CN110684798A - Muscle-targeted minicircle DNA gene therapy - Google Patents
Muscle-targeted minicircle DNA gene therapy Download PDFInfo
- Publication number
- CN110684798A CN110684798A CN201910825998.1A CN201910825998A CN110684798A CN 110684798 A CN110684798 A CN 110684798A CN 201910825998 A CN201910825998 A CN 201910825998A CN 110684798 A CN110684798 A CN 110684798A
- Authority
- CN
- China
- Prior art keywords
- leu
- ser
- glu
- val
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/36—Blood coagulation or fibrinolysis factors
- A61K38/37—Factors VIII
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
- A61K38/482—Serine endopeptidases (3.4.21)
- A61K38/4846—Factor VII (3.4.21.21); Factor IX (3.4.21.22); Factor Xa (3.4.21.6); Factor XI (3.4.21.27); Factor XII (3.4.21.38)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0075—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/745—Blood coagulation or fibrinolysis factors
- C07K14/755—Factors VIII, e.g. factor VIII C (AHF), factor VIII Ag (VWF)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/644—Coagulation factor IXa (3.4.21.22)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/21—Serine endopeptidases (3.4.21)
- C12Y304/21022—Coagulation factor IXa (3.4.21.22)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
Abstract
The present application relates to muscle-targeted minicircle DNA gene therapy. In particular to a micro-ring DNA carrier for efficiently expressing therapeutic gene products in muscles for a long time. The micro-ring DNA carrier is matched with a muscle targeted delivery technology, and can efficiently express therapeutic gene products in muscles for a long time, so that the defects that the half-life period of protein drugs is limited and the curative effect cannot be sustained are overcome. The micro-ring DNA carrier can be used for treating common hereditary gene defect diseases or chronic diseases, and has the advantages of safety, effectiveness and low cost.
Description
Technical Field
The invention belongs to the field of biological medicine, and particularly relates to a Minicircle (MC) DNA vector, and more particularly relates to a muscle-targeted Minicircle DNA gene therapy.
Background
Protein drugs (including hormones and polypeptides) have been widely used in clinical treatment of various monogenic genetic diseases (monogenic disorders) and chronic diseases. However, the protein/hormone/polypeptide medicament has poor heat stability and is inconvenient to prepare and store; and its half-life in vivo is limited, and repeated administration is required. Especially for hereditary gene deficiency diseases and chronic diseases, long-term or lifetime administration is often needed, and the use of protein medicines is more inconvenient and the cost is hard to bear. The gene therapy can continuously express target gene products in vivo, and conveniently realizes the purpose of long-term therapy. The essence of gene therapy is that a gene vector carrying a target gene is delivered to a target organ/tissue of the body, and after the target gene enters a cell, the therapeutic gene product is continuously expressed by using a transcription/translation system of a host cell. The muscle (skeletal muscle) is close to the body surface and is composed of terminally differentiated muscle cells, and the transgene can persist once entering, so the gene therapy target tissue is ideal.
Gene vectors and the corresponding means of gene delivery are key to gene therapy. Genetic vectors include both viral and non-viral vectors. The viral vector can actively enter a host cell, is highly efficient in transfection, is a mainstream gene vector, and is represented by an Adeno-associated Virus (AAV) vector. In contrast, non-viral vectors, represented by plasmids, cannot actively enter host cells, and transfection in vivo is limited. The most similar protocol to the present invention is AAV vector-based or plasmid vector-based gene therapy. The viral vector represented by the AAV vector has strong virus shell immunogenicity, is easy to cause severe immune reaction, and has high safety risk. Furthermore, the carcinogenic and teratogenic risks associated with random integration of genes are not negligible. AAV vector gene has limited capacity, total package capacity of 4.7kb, no intrinsic ITR sequence, promoter, polyA and other control sequences are eliminated, and the target gene length is generally not over 3.5 kb. When the gene of interest is large, the AAV vector cannot be packaged. The biggest defect of the plasmid vector is low transfection efficiency in vivo and difficult continuous expression.
For the technical problems in the prior art, the micro-loop (MC) DNA has no immunogenicity, no gene integration risk and no limitation of the size of a target gene, overcomes the defect that plasmids cannot be expressed continuously, and can efficiently express therapeutic gene products in muscles for a long time by matching with a muscle targeted delivery technology.
Disclosure of Invention
The present invention relates to Minicircle (MC) DNA vectors, and muscle-targeted Minicircle DNA gene therapy.
The present invention provides a recombinant gene vector for expressing a therapeutic gene product, wherein the recombinant gene vector comprises a coding gene or a target gene of the gene product.
In one aspect, the gene product is selected from a protein, polypeptide or nucleic acid fragment. Preferably, the protein or polypeptide is selected from an antibody, a functional protein, a cytokine, an enzyme or a hormone, or the nucleic acid fragment is selected from a gene fragment, mRNA, siRNA, shRNA or miRNA.
In one aspect, the recombinant gene vector is selected from a non-viral vector or a viral vector. Preferably, the non-viral vector is selected from a standard plasmid or other circular expression cassette, or the viral vector is selected from a retroviral vector, a lentiviral vector, an adenoviral vector and an Adeno-associated Virus (AAV) vector.
In one aspect, the functional protein is selected from factor ix (fix), factor viii (fviii) or variants thereof. Preferably, FIX is selected from the group consisting of full-length, FIX-Padua mutant or FIX-KLW mutant. Preferably, FVIII is selected from the group consisting of full-length, B-domain deleted (B-domain deleted) factor VIII (BDD-FVIII) mutants and BDD-FVIII-FD mutants. The non-viral vector is selected from a micro-loop DNA vector, or the viral vector is selected from an adeno-associated viral vector.
In one aspect, the amino acid sequence of FIX is as set forth in SEQ ID NO: 3, the amino acid sequence of the FIX-Padua is shown as SEQ ID NO: 4, the amino acid sequence of FIX-KLW is shown as SEQ ID NO: 5, the amino acid sequence of the BDD-FVIII is shown in SEQ ID NO: 7 is shown in the specification; the amino acid sequence of the BDD-FVIII-FD is shown in SEQ ID NO: shown in fig. 8.
In one aspect, the FIX has a sequence identical to SEQ ID NO: 3, and has the same function as the former FIX, and has at least 90%, 95%, 98% or 99% homology of amino acid sequence; the FIX-Padua has the same sequence as SEQ ID NO: 4, and has the same function as the previous FIX, and has at least 90%, 95%, 98% or 99% homology of amino acid sequence; the FIX-KLW has a sequence similar to SEQ ID NO: 5, and has the same function as the previous FIX, and has at least 90%, 95%, 98% or 99% homology of amino acid sequence; the BDD-FVIII has a sequence identical to SEQ ID NO: 7, and has the same function as the previous BDD-FVIII, and an amino acid sequence having at least 90%, 95%, 98% or 99% homology to the sequence shown in fig. 7; the BDD-FVIII-FD has a nucleotide sequence identical to that of SEQ ID NO: 8, and has the same function as the previous BDD-FVIII, and an amino acid sequence which is at least 90%, 95%, 98% or 99% homologous to the sequence shown in figure 8.
In one aspect, the nucleotide sequence of the FIX-encoding gene is as set forth in SEQ ID NO: 9, the nucleotide sequence of the FIX-Padua coding gene is shown as SEQ ID NO: 10, the nucleotide sequence of the FIX-KLW coding gene is shown as SEQ ID NO: 11, the nucleotide sequence of the BDD-FVIII encoding gene is shown in SEQ ID NO: 12, the nucleotide sequence of the BDD-FVIII-FD encoding gene is shown in SEQ ID NO: shown at 13.
In one aspect, the FIX-encoding gene has a sequence identical to SEQ ID NO: 9, and the encoded FIX has the same function as the previous FIX; the FIX-Padua encoding gene has the nucleotide sequence similar to that of SEQ ID NO: 10, and the encoded FIX-Padua has the same function as the previous FIX-Padua; the FIX-KLW coding gene has a sequence similar to that of SEQ ID NO: 11, and the encoded FIX-KLW has the same function as the previous FIX-KLW; the BDD-FVIII encoding gene has a nucleotide sequence similar to that of SEQ ID NO: 12, and the encoded BDD-FVIII has the same function as the previous BDD-FVIII; the BDD-FVIII-FD encoding gene has a nucleotide sequence similar to that of SEQ ID NO: 13, and the encoded BDD-FVIII-FD has the same function as the previous BDD-FVIII.
The application also provides a preparation method of the recombinant gene vector, which comprises the following specific steps:
(1) respectively obtaining the coding gene of the gene product or the sequence of the target gene from the prior art;
(2) constructing a recombinant gene vector expressing the gene product according to the sequence in (1) above;
optionally, the step of (a) is carried out,
(3) identifying the expression level of the recombinant gene vector in vivo and detecting the therapeutic effect of the gene product on the relevant diseases;
the recombinant gene vector contains a coding gene or a target gene of the gene product.
In one aspect, the gene product is selected from a protein, polypeptide or nucleic acid fragment. Preferably, the protein or polypeptide is selected from an antibody, a functional protein, a cytokine, an enzyme or a hormone, or the nucleic acid fragment is selected from a gene fragment, mRNA, siRNA, shRNA or miRNA.
In one aspect, the recombinant gene vector is selected from a non-viral vector or a viral vector. Preferably, the non-viral vector is selected from a standard plasmid or other circular expression cassette, or the viral vector is selected from a retroviral vector, a lentiviral vector, an adenoviral vector and an adeno-associated viral vector.
In one aspect, the functional protein is selected from coagulation factor ix (fix), coagulation factor viii (fviii) or variants thereof, the non-viral vector is selected from a minicircle DNA vector, or the viral vector is selected from an adeno-associated viral vector.
In one aspect, FIX is selected from the group consisting of full-length, a FIX-Padua mutant or a FIX-KLW mutant; FVIII is selected from full-length, BDD-FVIII mutants or BDD-FVIII-FD mutants.
The present application also provides a host cell comprising the recombinant gene vector described previously.
In one aspect, the host cell comprises a bacterial cell, a yeast cell, an insect cell, or a mammalian cell.
The application also provides a pharmaceutical composition, which comprises the recombinant gene vector and a pharmaceutically acceptable carrier.
In one aspect, the pharmaceutical composition may be formulated into a pharmaceutical formulation according to conventional methods. In the preparation process, the recombinant gene vector is preferably mixed with a pharmaceutically acceptable carrier or diluted with a carrier. When the carrier serves as a diluent, it may be solid, semi-solid or liquid. The preparation is selected from tablet, pill, powder, capsule, suspension, emulsion, solution, aerosol, injectable solution, etc. Suitable carriers, excipients or diluents include water, lactose, dextrose, sucrose, sorbitol, mannitol, calcium silicate, cellulose, polyvinylpyrrolidone, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil and the like. The formulation may also include fillers, anticoagulants, lubricants, humectants, flavoring agents, emulsifiers, preservatives, and the like.
The application also provides the use of the recombinant gene vector, the host cell or the pharmaceutical composition in preparation of a medicament for treating diseases.
In one aspect, the disease is selected from a genetic gene deficiency disease or a chronic disease. Preferably, the genetic disease is selected from haemophilia a or B.
The present application also provides a method of treating a disease in a patient, the method comprising: (1) preparing a recombinant gene vector as described previously; or preparing a recombinant gene vector by performing the preparation method as described above; (2) high transgene expression in muscle (e.g., skeletal muscle) to produce a gene product sufficient to achieve a therapeutic effect by local delivery of an effective amount of the recombinant gene vector to the muscle (e.g., skeletal muscle).
The positive effects of the invention include: the micro-ring DNA carrier is matched with a muscle targeting delivery technology, and a therapeutic gene product can be efficiently expressed in muscles for a long time, so that the defects that the half-life period of the gene product (especially protein drugs) is limited and the curative effect cannot be sustained are overcome. After the hemophilia B mice are injected intramuscularly by FIX factor minicircle DNA carrier for 1 month, the blood coagulation effect of the hemophilia B mice is consistent with that of wild mice. Therefore, the micro-ring DNA vector has good prospect for treating hereditary gene defect diseases or chronic diseases, and provides a new clinical thought.
Drawings
FIG. 1: the minicircle DNA empty vector pmc. DTS-CMVmax, contains attB and attP recombination sites, 32 tandem repeats of I-SceI cleavage sites (I-SceI × 32), kana resistance gene, SV40DNA nuclear targeting sequence (DNA nuclear targeting sequence, DTS), CMV promoter/enhancer, chimeric intron (chimeric intron), Multiple Cloning Site (MCS), bovine growth factor (bGH) poly a signal.
FIG. 2: FIX factor minicircle DNA vector map.
FIG. 3: BDD-FVIII factor minicircle DNA vector maps.
FIG. 4: mice are injected with FIX factor micro-ring DNA carrier or BDD-FVIII micro-ring DNA intramuscularly, and ELISA detects the expression level of plasma FIX factor or BDD-FVIII factor.
FIG. 5: after FIX factor micro-ring DNA vector is injected into muscle for 1 month, a tail-clipping assay (tail-clip assay) is used for detecting the blood coagulation effect of bleeding of hemophilia B mice and wild mice.
Detailed Description
Example 1 micro-circular DNA Master plasmid construction
1) Full-length FIX and BDD-FVIII gene DNA fragments were synthesized (as shown in SEQ ID NO: 9-13).
2) The DNA fragment is subcloned into a micro-circular DNA empty vector pMC.DTS-CMVmax (map is shown in figure 1) to construct a micro-circular DNA mother plasmid.
Example 2 micro-Loop DNA preparation
1) Minicircle DNA mother plasmid transformed genetically engineered E coli bacterium ZYCY10P3S2T (Nature Biotechnology2010,28: 1287-9).
2) ZYCY10P3S2T containing minicircle mother plasmid is inoculated into TB culture medium containing kana, and shake culture is carried out at 37 ℃ for 12-16h, and a large amount of minicircle DNA mother plasmid is produced by thalli.
3) Adding an induction medium containing arabinose, and under the induction of the arabinose (shaking culture at 32 ℃ for 8h), ZYCY10P3S2T expresses a phi C31 recombinase and an endonuclease for recognizing an I-SceI site. The minicircle DNA mother plasmid undergoes DNA recombination at attB/attP recombination sites under the action of Φ C31 recombinase, forming two small circular DNA molecules: i) micro-ring DNA (only containing a target gene expression frame and 36-bp attR site); ii) a small loop consisting of plasmid backbone DNA (containing an I-SceI cleavage site). The small ring formed by the plasmid skeleton DNA and the non-recombined residual minicircle DNA mother plasmid are linearized under the action of I-SceI endonuclease, and then degraded by DNase, and only minicircle DNA is left in ZYCY10P3S2T bacteria.
4) The minicircle DNA was extracted using a plasmid extraction kit.
Example 3 validation of expression in minicircle DNA animals
1. Experimental procedure
1) FIX minicircle DNA and BDD-FVIII minicircle DNA C57BL/6 mice were injected intramuscularly.
2) Collecting blood at a predetermined time point and a fixed period, and separating blood plasma.
3) The ELISA kit detected plasma FIX factor and BDD-FVIII factor expression (see FIG. 3).
2. Results of the experiment
Single intramuscular injections of minicircles (mc.fix and mc.bdd-FVIII), FIX and BDD-FVIII were expressed continuously in mice for more than 40 days, plasma FIX concentrations were maintained at around 30ng/mL, and plasma BDD-FVIII was maintained at 2-3% of normal levels.
Example 4 micro-Loop DNA coagulation Activity assay
1. Experiment grouping
Mice were injected intramuscularly, in groups as shown in the following table:
| grouping | Mouse strain | Treatment method |
| Blank control group (N ═ 4) | F9-KO | Intramuscular injection of PBS (50. mu.l) |
| Micro-ring DNA experimental group (N ═ 4) | F9-KO | Intramuscular injection of MC.FIX (3. mu.g MC diluted in 50. mu.l PBS) |
| Normal control group (N ═ 4) | C57/BL6 | Without treatment |
C57/BL 6: normal clotting normal general mice; FIX knock-out mouse with genetic background of F9-KO C57/BL6 (hemophilia B mouse)
2. Bleeding time detection
Cutting 0.5cm from the mouse tip, and recording the bleeding time of the mouse every 30s until no red blood stain is seen on the filter paper after the bleeding is started, wherein the bleeding time is observed for 60min at the longest, and the bleeding time is calculated according to 60min after 60min (see figure 4).
3. Results of the experiment
Compared with a blank control group (PBS), 2 mice injected with MC.FIX micro-ring intramuscular hemophilia B have obviously shortened bleeding time (2/4), which is equivalent to the bleeding time of normal control mice, and the MC.FIX micro-ring intramuscular injection has obvious curative effect on hemophilia B.
The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be considered to be within the technical scope of the present invention, and the technical solutions and their concepts should be considered to be equivalent or modified within the technical scope of the present invention.
SEQUENCE LISTING
<110> Shenzhen Xinnuo micro-ring Biotech Limited
<120> muscle-targeted mini-circle DNA gene therapy
<130>CP11901190C
<160>13
<170>PatentIn version 3.3
<210>1
<211>28
<212>PRT
<213> FIX Signal peptide
<400>1
Met Gln Arg Val Asn Met Ile Met Ala Glu Ser Pro Gly Leu Ile Thr
1 5 10 15
Ile Cys Leu Leu Gly Tyr Leu Leu Ser Ala Glu Cys
20 25
<210>2
<211>18
<212>PRT
<213> FIX propeptide (propeptide)
<400>2
Thr Val Phe Leu Asp His Glu Asn Ala Asn Lys Ile Leu Asn Arg Pro
1 5 10 15
Lys Arg
<210>3
<211>461
<212>PRT
<213>FIX
<400>3
Met Gln Arg Val Asn Met Ile Met Ala Glu Ser Pro Gly Leu Ile Thr
1 5 10 15
Ile Cys Leu Leu Gly Tyr Leu Leu Ser Ala Glu Cys Thr Val Phe Leu
20 25 30
Asp His Glu Asn Ala Asn Lys Ile Leu Asn Arg Pro Lys Arg Tyr Asn
35 40 45
Ser Gly Lys Leu Glu Glu Phe Val Gln Gly Asn Leu Glu Arg Glu Cys
50 55 60
Met Glu Glu Lys Cys Ser Phe Glu Glu Ala Arg Glu Val Phe Glu Asn
65 70 75 80
Thr Glu Arg Thr Thr Glu Phe Trp Lys Gln Tyr Val Asp Gly Asp Gln
85 90 95
Cys Glu Ser Asn Pro Cys Leu Asn Gly Gly Ser Cys Lys Asp Asp Ile
100 105 110
Asn Ser Tyr Glu Cys Trp Cys Pro Phe Gly Phe Glu Gly Lys Asn Cys
115 120 125
Glu Leu Asp Val Thr Cys Asn Ile Lys Asn Gly Arg Cys Glu Gln Phe
130 135 140
Cys Lys Asn Ser Ala Asp Asn Lys Val Val Cys Ser Cys Thr Glu Gly
145 150 155 160
Tyr Arg Leu Ala Glu Asn Gln Lys Ser Cys Glu Pro Ala Val Pro Phe
165 170 175
Pro Cys Gly Arg Val Ser Val Ser Gln Thr Ser Lys Leu Thr Arg Ala
180 185 190
Glu Thr Val Phe Pro Asp Val Asp Tyr Val Asn Ser Thr Glu Ala Glu
195 200 205
Thr Ile Leu Asp Asn Ile Thr Gln Ser Thr Gln Ser Phe Asn Asp Phe
210 215 220
Thr Arg Val Val Gly Gly Glu Asp Ala Lys Pro Gly Gln Phe Pro Trp
225 230 235 240
Gln Val Val Leu Asn Gly Lys Val Asp Ala Phe Cys Gly Gly Ser Ile
245 250 255
Val Asn Glu Lys Trp Ile Val Thr Ala Ala His Cys Val Glu Thr Gly
260 265 270
Val Lys Ile Thr Val Val Ala Gly Glu His Asn Ile Glu Glu Thr Glu
275 280 285
His Thr Glu Gln Lys Arg Asn Val Ile Arg Ile Ile Pro His His Asn
290 295 300
Tyr Asn Ala Ala Ile Asn Lys Tyr Asn His Asp Ile Ala Leu Leu Glu
305 310 315 320
Leu Asp Glu Pro Leu Val Leu Asn Ser Tyr Val Thr Pro Ile Cys Ile
325 330 335
Ala Asp Lys Glu Tyr Thr Asn Ile Phe Leu Lys Phe Gly Ser Gly Tyr
340 345 350
Val Ser Gly Trp Gly Arg Val Phe His Lys Gly Arg Ser Ala Leu Val
355 360 365
Leu Gln Tyr Leu Arg Val Pro Leu Val Asp Arg Ala Thr Cys Leu Arg
370 375 380
Ser Thr Lys Phe Thr Ile Tyr Asn Asn Met Phe Cys Ala Gly Phe His
385 390 395 400
Glu Gly Gly Arg Asp Ser Cys Gln Gly Asp Ser Gly Gly Pro His Val
405 410 415
Thr Glu Val Glu Gly Thr Ser Phe Leu Thr Gly Ile Ile Ser Trp Gly
420 425 430
Glu Glu Cys Ala Met Lys Gly Lys Tyr Gly Ile Tyr Thr Lys Val Ser
435 440 445
Arg Tyr Val Asn Trp Ile Lys Glu Lys Thr Lys Leu Thr
450 455 460
<210>4
<211>461
<212>PRT
<213> FIX-Padua mutant
<400>4
Met Gln Arg Val Asn Met Ile Met Ala Glu Ser Pro Gly Leu Ile Thr
1 5 10 15
Ile Cys Leu Leu Gly Tyr Leu Leu Ser Ala Glu Cys Thr Val Phe Leu
20 25 30
Asp His Glu Asn Ala Asn Lys Ile Leu Asn Arg Pro Lys Arg Tyr Asn
35 40 45
Ser Gly Lys Leu Glu Glu Phe Val Gln Gly Asn Leu Glu Arg Glu Cys
50 55 60
Met Glu Glu Lys Cys Ser Phe Glu Glu Ala Arg Glu Val Phe Glu Asn
65 70 75 80
Thr Glu Arg Thr Thr Glu Phe Trp Lys Gln Tyr Val Asp Gly Asp Gln
85 90 95
Cys Glu Ser Asn Pro Cys Leu Asn Gly Gly Ser Cys Lys Asp Asp Ile
100 105 110
Asn Ser Tyr Glu Cys Trp Cys Pro Phe Gly Phe Glu Gly Lys Asn Cys
115 120 125
Glu Leu Asp Val Thr Cys Asn Ile Lys Asn Gly Arg Cys Glu Gln Phe
130 135 140
Cys Lys Asn Ser Ala Asp Asn Lys Val Val Cys Ser Cys Thr Glu Gly
145 150 155 160
Tyr Arg Leu Ala Glu Asn Gln Lys Ser Cys Glu Pro Ala Val Pro Phe
165 170 175
Pro Cys Gly Arg Val Ser Val Ser Gln Thr Ser Lys Leu Thr Arg Ala
180 185 190
Glu Thr Val Phe Pro Asp Val Asp Tyr Val Asn Ser Thr Glu Ala Glu
195 200 205
Thr Ile Leu Asp Asn Ile Thr Gln Ser Thr Gln Ser Phe Asn Asp Phe
210 215 220
Thr Arg Val Val Gly Gly Glu Asp Ala Lys Pro GlyGln Phe Pro Trp
225 230 235 240
Gln Val Val Leu Asn Gly Lys Val Asp Ala Phe Cys Gly Gly Ser Ile
245 250 255
Val Asn Glu Lys Trp Ile Val Thr Ala Ala His Cys Val Glu Thr Gly
260 265 270
Val Lys Ile Thr Val Val Ala Gly Glu His Asn Ile Glu Glu Thr Glu
275 280 285
His Thr Glu Gln Lys Arg Asn Val Ile Arg Ile Ile Pro His His Asn
290 295 300
Tyr Asn Ala Ala Ile Asn Lys Tyr Asn His Asp Ile Ala Leu Leu Glu
305 310 315 320
Leu Asp Glu Pro Leu Val Leu Asn Ser Tyr Val Thr Pro Ile Cys Ile
325 330 335
Ala Asp Lys Glu Tyr Thr Asn Ile Phe Leu Lys Phe Gly Ser Gly Tyr
340 345 350
Val Ser Gly Trp Gly Arg Val Phe His Lys Gly Arg Ser Ala Leu Val
355 360 365
Leu Gln Tyr Leu Arg Val Pro Leu Val Asp Arg Ala Thr Cys Leu Leu
370 375 380
Ser Thr Lys Phe Thr Ile Tyr Asn Asn Met Phe Cys Ala GlyPhe His
385 390 395 400
Glu Gly Gly Arg Asp Ser Cys Gln Gly Asp Ser Gly Gly Pro His Val
405 410 415
Thr Glu Val Glu Gly Thr Ser Phe Leu Thr Gly Ile Ile Ser Trp Gly
420 425 430
Glu Glu Cys Ala Met Lys Gly Lys Tyr Gly Ile Tyr Thr Lys Val Ser
435 440 445
Arg Tyr Val Asn Trp Ile Lys Glu Lys Thr Lys Leu Thr
450 455 460
<210>5
<211>461
<212>PRT
<213> FIX-KLW mutant
<400>5
Met Gln Arg Val Asn Met Ile Met Ala Glu Ser Pro Gly Leu Ile Thr
1 5 10 15
Ile Cys Leu Leu Gly Tyr Leu Leu Ser Ala Glu Cys Thr Val Phe Leu
20 25 30
Asp His Glu Asn Ala Asn Lys Ile Leu Asn Arg Pro Lys Arg Tyr Asn
35 40 45
Ser Gly Lys Leu Glu Glu Phe Lys Gln Gly Asn Leu Glu Arg Glu Cys
50 55 60
Met Glu Glu Lys Cys Ser Phe Glu Glu Ala Arg Glu Val Phe Glu Asn
65 70 75 80
Thr Glu Arg Thr Thr Glu Phe Trp Lys Gln Tyr Val Asp Gly Asp Gln
85 90 95
Cys Glu Ser Asn Pro Cys Leu Asn Gly Gly Ser Cys Lys Asp Asp Ile
100 105 110
Asn Ser Tyr Glu Cys Trp Cys Pro Phe Gly Phe Glu Gly Lys Asn Cys
115 120 125
Glu Leu Asp Val Thr Cys Asn Ile Lys Asn Gly Arg Cys Glu Gln Phe
130 135 140
Cys Lys Asn Ser Ala Asp Asn Lys Val Val Cys Ser Cys Thr Glu Gly
145 150 155 160
Tyr Arg Leu Ala Glu Asn Gln Lys Ser Cys Glu Pro Ala Val Pro Phe
165 170 175
Pro Cys Gly Arg Val Ser Val Ser Gln Thr Ser Lys Leu Thr Arg Ala
180 185 190
Glu Thr Val Phe Pro Asp Val Asp Tyr Val Asn Ser Thr Glu Ala Glu
195 200 205
Thr Ile Leu Asp Asn Ile Thr Gln Ser Thr Gln Ser Phe Asn Asp Phe
210 215 220
ThrArg Val Val Gly Gly Glu Asp Ala Lys Pro Gly Gln Phe Pro Trp
225 230 235 240
Gln Val Val Leu Asn Gly Lys Val Asp Ala Phe Cys Gly Gly Ser Ile
245 250 255
Val Asn Glu Lys Trp Ile Val Thr Ala Ala His Cys Val Glu Thr Gly
260 265 270
Val Lys Ile Thr Val Val Ala Gly Glu His Asn Ile Glu Glu Thr Glu
275 280 285
His Thr Glu Gln Lys Arg Asn Val Ile Arg Ile Ile Pro His His Asn
290 295 300
Tyr Asn Ala Ala Ile Asn Lys Tyr Asn His Asp Ile Ala Leu Leu Glu
305 310 315 320
Leu Asp Glu Pro Leu Val Leu Asn Ser Tyr Val Thr Pro Ile Cys Ile
325 330 335
Ala Asp Lys Glu Tyr Thr Asn Ile Phe Leu Lys Phe Gly Ser Gly Tyr
340 345 350
Val Ser Gly Trp Gly Arg Val Phe His Lys Gly Arg Ser Ala Leu Val
355 360 365
Leu Gln Tyr Leu Arg Val Pro Leu Val Asp Arg Ala Thr Cys Leu Leu
370 375 380
Ser Thr LysPhe Thr Ile Tyr Asn Asn Met Phe Cys Ala Gly Phe His
385 390 395 400
Glu Gly Gly Arg Asp Ser Cys Gln Gly Asp Ser Gly Gly Pro His Val
405 410 415
Thr Glu Val Glu Gly Thr Trp Phe Leu Thr Gly Ile Ile Ser Trp Gly
420 425 430
Glu Glu Cys Ala Met Lys Gly Lys Tyr Gly Ile Tyr Thr Lys Val Ser
435 440 445
Arg Tyr Val Asn Trp Ile Lys Glu Lys Thr Lys Leu Thr
450 455 460
<210>6
<211>19
<212>PRT
<213> FVIII Signal peptide
<400>6
Met Gln Ile Glu Leu Ser Thr Cys Phe Phe Leu Cys Leu Leu Arg Phe
1 5 10 15
Cys Phe Ser
<210>7
<211>1457
<212>PRT
<213>BDD-FVIII
<400>7
Met Gln Ile Glu Leu Ser Thr Cys Phe Phe Leu Cys Leu Leu Arg Phe
1 5 10 15
Cys Phe Ser Ala Thr Arg Arg Tyr Tyr Leu Gly Ala Val Glu Leu Ser
20 25 30
Trp Asp Tyr Met Gln Ser Asp Leu Gly Glu Leu Pro Val Asp Ala Arg
35 40 45
Phe Pro Pro Arg Val Pro Lys Ser Phe Pro Phe Asn Thr Ser Val Val
50 55 60
Tyr Lys Lys Thr Leu Phe Val Glu Phe Thr Asp His Leu Phe Asn Ile
65 70 75 80
Ala Lys Pro Arg Pro Pro Trp Met Gly Leu Leu Gly Pro Thr Ile Gln
85 90 95
Ala Glu Val Tyr Asp Thr Val Val Ile Thr Leu Lys Asn Met Ala Ser
100 105 110
His Pro Val Ser Leu His Ala Val Gly Val Ser Tyr Trp Lys Ala Ser
115 120 125
Glu Gly Ala Glu Tyr Asp Asp Gln Thr Ser Gln Arg Glu Lys Glu Asp
130 135 140
Asp Lys Val Phe Pro Gly Gly Ser His Thr Tyr Val Trp Gln Val Leu
145 150 155 160
Lys Glu Asn Gly Pro Met Ala Ser Asp Pro Leu Cys Leu Thr Tyr Ser
165 170 175
Tyr LeuSer His Val Asp Leu Val Lys Asp Leu Asn Ser Gly Leu Ile
180 185 190
Gly Ala Leu Leu Val Cys Arg Glu Gly Ser Leu Ala Lys Glu Lys Thr
195 200 205
Gln Thr Leu His Lys Phe Ile Leu Leu Phe Ala Val Phe Asp Glu Gly
210 215 220
Lys Ser Trp His Ser Glu Thr Lys Asn Ser Leu Met Gln Asp Arg Asp
225 230 235 240
Ala Ala Ser Ala Arg Ala Trp Pro Lys Met His Thr Val Asn Gly Tyr
245 250 255
Val Asn Arg Ser Leu Pro Gly Leu Ile Gly Cys His Arg Lys Ser Val
260 265 270
Tyr Trp His Val Ile Gly Met Gly Thr Thr Pro Glu Val His Ser Ile
275 280 285
Phe Leu Glu Gly His Thr Phe Leu Val Arg Asn His Arg Gln Ala Ser
290 295 300
Leu Glu Ile Ser Pro Ile Thr Phe Leu Thr Ala Gln Thr Leu Leu Met
305 310 315 320
Asp Leu Gly Gln Phe Leu Leu Phe Cys His Ile Ser Ser His Gln His
325 330 335
Asp Gly Met GluAla Tyr Val Lys Val Asp Ser Cys Pro Glu Glu Pro
340 345 350
Gln Leu Arg Met Lys Asn Asn Glu Glu Ala Glu Asp Tyr Asp Asp Asp
355 360 365
Leu Thr Asp Ser Glu Met Asp Val Val Arg Phe Asp Asp Asp Asn Ser
370 375 380
Pro Ser Phe Ile Gln Ile Arg Ser Val Ala Lys Lys His Pro Lys Thr
385 390 395 400
Trp Val His Tyr Ile Ala Ala Glu Glu Glu Asp Trp Asp Tyr Ala Pro
405 410 415
Leu Val Leu Ala Pro Asp Asp Arg Ser Tyr Lys Ser Gln Tyr Leu Asn
420 425 430
Asn Gly Pro Gln Arg Ile Gly Arg Lys Tyr Lys Lys Val Arg Phe Met
435 440 445
Ala Tyr Thr Asp Glu Thr Phe Lys Thr Arg Glu Ala Ile Gln His Glu
450 455 460
Ser Gly Ile Leu Gly Pro Leu Leu Tyr Gly Glu Val Gly Asp Thr Leu
465 470 475 480
Leu Ile Ile Phe Lys Asn Gln Ala Ser Arg Pro Tyr Asn Ile Tyr Pro
485 490 495
His Gly Ile Thr Asp ValArg Pro Leu Tyr Ser Arg Arg Leu Pro Lys
500 505 510
Gly Val Lys His Leu Lys Asp Phe Pro Ile Leu Pro Gly Glu Ile Phe
515 520 525
Lys Tyr Lys Trp Thr Val Thr Val Glu Asp Gly Pro Thr Lys Ser Asp
530 535 540
Pro Arg Cys Leu Thr Arg Tyr Tyr Ser Ser Phe Val Asn Met Glu Arg
545 550 555 560
Asp Leu Ala Ser Gly Leu Ile Gly Pro Leu Leu Ile Cys Tyr Lys Glu
565 570 575
Ser Val Asp Gln Arg Gly Asn Gln Ile Met Ser Asp Lys Arg Asn Val
580 585 590
Ile Leu Phe Ser Val Phe Asp Glu Asn Arg Ser Trp Tyr Leu Thr Glu
595 600 605
Asn Ile Gln Arg Phe Leu Pro Asn Pro Ala Gly Val Gln Leu Glu Asp
610 615 620
Pro Glu Phe Gln Ala Ser Asn Ile Met His Ser Ile Asn Gly Tyr Val
625 630 635 640
Phe Asp Ser Leu Gln Leu Ser Val Cys Leu His Glu Val Ala Tyr Trp
645 650 655
Tyr Ile Leu Ser Ile Gly Ala GlnThr Asp Phe Leu Ser Val Phe Phe
660 665 670
Ser Gly Tyr Thr Phe Lys His Lys Met Val Tyr Glu Asp Thr Leu Thr
675 680 685
Leu Phe Pro Phe Ser Gly Glu Thr Val Phe Met Ser Met Glu Asn Pro
690 695 700
Gly Leu Trp Ile Leu Gly Cys His Asn Ser Asp Phe Arg Asn Arg Gly
705 710 715 720
Met Thr Ala Leu Leu Lys Val Ser Ser Cys Asp Lys Asn Thr Gly Asp
725 730 735
Tyr Tyr Glu Asp Ser Tyr Glu Asp Ile Ser Ala Tyr Leu Leu Ser Lys
740 745 750
Asn Asn Ala Ile Glu Pro Arg Ser Phe Ser Gln Asn Pro Pro Val Leu
755 760 765
Lys Arg His Gln Arg Glu Ile Thr Arg Thr Thr Leu Gln Ser Asp Gln
770 775 780
Glu Glu Ile Asp Tyr Asp Asp Thr Ile Ser Val Glu Met Lys Lys Glu
785 790 795 800
Asp Phe Asp Ile Tyr Asp Glu Asp Glu Asn Gln Ser Pro Arg Ser Phe
805 810 815
Gln Lys Lys Thr Arg His Tyr Phe Ile AlaAla Val Glu Arg Leu Trp
820 825 830
Asp Tyr Gly Met Ser Ser Ser Pro His Val Leu Arg Asn Arg Ala Gln
835 840 845
Ser Gly Ser Val Pro Gln Phe Lys Lys Val Val Phe Gln Glu Phe Thr
850 855 860
Asp Gly Ser Phe Thr Gln Pro Leu Tyr Arg Gly Glu Leu Asn Glu His
865 870 875 880
Leu Gly Leu Leu Gly Pro Tyr Ile Arg Ala Glu Val Glu Asp Asn Ile
885 890 895
Met Val Thr Phe Arg Asn Gln Ala Ser Arg Pro Tyr Ser Phe Tyr Ser
900 905 910
Ser Leu Ile Ser Tyr Glu Glu Asp Gln Arg Gln Gly Ala Glu Pro Arg
915 920 925
Lys Asn Phe Val Lys Pro Asn Glu Thr Lys Thr Tyr Phe Trp Lys Val
930 935 940
Gln His His Met Ala Pro Thr Lys Asp Glu Phe Asp Cys Lys Ala Trp
945 950 955 960
Ala Tyr Phe Ser Asp Val Asp Leu Glu Lys Asp Val His Ser Gly Leu
965 970 975
Ile Gly Pro Leu Leu Val Cys His Thr Asn Thr LeuAsn Pro Ala His
980 985 990
Gly Arg Gln Val Thr Val Gln Glu Phe Ala Leu Phe Phe Thr Ile Phe
995 1000 1005
Asp Glu Thr Lys Ser Trp Tyr Phe Thr Glu Asn Met Glu Arg Asn
1010 1015 1020
Cys Arg Ala Pro Cys Asn Ile Gln Met Glu Asp Pro Thr Phe Lys
1025 1030 1035
Glu Asn Tyr Arg Phe His Ala Ile Asn Gly Tyr Ile Met Asp Thr
1040 1045 1050
Leu Pro Gly Leu Val Met Ala Gln Asp Gln Arg Ile Arg Trp Tyr
1055 1060 1065
Leu Leu Ser Met Gly Ser Asn Glu Asn Ile His Ser Ile His Phe
1070 1075 1080
Ser Gly His Val Phe Thr Val Arg Lys Lys Glu Glu Tyr Lys Met
1085 1090 1095
Ala Leu Tyr Asn Leu Tyr Pro Gly Val Phe Glu Thr Val Glu Met
1100 1105 1110
Leu Pro Ser Lys Ala Gly Ile Trp Arg Val Glu Cys Leu Ile Gly
1115 1120 1125
Glu His Leu His Ala Gly Met Ser Thr Leu Phe Leu Val Tyr Ser
1130 11351140
Asn Lys Cys Gln Thr Pro Leu Gly Met Ala Ser Gly His Ile Arg
1145 1150 1155
Asp Phe Gln Ile Thr Ala Ser Gly Gln Tyr Gly Gln Trp Ala Pro
1160 1165 1170
Lys Leu Ala Arg Leu His Tyr Ser Gly Ser Ile Asn Ala Trp Ser
1175 1180 1185
Thr Lys Glu Pro Phe Ser Trp Ile Lys Val Asp Leu Leu Ala Pro
1190 1195 1200
Met Ile Ile His Gly Ile Lys Thr Gln Gly Ala Arg Gln Lys Phe
1205 1210 1215
Ser Ser Leu Tyr Ile Ser Gln Phe Ile Ile Met Tyr Ser Leu Asp
1220 1225 1230
Gly Lys Lys Trp Gln Thr Tyr Arg Gly Asn Ser Thr Gly Thr Leu
1235 1240 1245
Met Val Phe Phe Gly Asn Val Asp Ser Ser Gly Ile Lys His Asn
1250 1255 1260
Ile Phe Asn Pro Pro Ile Ile Ala Arg Tyr Ile Arg Leu His Pro
1265 1270 1275
Thr His Tyr Ser Ile Arg Ser Thr Leu Arg Met Glu Leu Met Gly
1280 1285 1290
Cys Asp Leu Asn Ser Cys Ser Met Pro Leu Gly Met Glu Ser Lys
1295 1300 1305
Ala Ile Ser Asp Ala Gln Ile Thr Ala Ser Ser Tyr Phe Thr Asn
1310 1315 1320
Met Phe Ala Thr Trp Ser Pro Ser Lys Ala Arg Leu His Leu Gln
1325 1330 1335
Gly Arg Ser Asn Ala Trp Arg Pro Gln Val Asn Asn Pro Lys Glu
1340 1345 1350
Trp Leu Gln Val Asp Phe Gln Lys Thr Met Lys Val Thr Gly Val
1355 1360 1365
Thr Thr Gln Gly Val Lys Ser Leu Leu Thr Ser Met Tyr Val Lys
1370 1375 1380
Glu Phe Leu Ile Ser Ser Ser Gln Asp Gly His Gln Trp Thr Leu
1385 1390 1395
Phe Phe Gln Asn Gly Lys Val Lys Val Phe Gln Gly Asn Gln Asp
1400 1405 1410
Ser Phe Thr Pro Val Val Asn Ser Leu Asp Pro Pro Leu Leu Thr
1415 1420 1425
Arg Tyr Leu Arg Ile His Pro Gln Ser Trp Val His Gln Ile Ala
1430 1435 1440
Leu Arg Met Glu Val Leu Gly Cys Glu Ala Gln Asp Leu Tyr
1445 1450 1455
<210>8
<211>1470
<212>PRT
<213> BDD-FVIII-FD mutants
<400>8
Met Gln Ile Glu Leu Ser Thr Cys Phe Phe Leu Cys Leu Leu Arg Phe
1 5 10 15
Cys Phe Ser Ala Thr Arg Arg Tyr Tyr Leu Gly Ala Val Glu Leu Ser
20 25 30
Trp Asp Tyr Met Gln Ser Asp Leu Gly Glu Leu Pro Val Asp Ala Arg
35 40 45
Phe Pro Pro Arg Val Pro Lys Ser Phe Pro Phe Asn Thr Ser Val Val
50 55 60
Tyr Lys Lys Thr Leu Phe Val Glu Phe Thr Asp His Leu Phe Asn Ile
65 70 75 80
Ala Lys Pro Arg Pro Pro Trp Met Gly Leu Leu Gly Pro Thr Ile Gln
85 90 95
Ala Glu Val Tyr Asp Thr Val Val Ile Thr Leu Lys Asn Met Ala Ser
100 105 110
His Pro Val Ser Leu His Ala Val Gly Val Ser Tyr Trp Lys Ala Ser
115 120 125
Glu Gly Ala Glu Tyr Asp Asp Gln Thr Ser Gln Arg Glu Lys Glu Asp
130135 140
Asp Lys Val Phe Pro Gly Gly Ser His Thr Tyr Val Trp Gln Val Leu
145 150 155 160
Lys Glu Asn Gly Pro Met Ala Ser Asp Pro Leu Cys Leu Thr Tyr Ser
165 170 175
Tyr Leu Ser His Val Asp Leu Val Lys Asp Leu Asn Ser Gly Leu Ile
180 185 190
Gly Ala Leu Leu Val Cys Arg Glu Gly Ser Leu Ala Lys Glu Lys Thr
195 200 205
Gln Thr Leu His Lys Phe Ile Leu Leu Phe Ala Val Phe Asp Glu Gly
210 215 220
Lys Ser Trp His Ser Glu Thr Lys Asn Ser Leu Met Gln Asp Arg Asp
225 230 235 240
Ala Ala Ser Ala Arg Ala Trp Pro Lys Met His Thr Val Asn Gly Tyr
245 250 255
Val Asn Arg Ser Leu Pro Gly Leu Ile Gly Cys His Arg Lys Ser Val
260 265 270
Tyr Trp His Val Ile Gly Met Gly Thr Thr Pro Glu Val His Ser Ile
275 280 285
Phe Leu Glu Gly His Thr Phe Leu Val Arg Asn His Arg Gln Ala Ser
290295 300
Leu Glu Ile Ser Pro Ile Thr Phe Leu Thr Ala Gln Thr Leu Leu Met
305 310 315 320
Asp Leu Gly Gln Phe Leu Leu Phe Cys His Ile Ser Ser His Gln His
325 330 335
Asp Gly Met Glu Ala Tyr Val Lys Val Asp Ser Cys Pro Glu Glu Pro
340 345 350
Gln Leu Arg Met Lys Asn Asn Glu Glu Ala Glu Asp Tyr Asp Asp Asp
355 360 365
Leu Thr Asp Ser Glu Met Asp Val Val Arg Phe Asp Asp Asp Asn Ser
370 375 380
Pro Ser Phe Ile Gln Ile Arg Ser Val Ala Lys Lys His Pro Lys Thr
385 390 395 400
Trp Val His Tyr Ile Ala Ala Glu Glu Glu Asp Trp Asp Tyr Ala Pro
405 410 415
Leu Val Leu Ala Pro Asp Asp Arg Ser Tyr Lys Ser Gln Tyr Leu Asn
420 425 430
Asn Gly Pro Gln Arg Ile Gly Arg Lys Tyr Lys Lys Val Arg Phe Met
435 440 445
Ala Tyr Thr Asp Glu Thr Phe Lys Thr Arg Glu Ala Ile Gln His Glu
450 455460
Ser Gly Ile Leu Gly Pro Leu Leu Tyr Gly Glu Val Gly Asp Thr Leu
465 470 475 480
Leu Ile Ile Phe Lys Asn Gln Ala Ser Arg Pro Tyr Asn Ile Tyr Pro
485 490 495
His Gly Ile Thr Asp Val Arg Pro Leu Tyr Ser Arg Arg Leu Pro Lys
500 505 510
Gly Val Lys His Leu Lys Asp Phe Pro Ile Leu Pro Gly Glu Ile Phe
515 520 525
Lys Tyr Lys Trp Thr Val Thr Val Glu Asp Gly Pro Thr Lys Ser Asp
530 535 540
Pro Arg Cys Leu Thr Arg Tyr Tyr Ser Ser Phe Val Asn Met Glu Arg
545 550 555 560
Asp Leu Ala Ser Gly Leu Ile Gly Pro Leu Leu Ile Cys Tyr Lys Glu
565 570 575
Ser Val Asp Gln Arg Gly Asn Gln Ile Met Ser Asp Lys Arg Asn Val
580 585 590
Ile Leu Phe Ser Val Phe Asp Glu Asn Arg Ser Trp Tyr Leu Thr Glu
595 600 605
Asn Ile Gln Arg Phe Leu Pro Asn Pro Ala Gly Val Gln Leu Glu Asp
610 615620
Pro Glu Phe Gln Ala Ser Asn Ile Met His Ser Ile Asn Gly Tyr Val
625 630 635 640
Phe Asp Ser Leu Gln Leu Ser Val Cys Leu His Glu Val Ala Tyr Trp
645 650 655
Tyr Ile Leu Ser Ile Gly Ala Gln Thr Asp Phe Leu Ser Val Phe Phe
660 665 670
Ser Gly Tyr Thr Phe Lys His Lys Met Val Tyr Glu Asp Thr Leu Thr
675 680 685
Leu Phe Pro Phe Ser Gly Glu Thr Val Phe Met Ser Met Glu Asn Pro
690 695 700
Gly Leu Trp Ile Leu Gly Cys His Asn Ser Asp Phe Arg Asn Arg Gly
705 710 715 720
Met Thr Ala Leu Leu Lys Val Ser Ser Cys Asp Lys Asn Thr Gly Asp
725 730 735
Tyr Tyr Glu Asp Ser Tyr Glu Asp Ile Ser Ala Tyr Leu Leu Ser Lys
740 745 750
Asn Asn Ala Ile Glu Pro Arg Ser Phe Ser Gln Asn Ala Thr Asn Val
755 760 765
Ser Asn Asn Ser Asn Thr Ser Asn Asp Ser Asn Val Ser Pro Pro Val
770 775780
Leu Lys Glu Ile Thr Arg Thr Thr Leu Gln Ser Asp Gln Glu Glu Ile
785 790 795 800
Asp Tyr Asp Asp Thr Ile Ser Val Glu Met Lys Lys Glu Asp Phe Asp
805 810 815
Ile Tyr Asp Glu Asp Glu Asn Gln Ser Pro Arg Ser Phe Gln Lys Lys
820 825 830
Thr Arg His Tyr Phe Ile Ala Ala Val Glu Arg Leu Trp Asp Tyr Gly
835 840 845
Met Ser Ser Ser Pro His Val Leu Arg Asn Arg Ala Gln Ser Gly Ser
850 855 860
Val Pro Gln Phe Lys Lys Val Val Phe Gln Glu Phe Thr Asp Gly Ser
865 870 875 880
Phe Thr Gln Pro Leu Tyr Arg Gly Glu Leu Asn Glu His Leu Gly Leu
885 890 895
Leu Gly Pro Tyr Ile Arg Ala Glu Val Glu Asp Asn Ile Met Val Thr
900 905 910
Phe Arg Asn Gln Ala Ser Arg Pro Tyr Ser Phe Tyr Ser Ser Leu Ile
915 920 925
Ser Tyr Glu Glu Asp Gln Arg Gln Gly Ala Glu Pro Arg Lys Asn Phe
930 935 940
Val Lys Pro Asn Glu Thr Lys Thr Tyr Phe Trp Lys Val Gln His His
945 950 955 960
Met Ala Pro Thr Lys Asp Glu Phe Asp Cys Lys Ala Trp Ala Tyr Phe
965 970 975
Ser Asp Val Asp Leu Glu Lys Asp Val His Ser Gly Leu Ile Gly Pro
980 985 990
Leu Leu Val Cys His Thr Asn Thr Leu Asn Pro Ala His Gly Arg Gln
995 1000 1005
Val Thr Val Gln Glu Phe Ala Leu Phe Phe Thr Ile Phe Asp Glu
1010 1015 1020
Thr Lys Ser Trp Tyr Phe Thr Glu Asn Met Glu Arg Asn Cys Arg
1025 1030 1035
Ala Pro Cys Asn Ile Gln Met Glu Asp Pro Thr Phe Lys Glu Asn
1040 1045 1050
Tyr Arg Phe His Ala Ile Asn Gly Tyr Ile Met Asp Thr Leu Pro
1055 1060 1065
Gly Leu Val Met Ala Gln Asp Gln Arg Ile Arg Trp Tyr Leu Leu
1070 1075 1080
Ser Met Gly Ser Asn Glu Asn Ile His Ser Ile His Phe Ser Gly
1085 1090 1095
His Val Phe Thr Val Arg Lys Lys Glu Glu Tyr Lys Met Ala Leu
1100 1105 1110
Tyr Asn Leu Tyr Pro Gly Val Phe Glu Thr Val Glu Met Leu Pro
1115 1120 1125
Ser Lys Ala Gly Ile Trp Arg Val Glu Cys Leu Ile Gly Glu His
1130 1135 1140
Leu His Ala Gly Met Ser Thr Leu Phe Leu Val Tyr Ser Asn Lys
1145 1150 1155
Cys Gln Thr Pro Leu Gly Met Ala Ser Gly His Ile Arg Asp Phe
1160 1165 1170
Gln Ile Thr Ala Ser Gly Gln Tyr Gly Gln Trp Ala Pro Lys Leu
1175 1180 1185
Ala Arg Leu His Tyr Ser Gly Ser Ile Asn Ala Trp Ser Thr Lys
1190 1195 1200
Glu Pro Phe Ser Trp Ile Lys Val Asp Leu Leu Ala Pro Met Ile
1205 1210 1215
Ile His Gly Ile Lys Thr Gln Gly Ala Arg Gln Lys Phe Ser Ser
1220 1225 1230
Leu Tyr Ile Ser Gln Phe Ile Ile Met Tyr Ser Leu Asp Gly Lys
1235 1240 1245
Lys Trp Gln Thr Tyr Arg Gly Asn Ser Thr Gly Thr Leu Met Val
1250 12551260
Phe Phe Gly Asn Val Asp Ser Ser Gly Ile Lys His Asn Ile Phe
1265 1270 1275
Asn Pro Pro Ile Ile Ala Arg Tyr Ile Arg Leu His Pro Thr His
1280 1285 1290
Tyr Ser Ile Arg Ser Thr Leu Arg Met Glu Leu Met Gly Cys Asp
1295 1300 1305
Leu Asn Ser Cys Ser Met Pro Leu Gly Met Glu Ser Lys Ala Ile
1310 1315 1320
Ser Asp Ala Gln Ile Thr Ala Ser Ser Tyr Phe Thr Asn Met Phe
1325 1330 1335
Ala Thr Trp Ser Pro Ser Lys Ala Arg Leu His Leu Gln Gly Arg
1340 1345 1350
Ser Asn Ala Trp Arg Pro Gln Val Asn Asn Pro Lys Glu Trp Leu
1355 1360 1365
Gln Val Asp Phe Gln Lys Thr Met Lys Val Thr Gly Val Thr Thr
1370 1375 1380
Gln Gly Val Lys Ser Leu Leu Thr Ser Met Tyr Val Lys Glu Phe
1385 1390 1395
Leu Ile Ser Ser Ser Gln Asp Gly His Gln Trp Thr Leu Phe Phe
1400 1405 1410
Gln Asn Gly Lys Val Lys Val Phe Gln Gly Asn Gln Asp Ser Phe
1415 1420 1425
Thr Pro Val Val Asn Ser Leu Asp Pro Pro Leu Leu Thr Arg Tyr
1430 1435 1440
Leu Arg Ile His Pro Gln Ser Trp Val His Gln Ile Ala Leu Arg
1445 1450 1455
Met Glu Val Leu Gly Cys Glu Ala Gln Asp Leu Tyr
1460 1465 1470
<210>9
<211>1386
<212>DNA
<213> FIX encoding Gene
<400>9
atgcagcgcg tgaacatgat catggcagaa tcaccaggcc tcatcaccat ctgcctttta 60
ggatatctac tcagtgctga atgtacagtt tttcttgatc atgaaaacgc caacaaaatt 120
ctgaatcggc caaagaggta taattcaggt aaattggaag agtttgttca agggaacctt 180
gagagagaat gtatggaaga aaagtgtagt tttgaagaag cacgagaagt ttttgaaaac 240
actgaaagaa caactgaatt ttggaagcag tatgttgatg gagatcagtg tgagtccaat 300
ccatgtttaa atggcggcag ttgcaaggat gacattaatt cctatgaatg ttggtgtccc 360
tttggatttg aaggaaagaa ctgtgaatta gatgtaacat gtaacattaa gaatggcaga 420
tgcgagcagt tttgtaaaaa tagtgctgat aacaaggtgg tttgctcctg tactgaggga 480
tatcgacttg cagaaaacca gaagtcctgt gaaccagcag tgccatttcc atgtggaaga 540
gtttctgttt cacaaacttc taagctcacc cgtgctgaga ctgtttttcc tgatgtggac 600
tatgtaaatt ctactgaagc tgaaaccatt ttggataaca tcactcaaag cacccaatca 660
tttaatgact tcacgcgtgt tgttggtgga gaagatgcca aaccaggtca attcccttgg 720
caggttgttt tgaatggtaa agttgatgca ttctgtggag gctctatcgt taatgaaaaa 780
tggattgtaa ctgctgccca ctgtgttgaa actggtgtta aaattacagt tgtcgccggc 840
gaacataata ttgaggagac agaacataca gagcaaaagc gaaatgtgat tcgaattatt 900
cctcaccaca actacaatgc agctattaat aagtacaacc atgacattgc ccttctggaa 960
ctggacgaac ccttagtgct aaacagctac gttacaccta tttgcattgc tgacaaggaa 1020
tacacgaaca tcttcctcaa atttggatct ggctatgtaa gtggctgggg aagagtcttc 1080
cacaaaggga gatcagcttt agttcttcag taccttagag ttccacttgt tgaccgagcc 1140
acatgtcttc gatctacaaa gttcaccatc tataacaaca tgttctgtgc tggcttccat 1200
gaaggaggta gagattcatg tcaaggagat agtgggggac cccatgttac tgaagtggaa 1260
gggaccagtt tcttaactgg aattattagc tggggtgaag agtgtgcaat gaaaggcaaa 1320
tatggaatat ataccaaggt atcccggtat gtcaactgga ttaaggaaaa aacaaagctc 1380
acttaa 1386
<210>10
<211>1386
<212>DNA
<213> FIX-Padua mutant encoding gene
<400>10
atgcagcgcg tgaacatgat catggcagaa tcaccaggcc tcatcaccat ctgcctttta 60
ggatatctac tcagtgctga atgtacagtt tttcttgatc atgaaaacgc caacaaaatt 120
ctgaatcggc caaagaggta taattcaggt aaattggaag agtttgttca agggaacctt 180
gagagagaat gtatggaaga aaagtgtagt tttgaagaag cacgagaagt ttttgaaaac 240
actgaaagaa caactgaatt ttggaagcag tatgttgatg gagatcagtg tgagtccaat 300
ccatgtttaa atggcggcag ttgcaaggat gacattaatt cctatgaatg ttggtgtccc 360
tttggatttg aaggaaagaa ctgtgaatta gatgtaacat gtaacattaa gaatggcaga 420
tgcgagcagt tttgtaaaaa tagtgctgat aacaaggtgg tttgctcctg tactgaggga 480
tatcgacttg cagaaaacca gaagtcctgt gaaccagcag tgccatttcc atgtggaaga 540
gtttctgttt cacaaacttc taagctcacc cgtgctgaga ctgtttttcc tgatgtggac 600
tatgtaaatt ctactgaagc tgaaaccatt ttggataaca tcactcaaag cacccaatca 660
tttaatgact tcacgcgtgt tgttggtgga gaagatgcca aaccaggtca attcccttgg 720
caggttgttt tgaatggtaa agttgatgca ttctgtggag gctctatcgt taatgaaaaa 780
tggattgtaa ctgctgccca ctgtgttgaa actggtgtta aaattacagt tgtcgccggc 840
gaacataata ttgaggagac agaacataca gagcaaaagc gaaatgtgat tcgaattatt 900
cctcaccaca actacaatgc agctattaat aagtacaacc atgacattgc ccttctggaa 960
ctggacgaac ccttagtgct aaacagctac gttacaccta tttgcattgc tgacaaggaa 1020
tacacgaaca tcttcctcaa atttggatct ggctatgtaa gtggctgggg aagagtcttc 1080
cacaaaggga gatcagcttt agttcttcag taccttagag ttccacttgt tgaccgagcc 1140
acatgtcttc tatctacaaa gttcaccatc tataacaaca tgttctgtgc tggcttccat 1200
gaaggaggta gagattcatg tcaaggagat agtgggggac cccatgttac tgaagtggaa 1260
gggaccagtt tcttaactgg aattattagc tggggtgaag agtgtgcaat gaaaggcaaa 1320
tatggaatat ataccaaggt atcccggtat gtcaactgga ttaaggaaaa aacaaagctc 1380
acttaa 1386
<210>11
<211>1386
<212>DNA
<213> FIX-KLW mutant encoding gene
<400>11
atgcagaggg tgaacatgat catggccgag agccctggcc tgatcacaat ctgcctgctg 60
ggctatctgc tgtccgccga gtgtaccgtg ttcctggacc acgagaacgc caataagatc 120
ctgaacaggc caaagagata caattctggc aagctggagg agtttaagca gggcaacctg 180
gagcgggagt gcatggagga gaagtgtagc ttcgaggagg ccagggaggt gtttgagaat 240
accgagagaa ccacagagtt ctggaagcag tatgtggacg gcgatcagtg cgagtccaac 300
ccctgtctga atggcggctc ttgcaaggac gatatcaaca gctacgagtg ctggtgtcct 360
ttcggctttg agggcaagaa ttgcgagctg gacgtgacat gtaacatcaa gaatggcagg 420
tgcgagcagt tttgtaagaa ctccgccgat aataaggtgg tgtgctcttg taccgagggc 480
tatagactgg ccgagaacca gaagtcttgc gagccagcag tgccattccc ttgtggacgg 540
gtgagcgtgt cccagacctc taagctgaca cgcgccgaga ccgtgtttcc cgacgtggat 600
tacgtgaata gcacagaggc cgagaccatc ctggacaaca tcacccagtc tacacagagc 660
ttcaatgact ttacaagggt ggtgggagga gaggatgcaa agccaggcca gttcccctgg 720
caggtggtgc tgaacggcaa ggtggatgcc ttttgcggcg gcagcatcgt gaatgagaag 780
tggatcgtga ccgcagcaca ctgcgtggag acaggcgtga agatcaccgt ggtggccggc 840
gagcacaaca tcgaggagac cgagcacaca gagcagaagc ggaatgtgat ccgcatcatc 900
ccccaccaca actacaatgc cgccatcaac aagtataatc acgacatcgc cctgctggag 960
ctggatgagc ctctggtgct gaactcctac gtgacaccaa tctgcatcgc cgacaaggag 1020
tataccaata tcttcctgaa gtttggatcc ggatacgtgt ctggatgggg aagggtgttc 1080
cacaagggca gaagcgccct ggtgctgcag tatctgaggg tgccactggt ggatagggca 1140
acctgtctgc tgtccaccaa gtttacaatc tacaacaata tgttctgcgc aggatttcac 1200
gagggaggaa gggacagctg tcagggcgat tccggaggac ctcacgtgac agaggtggag 1260
ggcacatggt tcctgaccgg catcatctcc tggggcgagg agtgtgccat gaagggcaag 1320
tacggcatct ataccaaggt gtctcgctac gtgaactgga tcaaggagaa gaccaagctg 1380
acatga 1386
<210>12
<211>4374
<212>DNA
<213> BDD-FVIII encoding Gene
<400>12
atgcagattg agctgagcac ctgcttcttc ctgtgcctgc tgaggttctg cttctctgcc 60
accaggagat actacctggg ggctgtggag ctgagctggg actacatgca gtctgacctg 120
ggggagctgc ctgtggatgc caggttcccc cccagagtgc ccaagagctt ccccttcaac 180
acctctgtgg tgtacaagaa gaccctgttt gtggagttca ctgaccacct gttcaacatt 240
gccaagccca ggcccccctg gatgggcctg ctgggcccca ccatccaggc tgaggtgtat 300
gacactgtgg tgatcaccct gaagaacatg gccagccacc ctgtgagcct gcatgctgtg 360
ggggtgagct actggaaggc ctctgagggg gctgagtatg atgaccagac cagccagagg 420
gagaaggagg atgacaaggt gttccctggg ggcagccaca cctatgtgtg gcaggtgctg 480
aaggagaatg gccccatggc ctctgacccc ctgtgcctga cctacagcta cctgagccat 540
gtggacctgg tgaaggacct gaactctggc ctgattgggg ccctgctggt gtgcagggag 600
ggcagcctgg ccaaggagaa gacccagacc ctgcacaagt tcatcctgct gtttgctgtg 660
tttgatgagg gcaagagctg gcactctgaa accaagaaca gcctgatgca ggacagggat 720
gctgcctctg ccagggcctg gcccaagatg cacactgtga atggctatgt gaacaggagc 780
ctgcctggcc tgattggctg ccacaggaag tctgtgtact ggcatgtgat tggcatgggc 840
accacccctg aggtgcacag catcttcctg gagggccaca ccttcctggt caggaaccac 900
aggcaggcca gcctggagat cagccccatc accttcctga ctgcccagac cctgctgatg 960
gacctgggcc agttcctgct gttctgccac atcagcagcc accagcatga tggcatggag 1020
gcctatgtga aggtggacag ctgccctgag gagccccagc tgaggatgaa gaacaatgag 1080
gaggctgagg actatgatga tgacctgact gactctgaga tggatgtggt gaggtttgat 1140
gatgacaaca gccccagctt catccagatc aggtctgtgg ccaagaagca ccccaagacc 1200
tgggtgcact acattgctgc tgaggaggaggactgggact atgcccccct ggtgctggcc 1260
cctgatgaca ggagctacaa gagccagtac ctgaacaatg gcccccagag gattggcagg 1320
aagtacaaga aggtcaggtt catggcctac actgatgaaa ccttcaagac cagggaggcc 1380
atccagcatg agtctggcat cctgggcccc ctgctgtatg gggaggtggg ggacaccctg 1440
ctgatcatct tcaagaacca ggccagcagg ccctacaaca tctaccccca tggcatcact 1500
gatgtgaggc ccctgtacag caggaggctg cccaaggggg tgaagcacct gaaggacttc 1560
cccatcctgc ctggggagat cttcaagtac aagtggactg tgactgtgga ggatggcccc 1620
accaagtctg accccaggtg cctgaccaga tactacagca gctttgtgaa catggagagg 1680
gacctggcct ctggcctgat tggccccctg ctgatctgct acaaggagtc tgtggaccag 1740
aggggcaacc agatcatgtc tgacaagagg aatgtgatcc tgttctctgt gtttgatgag 1800
aacaggagct ggtacctgac tgagaacatc cagaggttcc tgcccaaccc tgctggggtg 1860
cagctggagg accctgagtt ccaggccagc aacatcatgc acagcatcaa tggctatgtg 1920
tttgacagcc tgcagctgtc tgtgtgcctg catgaggtgg cctactggta catcctgagc 1980
attggggccc agactgactt cctgtctgtg ttcttctctg gctacacctt caagcacaag 2040
atggtgtatg aggacaccct gaccctgttc cccttctctg gggagactgt gttcatgagc 2100
atggagaacc ctggcctgtg gattctgggc tgccacaact ctgacttcag gaacaggggc 2160
atgactgccc tgctgaaagt ctccagctgt gacaagaaca ctggggacta ctatgaggac 2220
agctatgagg acatctctgc ctacctgctg agcaagaaca atgccattga gcccaggagc 2280
ttcagccaga atcccccagt gctgaagagg caccagaggg agatcaccag gaccaccctg 2340
cagtctgacc aggaggagat tgactatgat gacaccatct ctgtggagat gaagaaggag 2400
gactttgaca tctacgacga ggacgagaac cagagcccca ggagcttcca gaagaagacc 2460
aggcactact tcattgctgc tgtggagagg ctgtgggact atggcatgag cagcagcccc 2520
catgtgctga ggaacagggc ccagtctggc tctgtgcccc agttcaagaa ggtggtgttc 2580
caggagttca ctgatggcag cttcacccag cccctgtaca gaggggagct gaatgagcac 2640
ctgggcctgc tgggccccta catcagggct gaggtggagg acaacatcat ggtgaccttc 2700
aggaaccagg ccagcaggcc ctacagcttc tacagcagcc tgatcagcta tgaggaggac 2760
cagaggcagg gggctgagcc caggaagaac tttgtgaagc ccaatgaaac caagacctac 2820
ttctggaagg tgcagcacca catggccccc accaaggatg agtttgactg caaggcctgg 2880
gcctacttct ctgatgtgga cctggagaag gatgtgcact ctggcctgat tggccccctg 2940
ctggtgtgcc acaccaacac cctgaaccct gcccatggca ggcaggtgac tgtgcaggag 3000
tttgccctgt tcttcaccat ctttgatgaa accaagagct ggtacttcac tgagaacatg 3060
gagaggaact gcagggcccc ctgcaacatc cagatggagg accccacctt caaggagaac 3120
tacaggttcc atgccatcaa tggctacatc atggacaccc tgcctggcct ggtgatggcc 3180
caggaccaga ggatcaggtg gtacctgctg agcatgggca gcaatgagaa catccacagc 3240
atccacttct ctggccatgt gttcactgtg aggaagaagg aggagtacaa gatggccctg 3300
tacaacctgt accctggggt gtttgagact gtggagatgc tgcccagcaa ggctggcatc 3360
tggagggtgg agtgcctgat tggggagcac ctgcatgctg gcatgagcac cctgttcctg 3420
gtgtacagca acaagtgcca gacccccctg ggcatggcct ctggccacat cagggacttc 3480
cagatcactg cctctggcca gtatggccag tgggccccca agctggccag gctgcactac 3540
tctggcagca tcaatgcctg gagcaccaag gagcccttca gctggatcaa ggtggacctg 3600
ctggccccca tgatcatcca tggcatcaag acccaggggg ccaggcagaa gttcagcagc 3660
ctgtacatca gccagttcat catcatgtac agcctggatg gcaagaagtg gcagacctac 3720
aggggcaaca gcactggcac cctgatggtg ttctttggca atgtggacag ctctggcatc 3780
aagcacaaca tcttcaaccc ccccatcatt gccagataca tcaggctgca ccccacccac 3840
tacagcatca ggagcaccct gaggatggag ctgatgggct gtgacctgaa cagctgcagc 3900
atgcccctgg gcatggagag caaggccatc tctgatgccc agatcactgc cagcagctac 3960
ttcaccaaca tgtttgccac ctggagcccc agcaaggcca ggctgcacct gcagggcagg 4020
agcaatgcct ggaggcccca ggtcaacaac cccaaggagt ggctgcaggt ggacttccag 4080
aagaccatga aggtgactgg ggtgaccacc cagggggtga agagcctgct gaccagcatg 4140
tatgtgaagg agttcctgat cagcagcagc caggatggcc accagtggac cctgttcttc 4200
cagaatggca aggtgaaggt gttccagggc aaccaggaca gcttcacccc tgtggtgaac 4260
agcctggacc cccccctgct gaccagatac ctgaggattc acccccagag ctgggtgcac 4320
cagattgccc tgaggatgga ggtgctgggc tgtgaggccc aggacctgta ctga 4374
<210>13
<211>4413
<212>DNA
<213> BDD-FVIII-FD mutant encoding gene
<400>13
atgcagattg agctgagcac ctgcttcttc ctgtgcctgc tgaggttctg cttctctgcc 60
accaggagat actacctggg ggctgtggag ctgagctggg actacatgca gtctgacctg 120
ggggagctgc ctgtggatgc caggttcccc cccagagtgc ccaagagctt ccccttcaac 180
acctctgtgg tgtacaagaa gaccctgttt gtggagttca ctgaccacct gttcaacatt 240
gccaagccca ggcccccctg gatgggcctg ctgggcccca ccatccaggc tgaggtgtat 300
gacactgtgg tgatcaccct gaagaacatg gccagccacc ctgtgagcct gcatgctgtg 360
ggggtgagct actggaaggc ctctgagggg gctgagtatg atgaccagac cagccagagg 420
gagaaggagg atgacaaggt gttccctggg ggcagccaca cctatgtgtg gcaggtgctg 480
aaggagaatg gccccatggc ctctgacccc ctgtgcctga cctacagcta cctgagccat 540
gtggacctgg tgaaggacct gaactctggc ctgattgggg ccctgctggt gtgcagggag 600
ggcagcctgg ccaaggagaa gacccagacc ctgcacaagt tcatcctgct gtttgctgtg 660
tttgatgagg gcaagagctg gcactctgaa accaagaaca gcctgatgca ggacagggat 720
gctgcctctg ccagggcctg gcccaagatg cacactgtga atggctatgt gaacaggagc 780
ctgcctggcc tgattggctg ccacaggaag tctgtgtact ggcatgtgat tggcatgggc 840
accacccctg aggtgcacag catcttcctg gagggccaca ccttcctggt caggaaccac 900
aggcaggcca gcctggagat cagccccatc accttcctga ctgcccagac cctgctgatg 960
gacctgggcc agttcctgct gttctgccac atcagcagcc accagcatga tggcatggag 1020
gcctatgtga aggtggacag ctgccctgag gagccccagc tgaggatgaa gaacaatgag 1080
gaggctgagg actatgatga tgacctgact gactctgaga tggatgtggt gaggtttgat 1140
gatgacaaca gccccagctt catccagatc aggtctgtgg ccaagaagca ccccaagacc 1200
tgggtgcact acattgctgc tgaggaggag gactgggact atgcccccct ggtgctggcc 1260
cctgatgaca ggagctacaa gagccagtac ctgaacaatg gcccccagag gattggcagg 1320
aagtacaaga aggtcaggtt catggcctac actgatgaaa ccttcaagac cagggaggcc 1380
atccagcatg agtctggcat cctgggcccc ctgctgtatg gggaggtggg ggacaccctg 1440
ctgatcatct tcaagaacca ggccagcagg ccctacaaca tctaccccca tggcatcact 1500
gatgtgaggc ccctgtacag caggaggctg cccaaggggg tgaagcacct gaaggacttc 1560
cccatcctgc ctggggagat cttcaagtac aagtggactg tgactgtgga ggatggcccc 1620
accaagtctg accccaggtg cctgaccaga tactacagca gctttgtgaa catggagagg 1680
gacctggcct ctggcctgat tggccccctg ctgatctgct acaaggagtc tgtggaccag 1740
aggggcaacc agatcatgtc tgacaagagg aatgtgatcc tgttctctgt gtttgatgag 1800
aacaggagct ggtacctgac tgagaacatc cagaggttcc tgcccaaccc tgctggggtg 1860
cagctggagg accctgagtt ccaggccagc aacatcatgc acagcatcaa tggctatgtg 1920
tttgacagcc tgcagctgtc tgtgtgcctg catgaggtgg cctactggta catcctgagc 1980
attggggccc agactgactt cctgtctgtg ttcttctctg gctacacctt caagcacaag 2040
atggtgtatg aggacaccct gaccctgttc cccttctctg gggagactgt gttcatgagc 2100
atggagaacc ctggcctgtg gattctgggc tgccacaact ctgacttcag gaacaggggc 2160
atgactgccc tgctgaaagt ctccagctgt gacaagaaca ctggggacta ctatgaggac 2220
agctatgagg acatctctgc ctacctgctg agcaagaaca atgccattga gcccaggagc 2280
ttcagccaga atgccactaa tgtgtctaac aacagcaaca ccagcaatga cagcaatgtg 2340
tctcccccag tgctgaagga gatcaccagg accaccctgc agtctgacca ggaggagatt 2400
gactatgatg acaccatctc tgtggagatg aagaaggagg actttgacat ctacgacgag 2460
gacgagaacc agagccccag gagcttccag aagaagacca ggcactactt cattgctgct 2520
gtggagaggc tgtgggacta tggcatgagc agcagccccc atgtgctgag gaacagggcc 2580
cagtctggct ctgtgcccca gttcaagaag gtggtgttcc aggagttcac tgatggcagc 2640
ttcacccagc ccctgtacag aggggagctg aatgagcacc tgggcctgct gggcccctac 2700
atcagggctg aggtggagga caacatcatg gtgaccttca ggaaccaggc cagcaggccc 2760
tacagcttct acagcagcct gatcagctat gaggaggacc agaggcaggg ggctgagccc 2820
aggaagaact ttgtgaagcc caatgaaacc aagacctact tctggaaggt gcagcaccac 2880
atggccccca ccaaggatga gtttgactgc aaggcctggg cctacttctc tgatgtggac 2940
ctggagaagg atgtgcactc tggcctgatt ggccccctgc tggtgtgcca caccaacacc 3000
ctgaaccctg cccatggcag gcaggtgact gtgcaggagt ttgccctgtt cttcaccatc 3060
tttgatgaaa ccaagagctg gtacttcact gagaacatgg agaggaactg cagggccccc 3120
tgcaacatcc agatggagga ccccaccttc aaggagaact acaggttcca tgccatcaat 3180
ggctacatca tggacaccct gcctggcctg gtgatggccc aggaccagag gatcaggtgg 3240
tacctgctga gcatgggcag caatgagaac atccacagca tccacttctc tggccatgtg 3300
ttcactgtga ggaagaagga ggagtacaag atggccctgt acaacctgta ccctggggtg 3360
tttgagactg tggagatgct gcccagcaag gctggcatct ggagggtgga gtgcctgatt 3420
ggggagcacc tgcatgctgg catgagcacc ctgttcctgg tgtacagcaa caagtgccag 3480
acccccctgg gcatggcctc tggccacatc agggacttcc agatcactgc ctctggccag 3540
tatggccagt gggcccccaa gctggccagg ctgcactact ctggcagcat caatgcctgg 3600
agcaccaagg agcccttcag ctggatcaag gtggacctgc tggcccccat gatcatccat 3660
ggcatcaaga cccagggggc caggcagaag ttcagcagcc tgtacatcag ccagttcatc 3720
atcatgtaca gcctggatgg caagaagtgg cagacctaca ggggcaacag cactggcacc 3780
ctgatggtgt tctttggcaa tgtggacagc tctggcatca agcacaacat cttcaacccc 3840
cccatcattg ccagatacat caggctgcac cccacccact acagcatcag gagcaccctg 3900
aggatggagc tgatgggctg tgacctgaac agctgcagca tgcccctggg catggagagc 3960
aaggccatct ctgatgccca gatcactgcc agcagctact tcaccaacat gtttgccacc 4020
tggagcccca gcaaggccag gctgcacctg cagggcagga gcaatgcctg gaggccccag 4080
gtcaacaacc ccaaggagtg gctgcaggtg gacttccaga agaccatgaa ggtgactggg 4140
gtgaccaccc agggggtgaa gagcctgctg accagcatgt atgtgaagga gttcctgatc 4200
agcagcagcc aggatggcca ccagtggacc ctgttcttcc agaatggcaa ggtgaaggtg 4260
ttccagggca accaggacag cttcacccct gtggtgaaca gcctggacccccccctgctg 4320
accagatacc tgaggattca cccccagagc tgggtgcacc agattgccct gaggatggag 4380
gtgctgggct gtgaggccca ggacctgtac tga 4413
Claims (10)
1. A recombinant gene vector for expressing a therapeutic gene product, wherein the recombinant gene vector comprises a gene encoding the gene product or a gene of interest;
preferably, the gene product is selected from the group consisting of a protein, a polypeptide, or a nucleic acid fragment; more preferably, the protein or polypeptide is selected from an antibody, a functional protein, a cytokine, an enzyme or a hormone, or the nucleic acid fragment is selected from a gene fragment, mRNA, siRNA, shRNA or miRNA;
preferably, the recombinant gene vector is selected from a non-viral vector or a viral vector; more preferably, the non-viral vector is selected from a standard plasmid or other circular expression cassette, or the viral vector is selected from a retroviral vector, a lentiviral vector, an adenoviral vector and an adeno-associated viral vector.
2. The recombinant gene vector according to claim 1, wherein the functional protein is selected from the group consisting of coagulation Factor IX (FIX), coagulation Factor VIII (FVIII), and variants thereof; preferably, FIX is selected from the group consisting of full-length, FIX-Padua mutant or FIX-KLW mutant; preferably, FVIII is selected from full length, BDD-FVIII mutants or BDD-FVIII-FD mutants; the non-viral vector is selected from a micro-loop DNA vector, or the viral vector is selected from an adeno-associated viral vector.
3. The recombinant gene vector of claim 1 or 2, wherein the amino acid sequence of FIX is as set forth in SEQ ID NO: 3, the amino acid sequence of the FIX-Padua is shown as SEQ ID NO: 4, the amino acid sequence of the FIX-KLW is shown as SEQ ID NO: 5, the amino acid sequence of the BDD-FVIII is shown in SEQ ID NO: 7 is shown in the specification; the amino acid sequence of the BDD-FVIII-FD is shown in SEQ ID NO: shown in fig. 8.
4. The recombinant gene vector of claim 3, wherein the nucleotide sequence of the FIX encoding gene is as shown in SEQ ID NO: 9, the nucleotide sequence of the FIX-Padua coding gene is shown as SEQ ID NO: 10, the nucleotide sequence of the FIX-KLW coding gene is shown as SEQ ID NO: 11, the nucleotide sequence of the BDD-FVIII encoding gene is shown in SEQ ID NO: 12, the nucleotide sequence of the BDD-FVIII-FD encoding gene is shown in SEQ ID NO: shown at 13.
5. The method for preparing the recombinant gene vector according to any one of claims 1 to 4, comprising the steps of:
(1) respectively obtaining the coding gene of the gene product or the sequence of the target gene from the prior art;
(2) constructing a recombinant gene vector expressing the gene product according to the sequence in (1) above;
optionally, the step of (a) is carried out,
(3) identifying the expression level of the recombinant gene vector in vivo and detecting the therapeutic effect of the gene product on the relevant diseases;
the recombinant gene vector comprises a coding gene or a target gene of the gene product;
preferably, the gene product is selected from the group consisting of a protein, a polypeptide, or a nucleic acid fragment; more preferably, the protein or polypeptide is selected from an antibody, a functional protein, a cytokine, an enzyme or a hormone, or the nucleic acid fragment is selected from a gene fragment, mRNA, siRNA, shRNA or miRNA;
preferably, the recombinant gene vector is selected from a non-viral vector or a viral vector; more preferably, the non-viral vector is selected from a standard plasmid or other circular expression cassette, or the viral vector is selected from a retroviral vector, a lentiviral vector, an adenoviral vector and an adeno-associated viral vector.
6. The method according to claim 5, wherein the functional protein is selected from the group consisting of Factor IX (FIX), Factor VIII (FVIII), and variants thereof; the non-viral vector is selected from a micro-loop DNA vector, or the viral vector is selected from an adeno-associated viral vector;
preferably, FIX is selected from the group consisting of full-length, FIX-Padua mutant or FIX-KLW mutant; FVIII is selected from full-length, BDD-FVIII mutants or BDD-FVIII-FD mutants.
7. A host cell comprising the recombinant gene vector of any one of claims 1-4; preferably, the host cell comprises a bacterial cell, a yeast cell, an insect cell or a mammalian cell.
8. A pharmaceutical composition comprising the recombinant gene vector of any one of claims 1-4, and a pharmaceutically acceptable carrier.
9. Use of the recombinant gene vector of any one of claims 1-4, the host cell of claim 7, or the pharmaceutical composition of claim 8 in the manufacture of a medicament for the treatment of a disease;
preferably, the disease is selected from the group consisting of a genetic gene deficiency disease; more preferably, the genetic disease is selected from haemophilia a or B.
10. A method of treating a disease in a patient, the method comprising:
(1) preparing the recombinant gene vector according to any one of claims 1 to 4; or preparing a recombinant gene vector by performing the preparation method according to any one of claims 5 to 6;
(2) high transgene expression in muscle (e.g., skeletal muscle) to produce a gene product sufficient to achieve a therapeutic effect by local delivery of an effective amount of the recombinant gene vector to the muscle (e.g., skeletal muscle).
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910825998.1A CN110684798A (en) | 2019-09-03 | 2019-09-03 | Muscle-targeted minicircle DNA gene therapy |
| PCT/CN2020/108361 WO2021042944A1 (en) | 2019-09-03 | 2020-08-11 | Muscle-targeted minicircle dna gene therapy |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910825998.1A CN110684798A (en) | 2019-09-03 | 2019-09-03 | Muscle-targeted minicircle DNA gene therapy |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110684798A true CN110684798A (en) | 2020-01-14 |
Family
ID=69107743
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910825998.1A Pending CN110684798A (en) | 2019-09-03 | 2019-09-03 | Muscle-targeted minicircle DNA gene therapy |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN110684798A (en) |
| WO (1) | WO2021042944A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021042944A1 (en) * | 2019-09-03 | 2021-03-11 | 深圳新诺微环生物科技有限公司 | Muscle-targeted minicircle dna gene therapy |
| CN113336841A (en) * | 2021-06-02 | 2021-09-03 | 中国医学科学院血液病医院(中国医学科学院血液学研究所) | F8 protein variant and gene therapy vector prepared by using same |
| WO2024007978A1 (en) * | 2022-07-07 | 2024-01-11 | 深圳新诺微环生物科技有限公司 | Linker peptide, fviii protein containing linker peptide or variant thereof, and use thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2020351204A1 (en) | 2019-09-18 | 2022-04-21 | Intergalactic Therapeutics, Inc. | Synthetic DNA vectors and methods of use |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1361178A (en) * | 2000-12-29 | 2002-07-31 | 中国科学院上海生物化学研究所 | New recombinant blood coagulation factor VIII and its production process and medicinal composition |
| CN102112608A (en) * | 2008-07-28 | 2011-06-29 | 巴登－符滕堡－黑森Drk－献血服务有限责任公司 | Factor IX variants with clotting activity in absence of their cofactor and their use for treating bleeding disorders |
| CN105316314A (en) * | 2014-07-29 | 2016-02-10 | 深圳先进技术研究院 | High-purity minicircle DNA (deoxyribonucleic acid) and preparation method and application thereof |
| CN105316352A (en) * | 2014-07-29 | 2016-02-10 | 深圳先进技术研究院 | Carrier for adaptive expression target gene and its preparation method and application |
| CN108473976A (en) * | 2015-10-28 | 2018-08-31 | 桑格摩生物治疗股份有限公司 | Liver specificity construct, Factor IX expression cassette and its application method |
| WO2018217731A1 (en) * | 2017-05-22 | 2018-11-29 | Baxalta Incorporated | Viral vectors encoding recombinant fix with increased expression for gene therapy of hemophilia b |
| WO2019028192A1 (en) * | 2017-08-01 | 2019-02-07 | Spark Therapeutics, Inc. | Factor viii (fviii) gene therapy methods |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104342453A (en) * | 2013-08-06 | 2015-02-11 | 深圳先进技术研究院 | Minicircle DNA recombinant parent plasmid containing genetically engineered antibody gene expression cassette, minicircle DNA containing the expression cassette and application thereof |
| EP2881463A1 (en) * | 2013-12-09 | 2015-06-10 | DRK-Blutspendedienst Baden-Württemberg-Hessen gGmbH | Factor IX variants with clotting activity in absence of their cofactor and/or with increased F.IX clotting activity and their use for treating bleeding disorders |
| WO2019032898A1 (en) * | 2017-08-09 | 2019-02-14 | Bioverativ Therapeutics Inc. | Nucleic acid molecules and uses thereof |
| CN110684798A (en) * | 2019-09-03 | 2020-01-14 | 深圳新诺微环生物科技有限公司 | Muscle-targeted minicircle DNA gene therapy |
-
2019
- 2019-09-03 CN CN201910825998.1A patent/CN110684798A/en active Pending
-
2020
- 2020-08-11 WO PCT/CN2020/108361 patent/WO2021042944A1/en active Application Filing
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1361178A (en) * | 2000-12-29 | 2002-07-31 | 中国科学院上海生物化学研究所 | New recombinant blood coagulation factor VIII and its production process and medicinal composition |
| CN102112608A (en) * | 2008-07-28 | 2011-06-29 | 巴登－符滕堡－黑森Drk－献血服务有限责任公司 | Factor IX variants with clotting activity in absence of their cofactor and their use for treating bleeding disorders |
| CN105316314A (en) * | 2014-07-29 | 2016-02-10 | 深圳先进技术研究院 | High-purity minicircle DNA (deoxyribonucleic acid) and preparation method and application thereof |
| CN105316352A (en) * | 2014-07-29 | 2016-02-10 | 深圳先进技术研究院 | Carrier for adaptive expression target gene and its preparation method and application |
| CN108473976A (en) * | 2015-10-28 | 2018-08-31 | 桑格摩生物治疗股份有限公司 | Liver specificity construct, Factor IX expression cassette and its application method |
| WO2018217731A1 (en) * | 2017-05-22 | 2018-11-29 | Baxalta Incorporated | Viral vectors encoding recombinant fix with increased expression for gene therapy of hemophilia b |
| WO2019028192A1 (en) * | 2017-08-01 | 2019-02-07 | Spark Therapeutics, Inc. | Factor viii (fviii) gene therapy methods |
Non-Patent Citations (11)
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021042944A1 (en) * | 2019-09-03 | 2021-03-11 | 深圳新诺微环生物科技有限公司 | Muscle-targeted minicircle dna gene therapy |
| CN113336841A (en) * | 2021-06-02 | 2021-09-03 | 中国医学科学院血液病医院(中国医学科学院血液学研究所) | F8 protein variant and gene therapy vector prepared by using same |
| WO2024007978A1 (en) * | 2022-07-07 | 2024-01-11 | 深圳新诺微环生物科技有限公司 | Linker peptide, fviii protein containing linker peptide or variant thereof, and use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2021042944A1 (en) | 2021-03-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110684798A (en) | Muscle-targeted minicircle DNA gene therapy | |
| US20220323572A1 (en) | Coronavirus rna vaccines | |
| US20200038499A1 (en) | Rna bacterial vaccines | |
| CN110325199A (en) | For treating the gene therapy of phenylketonuria | |
| JP2024023294A (en) | CPF1-related methods and compositions for gene editing | |
| CN110904127A (en) | African swine fever virus vaccine | |
| US20230270841A1 (en) | Coronavirus vaccine | |
| CN112979829B (en) | Fusion protein and application thereof in preparation of vaccine targeting new coronavirus SARS-COV-2 | |
| CA3216490A1 (en) | Epstein-barr virus mrna vaccines | |
| AU7160296A (en) | DNA construct comprising a muscle specific regulatory element for immunization or gene therapy | |
| WO1997011190A9 (en) | Dna construct comprising a muscle specific regulatory element for immunization or gene therapy | |
| KR20210104661A (en) | Intein proteins and uses thereof | |
| CN114729009A (en) | AAV vector variants for ocular gene delivery | |
| KR20230093241A (en) | Compositions and methods for the treatment of neurological disorders associated with glucosylceramides beta deficiency | |
| KR20230003511A (en) | CRISPR-inhibition for facial scapular brachial muscular dystrophy | |
| JPH1142092A (en) | Human cardiac/cerebral toroidal protein | |
| CN108977464B (en) | Composition, medicine and sgRNA for improving blood coagulation activity of patients with hemophilia B | |
| CN114134165B (en) | Novel HPV therapeutic nucleic acid vaccine | |
| CN113302202A (en) | Treatment of neuropathy using deoxyribonucleic acid constructs expressing insulin-like growth factor 1 isoforms | |
| CN112538462B (en) | Cell membrane for rapid amplification of NK cells and application thereof | |
| CN115594742A (en) | Coronavirus S protein variant and application thereof | |
| JP2023545241A (en) | Enhancement of immunity using chimeric CD40 ligands and coronavirus vaccines | |
| US8993316B2 (en) | Methods and compositions for gene therapy and GHRH therapy | |
| CN106999572A (en) | Therapeutic combination and method for inducing the immune response to herpes simplex virus type 2 (HSV 2) | |
| CN116444685A (en) | Efficient controllable RNA delivery system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200114 |