CN110684775A

CN110684775A - Eriocheir sinensis NKCC gene and cloning method and expression analysis method thereof

Info

Publication number: CN110684775A
Application number: CN201910582773.8A
Authority: CN
Inventors: 杨志刚; 张龙; 周俊宇; 魏帮鸿; 董文静; 成永旭
Original assignee: Shanghai Ocean University
Current assignee: Shanghai Ocean University
Priority date: 2019-07-01
Filing date: 2019-07-01
Publication date: 2020-01-14

Abstract

The invention discloses a Eriocheir sinensis NKCC gene, the nucleotide sequence of which is shown as SEQ ID NO. 1. Also discloses a cloning method of the gene, which comprises the following steps: comparing the NKCC amino acid sequences of different species, designing a primer, carrying out reverse transcription on the Eriocheir sinensis cheek total RNA into cDNA, and carrying out PCR amplification to obtain an NKCC gene core fragment; designing 3' and 5' end primers according to the core fragment, reversely transcribing the extracted total RNA into 3' and 5' cDNA first chains, taking the first chains as a template RACE, and obtaining 3' and 5 end RACE fragments; and respectively connecting the 3' and 5 terminal RACE fragments with the core fragment to obtain the NKCC full-length sequence. Also discloses an expression analysis method of the gene, which shows that the expression level is the highest in intestines; the gene is presumed to play an important role in osmotic pressure regulation through salt stress experiments. The invention provides a theoretical basis for researching the action mechanism of the ion channel in the eriocheir sinensis osmotic regulation.

Description

Eriocheir sinensis NKCC gene and cloning method and expression analysis method thereof

Technical Field

The invention relates to the technical field of biology, in particular to a Eriocheir sinensis NKCC gene, a cloning method and an expression analysis method thereof.

Background

Eriocheir sinensis (Eriocheir sinensis) belongs to Eriocheir sinensis of Depodophiales of Crustacea, is an important economic crab in China, has delicious taste and rich nutrition, and is deeply loved by people. The eriocheir sinensis has a special life history of breeding and spawning in brackish water and fattening and growing in fresh water, environmental factors such as pH, salinity, temperature and the like of a water body can cause important influence on physiological activities such as growth, breeding, immunity and the like of aquatic crustaceans, particularly, salinity is an important environmental variable, the crustaceans living in coastal areas have to deal with the change of environmental salinity through the adjustment of the osmotic pressure per se, and the widely-salted crustaceans have various osmotic pressure adjusting capacities.

NKCC is an electric neutral ion transmembrane transport protein, and the expression pattern of the NKCC at different osmoregulation time points determines the salinity adaptation of euryhaline aquatic animals. NKCC is a member of the chloride cotransporter family, and is distributed in both vertebrates and invertebrates [ Yang W etc.; 2016]. NKCC can transport ions through the membrane in the ratio of 1Na to 1K to 2Cl, and plays an important role in regulating the osmotic pressure of cells, maintaining the ion balance of the cells and regulating the volume of the cells. NKCC has two gene subtypes, the absorptive subtype NKCC1 (ion-absorbing in vitro) and the secretory subtype NKCC2 (ion-absorbing in vivo). NKCC1 is more widely distributed in the animal body, while NKCC2 is mainly distributed in the kidneys. It has been shown that when fish are in a hypertonic environment, the body's NKCC1 is activated, secreting ions into the body, and maintaining osmotic pressure balance [ liu hong et al, 2016 ]. In fish, NKCC was cloned at bottom , shark, eel, weever, tilapia, etc. and extensively studied [ Yang W etc.; 2016]. However, the full length of the NKCC gene has not been reported in Eriocheir sinensis.

The experiment successfully clones the overall length of the NKCC gene of the Eriocheir sinensis, analyzes the expression of the NKCC gene in different tissues of the Eriocheir sinensis and analyzes the expression of the NKCC gene of the Eriocheir sinensis at different time points under the stress of high salinity; and measuring the change of the serum osmotic pressure and the change of Na and Cl content of the eriocheir sinensis at different time points under the stress of high salinity. Provides research data for the action mechanism of NKCC in the regulation of the osmotic pressure of the Eriocheir sinensis.

Disclosure of Invention

An object of the present invention is to solve at least the above problems and to provide at least the advantages described later.

The invention also aims to provide a full-name sequence of the Eriocheir sinensis NKCC gene and a protein expressed by the sequence.

The invention also aims to provide a cloning method of the Eriocheir sinensis NKCC gene, which designs a core fragment cloned by 4 pairs of primers and a cloned 3 'and 5' terminal fragment according to corresponding conserved sequences by amino acid comparison of different species to obtain the full-length sequence of the Eriocheir sinensis NKCC.

The invention also aims to provide an expression analysis method of the Eriocheir sinensis NKCC gene, which analyzes that the NKCC gene has the highest expression in intestines and is the thoracic ganglion to provide necessary basis for analyzing an osmotic regulatory mechanism.

To achieve these objects and other advantages of the present invention, there is provided a Eriocheir sinensis NKCC gene, the nucleotide sequence of which is shown in SEQ ID NO. 1.

The invention also provides a protein coded by the Eriocheir sinensis NKCC gene, and the amino acid sequence of the protein is shown in SEQ ID NO. 2.

The invention also provides a cloning method of the Eriocheir sinensis NKCC gene, which comprises the following steps:

step 1: comparing NKCC amino acid sequences of different species, designing 4 pairs of primers according to corresponding conserved regions, carrying out reverse transcription on the total RNA of the Eriocheir sinensis gills into a first cDNA chain, carrying out PCR reaction to obtain a core fragment of the NKCC gene of the Eriocheir sinensis, connecting the core fragment to a vector and sequencing;

wherein the 4 pairs of primers comprise NKCC-F1/NKCC-R1, NKCC-F2/NKCC-R2, NKCC-F3/NKCC-R3 and NKCC-F4/NKCC-R4, the nucleotide sequence of the NKCC-F1 is shown as SEQ ID NO: as shown in figure 3, the first and second, the nucleotide sequence of the NKCC-R1 is shown as SEQ ID NO: as shown in (4) in the figure, the nucleotide sequence of the NKCC-F2 is shown as SEQ ID NO: as shown in figure 5, the first and second, the nucleotide sequence of the NKCC-R2 is shown as SEQ ID NO: as shown in figure 6, the flow of the gas, the nucleotide sequence of the NKCC-F3 is shown as SEQ ID NO: as shown in figure 7, the first and second, the nucleotide sequence of the NKCC-R3 is shown as SEQ ID NO: as shown in figure 8, the flow of air, the nucleotide sequence of the NKCC-F4 is shown as SEQ ID NO: as shown in figure 9, the first and second, the nucleotide sequence of the NKCC-R4 is shown as SEQ ID NO:10 is shown in the figure;

step 2: respectively designing a 3 '-NKCC RACE upstream primer and a 5' -NKCC RACE downstream primer according to the obtained core fragment of the NKCC gene of the Eriocheir sinensis, reversely transcribing the extracted total RNA of the Eriocheir sinensis into a 3 '-cDNA and a 5' -cDNA first chain, carrying out 3 'and 5' end fragment RACE by taking the 3 '-cDNA and the 5' -cDNA first chain as templates, respectively connecting the obtained 3 'and 5' end RACE fragments with a vector, cloning and sequencing;

wherein, the 3 '-NKCC RACE upstream primer is shown as SEQ ID NO. 11, and the 5' -NKCC RACE downstream primer is shown as SEQ ID NO. 12;

and step 3: and respectively removing the vectors of the obtained 3 'and 5' terminal RACE fragments and the core fragment of the Eriocheir sinensis NKCC gene, and splicing to obtain the full-length sequence of the Eriocheir sinensis NKCC gene.

Preferably, in step 1 and step 2, the vector is pMD-19T.

The invention also provides a Eriocheir sinensis NKCC gene obtained by the cloning method of the same.

Preferably, male eriocheir sinensis is selected, muscle, liver pancreas, serum, stomach and intestine of the male eriocheir sinensis are taken, total RNA is extracted respectively, cDNA synthesis is carried out, real-time fluorescence quantitative analysis is carried out by adopting a SYBR Premix Ex Taq Kit, real-time fluorescence quantitative PCR forward and reverse primers qF1, qR1, 18sF and 18sR are designed respectively according to the eriocheir sinensis NKCC gene cloning method of any one of claims 3 and 4, PCR is carried out respectively, data are derived, dissolution curve analysis is carried out, CT values of the NKCC gene and 18sRNA in each sample are detected, the relative expression quantity of a target gene is calculated by adopting a 2- △△ CT method, and the expression analysis of the eriocheir sinensis NKCC gene is carried out.

Preferably, the nucleotide sequence of qF1 is shown as SEQ ID NO. 13, the nucleotide sequence of qR1 is shown as SEQ ID NO. 14, the nucleotide sequence of 18sRNA is shown as SEQ ID NO. 15, and the nucleotide sequence of 18sRNA is shown as SEQ ID NO. 16.

Preferably, the real-time fluorescent quantitative PCR reaction is a two-step PCR amplification standard procedure: 30s at 95 ℃; 5s at 95 ℃ and 45s at 62 ℃, and amplifying for 40 cycles; the dissolution curve analysis program was: 95 ℃ for 15s, 65 ℃ for 60s and 95 ℃ for 30 s.

The invention at least comprises the following beneficial effects:

the NKCC gene is cloned from the eriocheir sinensis postgill by RT-PCR and RACE technologies, the cDNA total length of the gene is 4127bp, wherein the length of a5 'non-coding region (UTR) is 18bp, the length of a 3' non-coding region is 944bp, the length of an Open Reading Frame (ORF) is 3165bp, and fluorescent quantitative analysis shows that the gene is mainly expressed in the eriocheir sinensis intestinal. Salinity stress experimental analysis shows that the gene has obvious change along with the salinity stress time expression amount, has a trend of descending firstly and then ascending, and recovers to be stable after being stressed for 72 hours, and is presumed to play an important role in the osmotic pressure regulation of the eriocheir sinensis. The result can provide theoretical basis for further researching the action mechanism of the ion channel in the eriocheir sinensis osmotic regulation.

The NKCC gene ORF disclosed by the invention codes 1054 amino acids in total, the predicted molecular weight is 116.102kDa, the theoretical isoelectric point is 5.87, wherein the isoleucine and valine contents are highest and respectively account for 11.8% and 8.0%, the bioinformatics analysis shows that the NKCC gene is a highly conserved sequence, is positioned on a cell membrane and has 12 transmembrane domains, the NKCC amino acid sequence is analyzed through NCBI protein Blast, and shows that an electric Na-K-2Cl co-transport 12 SLC12A domain exists between 639 and 1054 amino acid residues, and a typical K-Cl co-transport domain exists between 51 and 1054 amino acid residues; meanwhile, the NKCC amino acid sequence of the Eriocheir sinensis has high homology with the NKCC amino acid sequences of other various species, for example, the homology with NKCC of the Scylla paramamosain, the common Eriocheir sinensis and the macadamia chinensis is 86.17%, 85.92% and 77.69% respectively; but far away from the homologous relationship with vertebrates such as human and mouse.

According to the invention, the Eriocheir sinensis NKCC gene and the protein thereof can be obtained by a cloning method and an expression analysis method of the Eriocheir sinensis, and the relation between the expression conditions of different tissues and salt stress is analyzed, so that the result shows that the gene is likely to participate in the osmotic pressure regulation of the Eriocheir sinensis and plays an important role in the osmotic pressure balance of river crabs, and theoretical basis is provided for further researching the action mechanism of the ion channel in the osmotic regulation of the Eriocheir sinensis.

Additional advantages, objects, and features of the invention will be set forth in part in the description which follows and in part will become apparent to those having ordinary skill in the art upon examination of the following or may be learned from practice of the invention.

Drawings

FIG. 1 is an NJ phylogenetic tree based on the NKCC amino acid sequence, constructed by MEGA5.0 software according to the present invention;

FIG. 2 shows the relative expression level of Eriocheir sinensis NKCC mRNA in each tissue according to the present invention;

FIG. 3 is the expression analysis of NKCC under different stress time at high salinity according to the present invention;

FIG. 4 shows the variation of serum osmotic pressure and serum ion of Eriocheir sinensis under high salinity and different stress time; wherein a is the change of serum Na + and Cl + at different stress time under high salinity;

b is the change of the serum osmotic pressure at different stress time under high salinity.

Detailed Description

The present invention is described in further detail below to enable those skilled in the art to practice the invention with reference to the description.

It will be understood that terms such as "having," "including," and "comprising," as used herein, do not preclude the presence or addition of one or more other elements or groups thereof.

The invention provides a Eriocheir sinensis NKCC gene, the nucleotide sequence of which is shown in SEQ ID NO: 1.

The invention provides a protein coded by the Eriocheir sinensis NKCC gene, and the amino acid sequence of the protein is shown in SEQ ID NO. 2.

The invention provides a cloning method of a Eriocheir sinensis NKCC gene, which comprises the following steps:

In a preferred embodiment, in step 1 and step 2, the vector is pMD-19T.

The invention provides a Eriocheir sinensis NKCC gene obtained by the cloning method of the same.

The invention provides an expression analysis method of a Eriocheir sinensis NKCC gene, which comprises the steps of selecting male Eriocheir sinensis, taking muscles, liver and pancreas, serum, stomach and intestines of the Eriocheir sinensis, respectively extracting total RNA, synthesizing cDNA, carrying out real-time fluorescence quantitative analysis by adopting a SYBRPremix Ex Taq Kit, respectively designing real-time fluorescence quantitative PCR forward and reverse primers qF1, qR1, 18sF and 18sR according to the Eriocheir sinensis NKCC gene and the 18sRNA gene which are obtained by the cloning method of the Eriocheir sinensis NKCC gene according to any one of claims 3 and 4, respectively carrying out PCR, respectively, deriving data, carrying out dissolution curve analysis, detecting CT values of the NKCC gene and the 18sRNA in each sample, calculating the relative expression of a target gene by adopting a 2- △△ CT method, and carrying out expression analysis on the Eriocheir sinensis NKCC gene.

In a preferred embodiment, the qF1 nucleotide sequence is shown as SEQ ID NO. 13, the qR1 nucleotide sequence is shown as SEQ ID NO. 14, the 18sRNA nucleotide sequence is shown as SEQ ID NO. 15, and the 18sRNA nucleotide sequence is shown as SEQ ID NO. 16.

In a preferred embodiment, the real-time fluorescent quantitative PCR reaction is a two-step PCR amplification standard procedure: 30s at 95 ℃; 5s at 95 ℃ and 45s at 62 ℃, and amplifying for 40 cycles; the dissolution curve analysis program was: 95 ℃ for 15s, 65 ℃ for 60s and 95 ℃ for 30 s.

Relevant reagents used in the following experiments: trizol reagent was purchased from Invitrogen, 2 XTaq PCRMasterMix, DNA gel recovery Kit, RNA preservation solution and E.coli Top10 competent cells were purchased from Tiangen Biochemical technology (Beijing) Ltd, 5 XTrimeScript RT Master Mix, SYBR Premix Ex Taq Kit and PMD-19T were purchased from TaKaRa,

RACE 5 '/3' Kit was purchased from Clontech.

Example 1

Cloning method of Eriocheir sinensis NKCC gene

1.1 test subjects

Male eriocheir sinensis with the weight of about 130g is captured from the Chongming base of Shanghai ocean university and is used for experiments after being temporarily cultured in a cement pond for one week. After 6 healthy individuals are randomly selected, three pairs of gills are used for cDNA cloning, and muscles, hepatopancreas, serum, stomachs, intestines and hepatopancreas are taken and rapidly stored in liquid nitrogen for tissue quantitative expression.

1.2 Experimental methods

1) BLAST is carried out on the amino acid sequence coded by the Eriocheir sinensis NKCC gene by using NCBI to obtain a plurality of NKCC amino acid sequences of other species with higher homology with the Eriocheir sinensis NKCC gene, DNAMAN is used for carrying out multiple sequence alignment analysis on the amino acid sequences to obtain corresponding conserved sequences and design 4 pairs of primers, namely NKCC-F1 (the nucleotide sequence of which is shown in SEQ ID NO: 3)/NKCC-R1 (the nucleotide sequence of which is shown in SEQ ID NO: 4), NKCC-F2 (the nucleotide sequence of which is shown in SEQ ID NO: 5)/NKCC-R2 (the nucleotide sequence of which is shown in SEQ ID NO: 6), NKCC-F3 (the nucleotide sequence of which is shown in SEQ ID NO: 7)/NKCC-R3 (the nucleotide sequence of which is shown in SEQ ID NO: 8) and NKCC-F4 (the nucleotide sequence of which is shown in SEQ ID NO: 9)/NKCC-R4 (the nucleotide sequence of which is shown in SEQ ID NO: 9) Shown as SEQ ID NO: 10), extracting total RNA of the gill of Eriocheir sinensis by Trizol method according to Trizol reagent kit instruction, performing reverse transcription according to PrimeScript RTMasterMix (Cat. NO. RR 036A, TAkara) instruction to synthesize first strand cDNA, and performing PCR amplification reaction on the synthesized cDNA by using 4 pairs of primers, specifically referring to 2 xTaq PCR Master Mix kit instruction, wherein the amplification system is as follows: 1 muL of cDNA template, 1 muL of forward primer, 1 muL of reverse primer and 10 muL of PCR Mix; the amplification conditions were: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 s; annealing at 55 ℃ for 30 s; stretching at 72 ℃ for 1 min; 30 cycles; keeping the temperature constant at 4 ℃. Detecting by using 1% agarose gel electrophoresis, recovering the band with the size according to the steps of the specification of the heaven root DNA gel recovery kit to obtain the core fragment of the NKCC gene of the Eriocheir sinensis, connecting the purified core fragment with a PMD-19T vector, and performing TOP10 competent cell transformation on the connection product.

The conversion comprises the following specific steps: after the competent cells are thawed, 10 mu L of the ligation product containing the target DNA is added into the competent cell suspension, and the mixture is gently blown and beaten by a pipette and evenly mixed and is ice-bathed for 30 minutes. The centrifuge tube was quickly transferred to an ice bath by heat shock at 42 ℃ for 90 seconds, and allowed to stand on ice for 2 to 3 minutes. Adding 900 μ l sterile LB medium (containing no antibiotics) into the centrifuge tube, mixing, placing in 37 deg.C shaking table, and shaking culturing at 150rpm for 45min to recover thallus. 100 μ l of transformed competent cells were added to LBA agar solid medium, the cells were spread evenly with a sterile spreading rod until dry, the plates inverted and incubated at 37 ℃ for 12-16 hours. The positive clone (white colony) was picked and placed in a centrifuge tube containing LBA medium, and the tube was shaken on a shaker for 4h at 37 ℃ and 200 r/min. And carrying out PCR (polymerase chain reaction) and agarose gel electrophoresis detection on the bacterial liquid. The PCR amplification system of the bacterial liquid is as follows: 1 mu L of bacterial liquid, 1 mu L of forward primer, 1 mu L of reverse primer and 10 mu L of PCR Mix; the amplification conditions were: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 s; annealing at 55 ℃ for 30 s; stretching at 72 ℃ for 1 min; 30 cycles; keeping the temperature at 4 ℃; then sent to the company for sequencing.

2) Respectively designing 3 '-NKCC RACE upstream primer shown as SEQ ID NO. 11 and 5' -NKCC RACE downstream primer shown as SEQ ID NO. 12 according to the obtained NKCC gene core fragment

RACE 5 '/3' Kit instruction, reverse transcribing the extracted Eriocheir sinensis total RNA into 3 '-cDNA and 5' -cDNA first chain, taking the first chain as a template to carry out 3 'and 5' end fragment RACE, which specifically comprises the following steps:

3 'terminal fragment Rapid amplification Using 3' -cDNA as template, according to

RACE 5 '/3' Kit instructions, 3 'amplification primers CCAGACCCCTGAAGACAAGC and 3' -NKCC RACE upstream primer is shown as SEQ ID NO. 11;

3' -RACE PCR amplification System: 2.5. mu.l of 3 '-RACE-Ready cDNA, 5. mu.l of 10 × UPM, 1. mu.l of 3' GSP, 41.5. mu.l of Master Mix; reaction conditions are as follows: 30s at 94 ℃, 30s at 68 ℃, 3min at 72 ℃ and 25 cycles.

II Rapid amplification of 5 '-terminal fragment Using 5' -cDNA as template, according to

RACE 5 '/3' Kit instructions, 5 'amplification primer used TGGCTGTACGATGATGGTGG and 5' -NKCC RACE downstream primer as shown in SEQ ID NO 12;

5' -RACE PCR amplification System: 2.5. mu.l of 5 '-RACE-Ready cDNA, 5. mu.l of 10 XUPM, 1. mu.l of 5' GSP, 41.5. mu.l of Master Mix; reaction conditions are as follows: 30s at 94 ℃, 30s at 68 ℃, 3min at 72 ℃ and 25 cycles.

And respectively connecting the obtained 3' and 5-end RACE fragments with a vector pMD-19T, carrying out TOP10 competent cell transformation on the connection product, selecting a positive cloning product, carrying out bacterial liquid PCR and agarose gel electrophoresis detection, and then sequencing.

3) And respectively removing the vectors from the obtained 3 'and 5' terminal fragments and the core fragment of the Eriocheir sinensis NKCC gene, and splicing to obtain the full-length sequence of the Eriocheir sinensis NKCC gene. The sequence obtained from the sequencing was de-vectored using the NCBI in-line tool (https:// www.ncbi.nlm.nih.gov/tools/vecscreen /). The method comprises the following specific steps: and introducing a sequencing sequence into the sequence frame, clicking Run VecScreen, and then clicking View report, wherein the marked red is the vector sequence. The Vector used was pMD19-T Vector, and the cleavage site was EcoR v.

1.3 analysis of results

Through sequence analysis, the total length of the Eriocheir sinensis NKCC gene is 4127bp of the cDNA total length of the gene, wherein the length of a5 'non-coding region (UTR) is 18bp, the length of a 3' non-coding region is 944bp, the length of an Open Reading Frame (ORF) is 3165bp, and the Eriocheir sinensis NKCC gene simultaneously has a typical tailing signal sequence (AATAAA) and a 31bp poly (A) sequence.

The ORT of the sequence encodes 1054 amino acids, the predicted molecular weight is 116.102kDa, and the theoretical isoelectric point is 5.87. Isoleucine (Leu) and valine (Ala) contents are highest, accounting for 11.8% and 8.0%, respectively; the protein cell is localized to the cytoplasmic membrane, which has 12 transmembrane domains. The NKCC amino acid sequence was analyzed by NCBI protein Blast (FIG. 4a), and the result showed that there was a typical domain of the Na-K-2Cl cotransporter SLC12A between the 639-and 1054-amino acid disabilities. There is a typical K-CL cotransporter domain between the 51-1054 amino acid disabilities. Meanwhile, through comparison with amino acid sequences of different species NKCC, the NKCC has high homology with various species NKCC, such as 86.17%, 85.92% and 77.69% of the homology with the NKCC of Scylla paramamosain, ordinary crabs and Hawaii red shrimps respectively; but far away from the homologous relationship with vertebrates such as human and mouse.

Example 2

Expression analysis of Eriocheir sinensis NKCC gene

2.1 analysis of the expression of the Eriocheir sinensis NKCC Gene in different tissues

Fluorescence quantification is realized by a SYBR Premix Ex Taqkit kit and is carried out on an ABI7500 real-time fluorescence quantification PCR system. A relative standard curve of primers was prepared using 10-fold gradient-diluted cDNA templates, and the appropriate template concentration and reaction conditions were determined. Through analysis of a relative standard curve, when the annealing temperature is set to be 62 ℃ and the annealing time is set to be 45s, the efficiency of the amplification primer can reach 100% +/-5%; meanwhile, when the dilution factor of the cDNA template is 10, the amplified Ct value is in a proper range.

And taking the muscle, the hepatopancreas, the serum, the stomach, the intestine and the hepatopancreas of the Eriocheir sinensis for fluorescence quantification, taking 5 biological repeated samples for each tissue for reducing experimental errors, and carrying out 3 times of technical repetition on each biological sample. The reaction system was prepared according to SYBR PremixEx Taq Kit. The reaction procedure is a two-step PCR amplification standard procedure: 30s at 95 ℃; 5s at 95 ℃ and 45s at 62 ℃, and amplifying for 40 cycles; the dissolution curve analysis program was: 95 ℃ for 15s, 65 ℃ for 60s and 95 ℃ for 30 s. And analyzing the relative expression quantity of the target gene by using Excel 2013 software by adopting a 2-delta Ct method.

As shown in FIG. 2, the Eriocheir sinensis NKCC gene is expressed in all the tested hepatopancreas, thoracic ganglia, intestinal tracts, muscles, gills, stomachs, hearts and brain ganglia, and the expression level in the intestines is significantly higher than that in other tissues (P <0.05), and the expression level in the muscles, gills, stomachs, hearts and brain ganglia is not significantly different in the following thoracic ganglia.

2.2 expression analysis of Eriocheir sinensis NKCC gene in different time periods of high salinity

Respectively taking Eriocheir sinensis intestines with salinity stress of 0h, 3h, 6h, 12h, 24h, 48h, 72h, 96h, 122h and 144h for qRT-PCR. The 18S rRNA gene was used as an internal reference gene. First strand cDNA was synthesized using 1. mu.g RNA as template using PrimeScript RT kit. The reaction system of qRT-PCR was 10. mu.L of 2 XSSYBR Premix Ex Taq (Cat. No. RR420A; TaKaRa), 0.2. mu. mol/L primer, 2. mu.L cDNA template. The reactions were performed on an ABI7500 real-time fluorescent quantitative PCR system (LifeTech, Applied Biosystems). To reduce errors in the PCR amplification system, 3 biological replicates were taken at each time point and 3 technical replicates were performed for each biological replicate. The relative expression level of each sample was determined by the 2- Δ Δ Ct method.

Internal reference gene primers: f: TCCAGTTCGCAGCTTCTTCTT, respectively;

R:AACATCTAAGGGCATCACAGA。

NKCC gene primer: qF 1: TCAGGGACAATCAGCGACAC, respectively;

qR1：CCAGGATGATGCCGGATTGA。

as shown in figure 3, the expression patterns of the Eriocheir sinensis NKCC gene under high salt stress at different times are analyzed, and from 0-3h, the NKCC expression is remarkably reduced, the expression level is increased at 6h, then the expression level of the NKCC is remarkably reduced at 12-48h and is remarkably increased at 72h, and the expression level of the NKCC gene is not greatly changed but is remarkably lower than 0h and 72h at 96-144 h.

2.3 analysis of serum osmotic pressure serum ion changes of Eriocheir sinensis in high salinity at different stress times

Salinity stress experiments were performed in the circulating water system of Shanghai ocean university, and the experiments were divided into seawater group (SW) and fresh water group (FW), each of which was replicated three times, each of which was replicated 10 crabs. SW uses sea crystal to prepare water with salinity of 25 degrees; the FW group uses aerated tap water with salinity of 0.

After the eriocheir sinensis is temporarily cultured for one week, individuals with complete healthy appendages are picked for experiments. The experimental crab is placed in a glass jar (40 multiplied by 60) of a circulating water system, and fine sand, tile blocks and the like are laid at the bottom of the jar for river crab concealment. Feeding is not carried out in the experimental process, the illumination period is 12h illumination/12 h darkness, the water quality parameters are monitored twice every day, the water temperature is kept at 24.5-30.0 ℃, the ph value is 8.0 +/-0.4, the dissolved oxygen is more than 5mg/l, and the total ammonia nitrogen is less than 0.01 mg/l. Taking out river crabs for sampling at 0h, 3h, 6h, 12h, 24h, 48h, 72h, 96h, 122h and 144h after the start of the experiment, and repeatedly taking 1 crab each time. The river crab is anesthetized on ice, and then serum, posterior gill and intestine are taken and quickly stored in liquid nitrogen.

As shown in a and b of figure 4, by measuring the content change of Na and Cl of the eriocheir sinensis under high salt stress at different time points and the change of the serum osmotic pressure at different time points, the result shows that the content of Na and Cl of the eriocheir sinensis shows the trend of rising firstly and then falling along with the high salinity stress, the content of Na reaches the maximum at 72h and then starts to fall, and the content of Cl reaches the maximum at 24h and then starts to fall. The serum osmotic pressure of the eriocheir sinensis is obviously increased within 0-6h, shows a slow increasing trend within 6-96h, and then slightly decreases within 96-144h, but the change is not obvious.

The above statistical analysis shows the experimental results as mean ± standard deviation (± SD). Statistical data analysis single-factor analysis of variance (ANOVA) was performed using SPSS22.0 and Duncan's multiple comparisons were performed to analyze the significance of differences between groups. Significance level was P < 0.05.

The invention obtains the NKCC gene full length of the Eriocheir sinensis by RACE technology and gene cloning technology, the cDNA full length of the gene is 4127bp, wherein the length of 5 'non-coding region (UTR) is 18bp, the length of 3' non-coding region is 944bp, the length of Open Reading Frame (ORF) is 3165bp, and ORF codes 1054 amino acids in total, the predicted molecular weight is 116.102kDa, the theoretical isoelectric point is 5.87, wherein the content of isoleucine and valine is the highest, and respectively accounts for 11.8 percent and 8.0 percent, and the bioinformatics analysis shows that the NKCC gene is a highly conserved sequence, is positioned on a cell membrane and has 12 transmembrane structural domains, the NCBI protein Blast is used for analyzing the NKCC amino acid sequence, which shows that an electric Na-K-2Cl co-transport SLC12A structural domain exists between 639-1054 amino acid residues, a typical K-Cl cotransporter domain is located between amino acid residues 51-1054; meanwhile, the NKCC gene of the eriocheir sinensis has high homology with the NKCC gene sequences of the scylla paramamosain and the portunus trituberculatus (shown in figure 1).

According to the invention, through fluorescence quantitative analysis, the NKCC gene of the Eriocheir sinensis has expression in each tissue, but has the highest expression in intestines, and is the brain ganglion, which is different from the NKCC gene studied in the marsupenaeus japonicus and the tilapia in the prior art, and has the highest expression in gills. The eriocheir sinensis intestinal tract feeding membrane is secreted by epithelial cells, and main proteins comprise NKA, ATP synthase, actin and the like and can participate in processes of immunity, osmotic regulation, nutrition transportation and the like. The brain ganglion is the main tissue of the neuroendocrine system of the Eriocheir sinensis and is responsible for signal transduction; the ion channel plays an important role in the signal transduction process, and extracellular signals are transmitted to a certain part of the cell through a cell membrane and an intracellular conduction device, so that the high expression of the NKCC gene of the Eriocheir sinensis in the brain ganglion indicates that the NKCC gene possibly participates in the signal transduction process of the Eriocheir sinensis.

In addition, the invention also finds a trend that the expression level of the NKCC is obviously reduced firstly along with the high salinity stress, and then the expression level is obviously increased and kept stable; na and Cl in the eriocheir sinensis serum tend to rise first and then fall along with the stress time; the serum osmolality showed a tendency to rise significantly and to remain stable after 96 h. According to the previous research that NKCC gene has two subtypes, namely a secretory subtype NKCC1 and an absorptive subtype NKCC2, the cloned NKCC is presumed to be a secretory subtype and mainly secretes Na and Cl into the external environment, wherein the Na and Cl are main ions forming the osmotic pressure of blood serum. At the beginning of salinity stress, the Na and Cl content in the external water environment of the Eriocheir sinensis suddenly increases to inhibit the activity of the NKCC gene, so that the expression level of the NKCC gene is obviously reduced, the Na and Cl content in the serum of the Eriocheir sinensis increases along with the high salinity stress, the osmotic pressure is obviously increased, the Eriocheir sinensis starts an organism osmotic pressure regulation mechanism, and Na and Cl are transported to the external environment through an ion channel to maintain osmotic balance; the NKCC gene is activated, the expression level is obviously increased, and Na and Cl are secreted to the outside, so that the osmotic pressure of the organism is kept balanced. Therefore, the relevance of the Eriocheir sinensis and the osmotic pressure regulation mechanism thereof researched by the application provides very important data support and theoretical basis for further researching the positioning of NKCC in the Eriocheir sinensis and the specific osmotic regulation principle.

While the embodiments of the invention have been disclosed above, it is not limited to the applications set forth in the description and the embodiments, which are fully applicable in various fields of endeavor to which the invention pertains, and further modifications may readily be made thereto by those skilled in the art, it being understood that the invention is not limited to the details shown and described herein but is not limited to the particular arrangements shown and described without departing from the general concept defined by the appended claims and their equivalents.

Sequence listing

<110> Shanghai ocean university

<120> Eriocheir sinensis NKCC gene and cloning method and expression analysis method thereof

<160>12

<170>SIPOSequenceListing 1.0

<210>1

<211>4127

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

acatggggag tcgaaaccat gagcacggga gacgcagata ctattgagtt ggactccgcg 60

tcccacatcc acgtggcctc cgggctggac acggcggatg gccaccacac gcacacctcc 120

aacagcggcg tgtacgagac ccgctaccag aagtccctcc gccactacct gacgcgggaa 180

gccctgccca aggaatccca ctacaggaac cttgactcca tcgttgacgg ctcggcgcgc 240

cccaccctcg atgacctgca ccacaacacc ctcagggaca atcagcgaca cacgggcgct 300

gatcctgaag ccgccgccgc caacctccgc gggaaagtga tcaagttcgg atggctggac 360

ggcgtctata tgcgatgtct cctcaacatt tggggcgtga tgctgttcct cagggtgtcg 420

tgggtggtcg gtcaatccgg catcatcctg gcccttgtga cggtcctgct ggggaacgtg 480

gtcaccacca tcaccaccct gtctatgtct gctgtggcta ccaatgggcg catccaagcc 540

ggtggcgttt actacatgat ttcccgctcc cttggacctg agttcggggg ctccatcggc 600

ctcatgttca cgctggccaa ctccatcgcc tcagccacct acatcatcgg tttctgcgac 660

tccctgaagg atctgctgaa gtactacgct gacggtgctc agatagtgga cggggctgtg 720

aacgacacgc gcatcgtggg cacagtcacc ctcattgctg tgctggccct ggccatcgtg 780

ggcatggact gggtcacgag ggttcaaatg gctctgctgt tcctgctgat tggctcgcag 840

attgacttcg tggttggtgc cttcatgggt ccactaactg aggaaagtga ggcccaagga 900

ttccttggct tcaatgccga tgtgatgtca gaaaacgtgg gtccagctta tcgagataat 960

gacggcagta gtcagaactt cttctcagtg tttggtgtgt tcttcacagc tgtgacaggc 1020

attgtggctg gagccaacct ctctggtgat ctcaaggacc ctgcagatgc cattcccaag 1080

ggaacactgc tggccatcct caccacgtgc ttaacctacc tgatctaccc catcatgatc 1140

ggggcgtccg tgctgaggga tgcttcaggg aatcttacat tatatcagga gtacaaggat 1200

ttgccctatt gggaaaaccc ggcgttcacc aactgcagca cgactggcta cgttgatgaa 1260

ttgggtaatc cagtgtgtga atttggcctc cagaacagct tccaggtgat ggagctcatg 1320

tcagcctggg gacccttgat ctacgctggg tgctttgctg ccacactctc ctctgccatt 1380

gcttccctgg ttggtgctcc aagggtcctg caggctctgg ccaaggacaa gttgtaccct 1440

ggcatcttcc tgttctccaa aggcactggt gccaacaacg atcctgtgcg tggctacatc 1500

cttgtcttca tcatctcctt catctgcatc atgattggtg acctgaacgt cgtctccact 1560

ctgctcagta acttcttcct ggcatcatac agtctcatca acttctcctg cttccacgca 1620

tccctcatca agtctcccgg ctggcgtccc agtttcaagt actacaactt gtggatcagt 1680

ttgcttggcg gtatcctgtg cctgatcgtg atgttcctca ttgactgggt cacagcgctc 1740

atcaccttca tcatcaccat cgcactctac ctctttgtgt cctaccgcaa ccccaatgtc 1800

aactggggct catcgactca agcacagact tatgtgtccg ccctgaagac caccctggac 1860

ctgaacaccg tcgaggagca tgtcaagaac taccggcctc agctgctggt gctctctggg 1920

tttgcaggtg caagacctcc tcttctggac tttgctcact gcatcaccaa gaacatttcc 1980

ctgcttgcct gtggtcacgt gatacaggga caccagaccc agcgtgtgcg taactccctc 2040

tccagacagg cctacagctg gctgaacaag caccacatcc gtgccttcta ctcactcgtt 2100

gaggggagca ccttggagga cggcgccagg aatctcttcc agttggtggg tctcggtaag 2160

ctgaagccca acaccgtcgt tctgggctac aaggcaaact ggcgcaagtg tgaccctgtg 2220

gaactcacgg cttacttcaa cacactccat gaggcgctcg acatgtactt tggtgtgatc 2280

atcctgcgcg tgcctcaggg tcttgactac tcccagatca tcgaggatga agactctcct 2340

gtcaccatga acggcaatga gaccaacatc acccagaccc ctgaagacaa gccaggccag 2400

tccaccacca accagctcac ccaagacgga acagacagtg aggcctccac cccccctgga 2460

tctccccagg cagaacgcgc aggagctgtg gttgagacaa atgctgcaga cagcaagaag 2520

cggcggacat ctttggccaa cctgttcagg ggccctggcg gtgctgagct cagcaaggaa 2580

gttctcaaca acatcaccat gttcaagagg aaacagaaga agggcactat tgatgtctgg 2640

tggctgtacg atgatggtgg cctgacgctg ctggtgcctt acatcctctc cacacgctcc 2700

cagtggtcgg gctgcaagct gagggtgttc gctctggcca accgcaagga tgagctagac 2760

atggagcaga ggagtatggc caacctgctc gccaagttca gaatagacta cagtgatgtg 2820

atcgtcattc cggatgtggc caagaaggcc gctgagtctt cgcggatgga attcgaccag 2880

atggttgaag acttcaagga aaagagcaaa gatgacgtgg acaagccaga aaatgctctc 2940

acaatcagcg aagcagagtt ccttggtcag cgagaaaaga ctaaccgcca catccgtctg 3000

agggagttgc tgctggaaaa ctcgagagat tcttcacttg ttgtgatgac actgccaatg 3060

ccccgcaaag cctcggtttc cgccccgctg tacatggcct ggttggagac cctcacgcgt 3120

gacatgcctc ctttcatcct catccgtggc aaccaaacat ccgttctcac cttctactct 3180

taggaggcat cctggagatt ttgtgtccct atttttaatt agatttttaa gatttcaaga 3240

atgaatgatc ctgattgctg tgtaccatag agttattcat tgtgtctttt tacatgaaaa 3300

tagaggttgt tgttgtgtgt gtacgtgttt gaatgtgtgt gtgtgtgtgt gtgtgtgtgt 3360

gtgtgtgtgt gtgtgtgtgt gtgttgtctg tatatgtatg tatgtaaaag tgagtgtttg 3420

acatttgcat atgaaagtaa tgggggtatc atcatgcaac atttttttaa tattgttatt 3480

gatacaagta tgcaatattt gtcaaaagta gtattagcat aattcctatt acaaagtttg 3540

ctagccttac attttgtaca ttccatgttt aaggactaaa caaattatat cttccaattc 3600

cttcaaaata ctcccatgca gactttttag tgttaaggtc tggcaataca aaacacacag 3660

aacaaagcgt tgcacaaaca atggagtgca gatgtttgag tatgaaagtt gattaatttg 3720

tattaccagt acaataaaac ttcaaaggta aatctggcta atcaagcttt gaaaaccagg 3780

tggtacacta tgtataaaga tcagtagttt ttgtttattt taaaattctg ctcaaaatgg 3840

gaagagtaac aacgtttcca taaatatctt gatatacttg aacattcctt tttagaagat 3900

gcttgtttgt taatggcttc aagactcatc actctgtgct ctgagttttt aatccaacac 3960

aaagttagga tccatcatcc ctcactaaaa gataaaagtc tgtagtttgt agacacccac 4020

tttaagctgt gaagccctca tcaatttgaa tcaaacctta gcaacttttg ttaataatga 4080

gtgggtatga tattacaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaa 4127

<210>2

<211>1054

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Met Ser Thr Gly Asp Ala Asp Thr Ile Glu Leu Asp Ser Ala Ser His

1 5 10 15

Ile His Val Ala Ser Gly Leu Asp Thr Ala Asp Gly His His Thr His

20 25 30

Thr Ser Asn Ser Gly Val Tyr Glu Thr Arg Tyr Gln Lys Ser Leu Arg

35 40 45

His Tyr Leu Thr Arg Glu Ala Leu Pro Lys Glu Ser His Tyr Arg Asn

50 55 60

Leu Asp Ser Ile Val Asp Gly Ser Ala Arg Pro Thr Leu Asp Asp Leu

65 70 75 80

His His Asn Thr Leu Arg Asp Asn Gln Arg His Thr Gly Ala Asp Pro

85 90 95

Glu Ala Ala Ala Ala Asn Leu Arg Gly Lys Val Ile Lys Phe Gly Trp

100 105 110

Leu Asp Gly Val Tyr Met Arg Cys Leu Leu Asn Ile Trp Gly Val Met

115 120 125

Leu Phe Leu Arg Val Ser Trp Val Val Gly Gln Ser Gly Ile Ile Leu

130 135 140

Ala Leu Val Thr Val Leu Leu Gly Asn Val Val Thr Thr Ile Thr Thr

145 150 155 160

Leu Ser Met Ser Ala Val Ala Thr Asn Gly Arg Ile Gln Ala Gly Gly

165 170 175

Val Tyr Tyr Met Ile Ser Arg Ser Leu Gly Pro Glu Phe Gly Gly Ser

180 185 190

Ile Gly Leu Met Phe Thr Leu Ala Asn Ser Ile Ala Ser Ala Thr Tyr

195 200 205

Ile Ile Gly Phe Cys Asp Ser Leu Lys Asp Leu Leu Lys Tyr Tyr Ala

210 215 220

Asp Gly Ala Gln Ile Val Asp Gly Ala Val Asn Asp Thr Arg Ile Val

225 230 235 240

Gly Thr Val Thr Leu Ile Ala Val Leu Ala Leu Ala Ile Val Gly Met

245 250 255

Asp Trp Val Thr Arg Val Gln Met Ala Leu Leu Phe Leu Leu Ile Gly

260 265 270

Ser Gln Ile Asp Phe Val Val Gly Ala Phe Met Gly Pro Leu Thr Glu

275 280 285

Glu Ser Glu Ala Gln Gly Phe Leu Gly Phe Asn Ala Asp Val Met Ser

290 295 300

Glu Asn Val Gly Pro Ala Tyr Arg Asp Asn Asp Gly Ser Ser Gln Asn

305 310 315 320

Phe Phe Ser Val Phe Gly Val Phe Phe Thr Ala Val Thr Gly Ile Val

325 330 335

Ala Gly Ala Asn Leu Ser Gly Asp Leu Lys Asp Pro Ala Asp Ala Ile

340 345 350

Pro Lys Gly Thr Leu Leu Ala Ile Leu Thr Thr Cys Leu Thr Tyr Leu

355 360 365

Ile Tyr Pro Ile Met Ile Gly Ala Ser Val Leu Arg Asp Ala Ser Gly

370 375 380

Asn Leu Thr Leu Tyr Gln Glu Tyr Lys Asp Leu Pro Tyr Trp Glu Asn

385 390 395 400

Pro Ala Phe Thr Asn Cys Ser Thr Thr Gly Tyr Val Asp Glu Leu Gly

405 410 415

Asn Pro Val Cys Glu Phe Gly Leu Gln Asn Ser Phe Gln Val Met Glu

420 425 430

Leu Met Ser Ala Trp Gly Pro Leu Ile Tyr Ala Gly Cys Phe Ala Ala

435 440 445

Thr Leu Ser Ser Ala Ile Ala Ser Leu Val Gly Ala Pro Arg Val Leu

450 455 460

Gln Ala Leu Ala Lys Asp Lys Leu Tyr Pro Gly Ile Phe Leu Phe Ser

465 470 475 480

Lys Gly Thr Gly Ala Asn Asn Asp Pro Val Arg Gly Tyr Ile Leu Val

485 490 495

Phe Ile Ile Ser Phe Ile Cys Ile Met Ile Gly Asp Leu Asn Val Val

500 505 510

Ser Thr Leu Leu Ser Asn Phe Phe Leu Ala Ser Tyr Ser Leu Ile Asn

515 520 525

Phe Ser Cys Phe His Ala Ser Leu Ile Lys Ser Pro Gly Trp Arg Pro

530 535 540

Ser Phe Lys Tyr Tyr Asn Leu Trp Ile Ser Leu Leu Gly Gly Ile Leu

545 550 555 560

Cys Leu Ile Val Met Phe Leu Ile Asp Trp Val Thr Ala Leu Ile Thr

565 570 575

Phe Ile Ile Thr Ile Ala Leu Tyr Leu Phe Val Ser Tyr Arg Asn Pro

580 585 590

Asn Val Asn Trp Gly Ser Ser Thr Gln Ala Gln Thr Tyr Val Ser Ala

595 600 605

Leu Lys Thr Thr Leu Asp Leu Asn Thr Val Glu Glu His Val Lys Asn

610 615 620

Tyr Arg Pro Gln Leu Leu Val Leu Ser Gly Phe Ala Gly Ala Arg Pro

625 630 635 640

Pro Leu Leu Asp Phe Ala His Cys Ile Thr Lys Asn Ile Ser Leu Leu

645 650 655

Ala Cys Gly His Val Ile Gln Gly His Gln Thr Gln Arg Val Arg Asn

660 665 670

Ser Leu Ser Arg Gln Ala Tyr Ser Trp Leu Asn Lys His His Ile Arg

675 680 685

Ala Phe Tyr Ser Leu Val Glu Gly Ser Thr Leu Glu Asp Gly Ala Arg

690 695 700

Asn Leu Phe Gln Leu Val Gly Leu Gly Lys Leu Lys Pro Asn Thr Val

705 710 715 720

Val Leu Gly Tyr Lys Ala Asn Trp Arg Lys Cys Asp Pro Val Glu Leu

725 730 735

Thr Ala Tyr Phe Asn Thr Leu His Glu Ala Leu Asp Met Tyr Phe Gly

740 745 750

Val Ile Ile Leu Arg Val Pro Gln Gly Leu Asp Tyr Ser Gln Ile Ile

755 760 765

Glu Asp Glu Asp Ser Pro Val Thr Met Asn Gly Asn Glu Thr Asn Ile

770 775 780

Thr Gln Thr Pro Glu Asp Lys Pro Gly Gln Ser Thr Thr Asn Gln Leu

785 790 795 800

Thr Gln Asp Gly Thr Asp Ser Glu Ala Ser Thr Pro Pro Gly Ser Pro

805 810 815

Gln Ala Glu Arg Ala Gly Ala Val Val Glu Thr Asn Ala Ala Asp Ser

820825 830

Lys Lys Arg Arg Thr Ser Leu Ala Asn Leu Phe Arg Gly Pro Gly Gly

835 840 845

Ala Glu Leu Ser Lys Glu Val Leu Asn Asn Ile Thr Met Phe Lys Arg

850 855 860

Lys Gln Lys Lys Gly Thr Ile Asp Val Trp Trp Leu Tyr Asp Asp Gly

865 870 875 880

Gly Leu Thr Leu Leu Val Pro Tyr Ile Leu Ser Thr Arg Ser Gln Trp

885 890 895

Ser Gly Cys Lys Leu Arg Val Phe Ala Leu Ala Asn Arg Lys Asp Glu

900 905 910

Leu Asp Met Glu Gln Arg Ser Met Ala Asn Leu Leu Ala Lys Phe Arg

915 920 925

Ile Asp Tyr Ser Asp Val Ile Val Ile Pro Asp Val Ala Lys Lys Ala

930 935 940

Ala Glu Ser Ser Arg Met Glu Phe Asp Gln Met Val Glu Asp Phe Lys

945 950 955 960

Glu Lys Ser Lys Asp Asp Val Asp Lys Pro Glu Asn Ala Leu Thr Ile

965 970 975

Ser Glu Ala Glu Phe Leu Gly Gln Arg Glu Lys Thr Asn Arg His Ile

980985 990

Arg Leu Arg Glu Leu Leu Leu Glu Asn Ser Arg Asp Ser Ser Leu Val

995 1000 1005

Val Met Thr Leu Pro Met Pro Arg Lys Ala Ser Val Ser Ala Pro Leu

1010 1015 1020

Tyr Met Ala Trp Leu Glu Thr Leu Thr Arg Asp Met Pro Pro Phe Ile

1025 1030 1035 1040

Leu Ile Arg Gly Asn Gln Thr Ser Val Leu Thr Phe Tyr Ser

1045 1050

<210>3

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

aacgagaccc gctaccagaa 20

<210>4

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gtccagccat ccgaacttga 20

<210>5

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

tcagggacaa tcagcgacac 20

<210>6

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ccaggatgat gccggattga 20

<210>7

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ggtcaatccg gcatcatcct 20

<210>8

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ccaagggagc gggaaatcat 20

<210>9

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ggctggacgg cgtctatatg 20

<210>10

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

atgatgccgg attgaccgac 20

<210>11

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

ctaatacgac tcactatagg gcaagcagtg gtatcaacgc agagt 45

<210>12

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

ctaatacgac tcactatagg gc 22

Claims

1. The Eriocheir sinensis NKCC gene is characterized in that the nucleotide sequence of the Eriocheir sinensis is shown as SEQ ID NO: 1.

2. The protein encoded by the Eriocheir sinensis NKCC gene according to claim 1, wherein the amino acid sequence of the protein is represented by SEQ ID NO. 2.

3. The method for cloning the Eriocheir sinensis NKCC gene according to claim 1, comprising the steps of:

wherein, the 4 pairs of primers comprise NKCC-F1/NKCC-R1, NKCC-F2/NKCC-R2, NKCC-F3/NKCC-R3 and NKCC-F4/NKCC-R4, the nucleotide sequence of the NKCC-F1 is shown as SEQ ID NO: as shown in figure 3, the first and second, the nucleotide sequence of the NKCC-R1 is shown as SEQ ID NO: as shown in (4) in the figure, the nucleotide sequence of the NKCC-F2 is shown as SEQ ID NO: as shown in figure 5, the first and second, the nucleotide sequence of the NKCC-R2 is shown as SEQ ID NO: as shown in figure 6, the flow of the gas, the nucleotide sequence of the NKCC-F3 is shown as SEQ ID NO: as shown in figure 7, the first and second, the nucleotide sequence of the NKCC-R3 is shown as SEQ ID NO: as shown in figure 8, the flow of air, the nucleotide sequence of the NKCC-F4 is shown as SEQ ID NO: as shown in figure 9, the first and second, the nucleotide sequence of the NKCC-R4 is shown as SEQ ID NO:10 is shown in the figure;

4. The method for cloning the NKCC gene of claim 3, wherein the vector in step 1 or 2 is pMD-19T.

5. The Eriocheir sinensis NKCC gene obtained by the cloning method of the same according to any one of claims 3 to 4.

6. The method for analyzing the expression of the NKCC gene of claim 1, wherein the method comprises selecting male Eriocheir sinensis, extracting total RNA from the muscle, liver and pancreas, blood serum, stomach and intestine, synthesizing cDNA, performing real-time quantitative fluorescence analysis with SYBRPremix Ex Taq Kit, obtaining the NKCC gene and 18sRNA gene of the Eriocheir sinensis according to the cloning method of any one of claims 3 and 4, designing real-time quantitative fluorescence PCR forward and reverse primers qF1, qR1, 18sF and 18sR, performing PCR, deriving data, performing dissolution curve analysis, detecting the CT values of the NKCC gene and 18sRNA in each sample, and performing 2-fold analysis^△△CTThe method calculates the relative expression quantity of the target gene and carries out the expression analysis of the Eriocheir sinensis NKCC gene.

7. The method for analyzing the expression of the Eriocheir sinensis NKCC gene according to claim 6, wherein the nucleotide sequence of qF1 is shown as SEQ ID NO. 13, the nucleotide sequence of qR1 is shown as SEQ ID NO. 14, the nucleotide sequence of 18sRNA is shown as SEQ ID NO. 15, and the nucleotide sequence of 18sRNA is shown as SEQ ID NO. 16.

8. The method for analyzing the expression of the NKCC gene in the claim 6, wherein the real-time fluorescent quantitative PCR reaction is a two-step PCR amplification standard program: 30s at 95 ℃; 5s at 95 ℃ and 45s at 62 ℃, and amplifying for 40 cycles; the dissolution curve analysis program was: 95 ℃ for 15s, 65 ℃ for 60s and 95 ℃ for 30 s.