L ZT and 100 mu M AS), dark culturing for 1 day, and light culturing for 1 day; washing with MS liquid twice, transferring to MS culture medium (containing 0.1mg/L IAA +2mg/L ZT +6g/L mannose +300mg/L timentin), changing culture medium every 2 weeks, growing callus, transferring to MS culture medium (containing 0.05mg/L IAA +1mg/L ZT +6g/L mannose +300mg/L timentin); cutting off and transferring into MS rooting culture medium (containing 0.1mg/L IAA, 6g/L mannose and 100mg/L timentin) when the bud grows to 1-2 cm; after the root system is developed, the soil is transplanted for planting (figure 6).
2 detection of transformed tomato
The leaves of the transformed tomato are cut, DNA is extracted by a CTAB method, and then PCR detection is carried out by PMI primers (figure 7), so as to obtain positive plants.
For PCR identification of positive plant seedling leaves, the enzymatic activity of PMI in plants is detected by chlorophenol red color reaction, and the result shows that PMI in transgenic positive seedling leaves has higher activity (figure 8).
Sequence listing
<110> Kunming plant institute of Chinese academy of sciences
<120> method for selecting marker gene by using green alga PMI as tomato genetic transformation
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>1258
<212>DNA
<213> Green algae (Chlorococcum sp.)
<400>1
atgctatcac tggtgtgccc agcacaaaac tacgcctggg gaaggccggc tgcggagagt 60
gaggtcgcca agcttgcatc cttgaacggc tccgtggtcg atgattccaa gcctttcgcc 120
gaactctgga tggggacaca tcccagcggc ccagcagtgg tatcagggca taacaccaca 180
ctgaaggaat ggatccaggc acacccagaa gctcttggtg atgctgtctt gaaacgattt 240
ggtacagacc taccctacct gtttaaggtg ttgtcagtca agacagcact gtcaatccag 300
tcacaccctg acaaggcact ggcagagagg ctgcatgcac agaatcccaa agactacaag 360
ggcgacaacc acaagccgga gatggctctt gctcttgacg gctttgaggc gctgtgtggg 420
tttgtgtcag cagatgagct caagcaggcg ctcaaagcaa accccgagct caagctttgc 480
gtaggggagc ttgtcgcaaa tgccttcttg gaggtgcctg ctgatggtgc aaagtctgct 540
ctgaaggctg cctttacagc gctgatgacc tgtgacaccg ccaaggtgtc ggctgccatc 600
aactccctgg tgcagcgcct gagccaggag gcagcagcag gcaggcagct cagtggcaag 660
gaacagctgc tgctcaggct caatgagcag tatcccaatg atgttggagt actgtcagca 720
tttttcttga atcaggttag gctgaacaat ggtgaagcca tctacctggc tgccaatgag 780
cctcatgcat atgtatctgg tgaactcgtg gagtgcatgg ccgccagtga caatgtcatc 840
agggcgggac tcacacctaa gttcagggat actgaagtgc tgtgtgacag cctcacatac 900
aacacgggag tgccagaagt cctcaagggc gaacgtatcc acgatcacgt caaagtgtac 960
cggccaccct tcgaagagtt cgagatccag cgcatggagg tgccagcggg ggagtctgta 1020
gcagcaccaa caaaccctgg gcctctgttg ttgcttgtgg accgaggtgc aggcactgca 1080
gaagcagcag cggcagctgg catgaaaggc gatggcctgc agcagcaagt agagctccat 1140
cgcggtagca tattgttcgt gccggctgcc actgggttgt cattcacggc ctctgctacg 1200
gacggcctga caatgtgggc agctgcttgc aatgccaagg tgttcgcgcc agctgtag 1258
Claims (8)
1. A method for adopting green alga PMI as a tomato genetic transformation screening marker gene is characterized in that the marker gene is the origin of green alga, and a screening agent is safe and nontoxic mannose, and the method comprises the following steps:
(1) cloning of PMI
Cloning a PMI phosphomannose isomerase gene from Chlorococcum sp by a PCR technology to obtain a safety marker gene, wherein a nucleotide sequence is shown as a sequence table SEQ ID NO. 1;
(2) construction of expression vectors
After enzyme digestion, the marker gene is connected and introduced into a binary vector PBI121 to replace the original kana resistance gene NPT II, the new vector has no NPT II mark and carries a safety screening marker PMI, is named as PMI-pBI121, and is introduced into agrobacterium LBA4404 by adopting an electric shock transformation method;
(3) genetic transformation of tomato
Transforming tomatoes by adopting an agrobacterium-mediated leaf disc method, culturing for 2 days, transferring into screening culture mediums containing mannose with different concentrations for screening culture, transferring into a rooting culture medium after budding, and rooting to obtain transgenic plants;
(4) identification of transgenic tomato
PCR identification is carried out to determine whether the plant is a transgenic plant; chlorophenol red experiments verify whether the plants are transgenic plants.
2. The method of claim 1, wherein the green algae is Chlorococcumsp.
3. The method of claim 1, wherein the expression vector is constructed by deleting an antibiotic marker gene.
4. The method of claim 1, wherein the expression vector is PMI-PBI 121.
5. The method of claim 1, wherein the mannose concentration is 6 g/L.
6. The use of the method of claim 1 for the construction of transgenic tomato using the green alga PMI as a marker gene for genetic transformation in tomato.
7. The use of the method of claim 6 for the construction of transgenic tomato using the PMI from green algae as a marker gene for genetic transformation screening of tomato, characterized in that the transgenic tomato is constructed by the following method:
cloning of PMI: cloning a PMI phosphomannose isomerase gene from Chlorococcum sp by a PCR technology to obtain a safety marker gene, wherein a nucleotide sequence is shown as a sequence table SEQ ID NO. 1;
construction of expression vector: after enzyme digestion, the marker gene is connected and introduced into a binary vector PBI121 to replace the original kana resistance gene NPT II, the new vector has no NPT II mark and carries a safety screening marker PMI, is named as PMI-pBI121, and is introduced into agrobacterium LBA4404 by adopting an electric shock transformation method;
genetic transformation of tomato: transforming tomatoes by adopting an agrobacterium-mediated leaf disc method, culturing for 2 days, transferring into screening culture mediums containing mannose with different concentrations for screening culture, transferring into a rooting culture medium after budding, and rooting to obtain transgenic plants;
identification of transgenic tomato: identifying whether the plant is a transgenic plant by using PCR; chlorophenol red experiments verify whether the plants are transgenic plants.
8. A security marker gene having a nucleotide sequence shown in SEQ ID No.1, which is obtained by cloning a PMI phosphomannose isomerase gene of Chlorococcum sp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911015798.6A CN110699370B (en) | 2019-10-24 | 2019-10-24 | Method for adopting green alga PMI as tomato genetic transformation screening marker gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911015798.6A CN110699370B (en) | 2019-10-24 | 2019-10-24 | Method for adopting green alga PMI as tomato genetic transformation screening marker gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110699370A true CN110699370A (en) | 2020-01-17 |
| CN110699370B CN110699370B (en) | 2022-12-02 |
Family
ID=69200405
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911015798.6A Active CN110699370B (en) | 2019-10-24 | 2019-10-24 | Method for adopting green alga PMI as tomato genetic transformation screening marker gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110699370B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104531656A (en) * | 2015-01-05 | 2015-04-22 | 安徽省农业科学院水稻研究所 | Phosphomannose isomerase from chlorella variabilis and application thereof |
| CN104805103A (en) * | 2015-04-07 | 2015-07-29 | 安徽省农业科学院水稻研究所 | Phosphomannose isomerase gene OsPMI1 originated from oryza sativa and application thereof |
| CN110358788A (en) * | 2019-06-25 | 2019-10-22 | 中国农业科学院作物科学研究所 | It is a kind of using PMI as the genetic transformation method for soybean of screening-gene |
-
2019
- 2019-10-24 CN CN201911015798.6A patent/CN110699370B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104531656A (en) * | 2015-01-05 | 2015-04-22 | 安徽省农业科学院水稻研究所 | Phosphomannose isomerase from chlorella variabilis and application thereof |
| CN104805103A (en) * | 2015-04-07 | 2015-07-29 | 安徽省农业科学院水稻研究所 | Phosphomannose isomerase gene OsPMI1 originated from oryza sativa and application thereof |
| CN110358788A (en) * | 2019-06-25 | 2019-10-22 | 中国农业科学院作物科学研究所 | It is a kind of using PMI as the genetic transformation method for soybean of screening-gene |
Non-Patent Citations (1)
| Title |
|---|
| 查琳等: "利用PMI选择标记进行杨树转基因体系的研究", 《林业科学研究》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110699370B (en) | 2022-12-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105543270A (en) | Double resistance CRISPR/Cas9 carrier and application | |
| CN104292317A (en) | Drought resistant correlative protein of plant and coding gene and application thereof | |
| CN102776228A (en) | Application of Arabidopsis transcription factor in breeding drought-resistant salt-tolerant rice | |
| CN113337520A (en) | Upland cotton GhA0749 and GhD0744 transcription factors and application thereof in flowering regulation | |
| CN114752599B (en) | Verticillium dahliae VdNRPS3 gene antipathogen target gene fragment, interference vector and application thereof | |
| CN110004156A (en) | GhCML20 gene relevant to resistance to verticillium wilt and its application | |
| CN103620039A (en) | Hkt protein of cotton and coding gene and application thereof | |
| CN103299895A (en) | Rapid creation method of cytoplasmic male sterility (CMS) line | |
| CN105039345B (en) | The clone of miRNA for enhancing mulberry tree salt resistance ability a kind of and its application | |
| CN106397556B (en) | Plant drought GAP-associated protein GAP ZmNAC111 and its encoding gene and application | |
| CN112359049A (en) | Lilium regale chitinase gene LrCHI2 and application thereof | |
| CN110699370B (en) | Method for adopting green alga PMI as tomato genetic transformation screening marker gene | |
| CN107365772B (en) | Plant pollen specific promoter PSP1 and application thereof | |
| CN108795927A (en) | The clone of common wheat gene TaSPX3 coded sequences and its application | |
| Mu et al. | Agrobacterium-mediated transformation and plant regeneration in Chinese dwarf cherry [Cerasus humilis (Bge.) Sok] | |
| CN104513825B (en) | Wheat salt-tolerant gene TaNAS1 and application thereof | |
| CN108424910A (en) | A kind of RNA segments and its application for target gene interference | |
| CN104628840B (en) | Plant stress tolerance related protein VrDREB2A, coding gene and application thereof | |
| CN103667342B (en) | A kind of method utilizing cotton cotyledon axillalry bud to prepare transgene cotton | |
| CN107022553A (en) | Chinese herbaceous peony HSP70 genes and its plant expression vector and application | |
| CN103014030B (en) | RNAi (Ribonucleic acid interference) carrier of three genes of collard DWARF, SP and GA20ox, and building method and application thereof | |
| Zhang et al. | An efficient regeneration protocol for Agrobacterium-mediated transformation of melon (Cucumis melo L.) | |
| CN105779476A (en) | Tea tree cold-proof gene CsSPMS and plant expression vector construction and application thereof | |
| CN105112423A (en) | Clone of miRNA for enhancing disease resistance of mulberry and application thereof | |
| CN105732785B (en) | Application of protein GhDHN1 in regulation and control of plant stress resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |