CN110680922A

CN110680922A - Application of IGF1 protein in regulation and control of acute lung injury mediated by influenza virus infection

Info

Publication number: CN110680922A
Application number: CN201910916078.0A
Authority: CN
Inventors: 张传福; 王荣; 周丽娟; 宋宏彬; 张灿; 史云
Original assignee: Chinese People's Liberation Army Center For Disease Control And Prevention
Current assignee: Chinese People's Liberation Army Center For Disease Control And Prevention
Priority date: 2019-09-26
Filing date: 2019-09-26
Publication date: 2020-01-14

Abstract

The invention discloses application of IGF1 protein in regulation and control of acute lung injury mediated by influenza virus infection. Experiments prove that after H1N1 influenza virus A/Porto Rico/8/1934 is infected, IGF1 expression is up-regulated, the phosphorylation level of IGF1 receptor is increased, and two signal paths of downstream PI3K/AKT and MAPK are triggered to trigger inflammation. Inhibition of IGF1or IGF1R expression to block downstream signaling pathways is a new approach to the treatment of influenza. It can be seen that IGF1 plays an important immune function in H1N1 influenza A/Porto Rico/8/1934-mediated acute lung injury. The invention has important application value.

Description

Application of IGF1 protein in regulation and control of acute lung injury mediated by influenza virus infection

Technical Field

The invention belongs to the field of biomedicine, and particularly relates to application of IGF1 protein in regulation and control of acute lung injury mediated by influenza virus infection.

Background

Influenza is an acute infectious disease mainly caused by respiratory system damage caused by influenza virus, has the epidemiological characteristics of acute onset, wide spread, strong infectivity, large harm and the like, and seriously threatens the health of human beings. The research shows that a series of symptoms and consequences caused by the influenza virus are not caused by the direct action of the influenza virus, but are caused by inflammatory injury caused by over activation of an immune system after the influenza virus invades the body. Influenza viruses replicate in respiratory epithelial cells, inducing the production of chemokines (e.g., MCP-3, MIP-1 α, IP-10, IL-8) and early inflammatory factors (e.g., IL-6, TNF- α, IL-1 β), as well as IFN- α/- β. Appropriate cytokines contribute to the body's antiviral and Th1 type immune response induction, but excessive inflammatory responses can cause harm to the body. The main cause of high pathogenicity of avian influenza viruses such as H5N1 is the excessive production and secretion of large and excessive levels of pro-inflammatory cytokines, the "cytokine storm"; in 1918 "Spanish influenza" was also a fatal inflammatory injury of the lung tissue by triggering an over-provoking response of the human immune system. This inflammatory injury to lung tissue is not only a significant cause of death from influenza virus, but also a major cause of lung infection due to SARS, sepsis, and aspiration pneumonia. Currently, immunosuppressive agents (such as glucocorticoids) are often used clinically to inhibit inflammatory factor responses, so as to block disease processes and improve clinical treatment effects. Research has shown that 51% -69% of severe influenza A H1N1 patients have certain therapeutic effect when being treated with glucocorticoid. However, glucocorticoid systemically inhibits the immune function of the body, and can induce or aggravate infection, cause various complications and cause serious side effects such as femoral head necrosis after long-term administration. Therefore, the pathogenic mechanism of influenza virus is deeply understood, and the search for safer and more effective influenza treatment methods and strategies is not easy.

Insulin-like growth factor 1(Insulin-like growth factor 1, IGF1) belongs to the Insulin-like growth factor family. The family plays an important role in the processes of cell growth, differentiation, apoptosis and the like. IGF1 acts primarily by binding to IGF 1R. IGF1R is a transmembrane protein, and is composed of two alpha domains and two beta domains, the alpha domain can activate the beta domain after binding with IGF1, and the beta domain has tyrosine kinase activity, so that phosphorylation of Hepatocyte Growth Factor (HGF), docking protein Insulin Receptor Substrate (IRS), vascular endothelial growth factor (VGEF), growth factor receptor binding protein 2(Grb2) and the like can be promoted.

Disclosure of Invention

The aim of the invention is to treat influenza.

The invention firstly protects the application of the substance inhibiting the activity and/or expression quantity of IGF1 protein, which can be K1) or K2):

K1) preparing a product; the product may function as at least one of C1) to C9):

C1) preventing acute lung injury caused by influenza virus infection;

C2) treating acute lung injury caused by influenza virus infection;

C3) relieving inflammatory reaction caused by influenza virus infection;

C4) reducing the content of inflammatory factors;

C5) inhibit the PI3K/AKT signaling pathway;

C6) inhibition of the MAPK signaling pathway;

C7) reducing the expression level of the p-AKT protein;

C8) reducing the expression level of pp38 protein;

C9) reducing the expression level of p-JNK protein;

K2) developing or screening an agent; the use of the agent may be at least one of C1) to C9).

The invention also protects the application of the substance taking the IGF1 protein as a drug target, which can be K1) or K2):

K1) preparing a product; the product has a function of at least one of C1) to C9):

C1) preventing acute lung injury caused by influenza virus infection;

C2) treating acute lung injury caused by influenza virus infection;

C3) relieving inflammatory reaction caused by influenza virus infection;

C4) reducing the content of inflammatory factors;

C5) inhibit the PI3K/AKT signaling pathway;

C6) inhibition of the MAPK signaling pathway;

C7) reducing the expression level of the p-AKT protein;

C8) reducing the expression level of pp38 protein;

C9) reducing the expression level of p-JNK protein;

K2) developing or screening an agent; the use of the agent is at least one of C1) to C9).

The invention also protects the application of the IGF1 protein or the substance for improving the activity and/or expression quantity of the IGF1 protein in preparing products; the product may function as at least one of D1) to D5):

D1) activating PI3K/AKT signaling pathway;

D2) activating a MAPK signaling pathway;

D3) improving the expression level of the p-AKT protein;

D4) increasing the expression level of pp38 protein;

D5) improving the expression level of p-JNK protein.

The invention also protects the application of the IGF1 protein or the substance for improving the activity and/or expression quantity of the IGF1 protein in preparing animal models of inflammatory diseases.

The invention also protects a product A, which can contain a substance for inhibiting the activity and/or expression amount of IGF1 protein; the function of the product A can be at least one of C1) to C9):

C1) preventing acute lung injury caused by influenza virus infection;

C2) treating acute lung injury caused by influenza virus infection;

C3) relieving inflammatory reaction caused by influenza virus infection;

C4) reducing the content of inflammatory factors;

C5) inhibit the PI3K/AKT signaling pathway;

C6) inhibition of the MAPK signaling pathway;

C7) reducing the expression level of the p-AKT protein;

C8) reducing the expression level of pp38 protein;

C9) reduces the expression level of p-JNK protein.

The invention also protects a product B, which can contain IGF1 protein or a substance for improving the activity and/or expression of IGF1 protein; the application of the product B can be at least one of D1) to D6):

D1) activating PI3K/AKT signaling pathway;

D2) activating a MAPK signaling pathway;

D3) improving the expression level of the p-AKT protein;

D4) increasing the expression level of pp38 protein;

D5) improving the expression level of the p-JNK protein;

D6) preparing an animal model of inflammatory diseases.

Any one of the animal models of inflammatory diseases may be specifically an animal model of acute inflammatory diseases.

The content of inflammatory factors in the serum of any of the animal models for inflammatory diseases is increased.

Any of the influenza viruses described above may be an H1N1 influenza virus. The H1N1 influenza virus can be H1N1 influenza virus A/Porto Rico/8/1934.

Any one of the above inflammatory factors may be at least one of INF-gamma, TNF-alpha, IL-6 and IL-1 beta.

Any of the acute lung injuries described above may be acute inflammatory lung injury.

The amino acid sequence of any of the above IGF1 proteins is set forth in SEQ ID NO: 2, respectively.

The nucleotide sequence of any one of the genes encoding IGF1 protein is shown as SEQ ID NO: 1 is shown.

The content of any one of the above inflammatory factors may be the content of the inflammatory factor in the serum of a mouse.

The content of any one of the above inflammatory factors may be the content of the inflammatory factor of A549 cells.

Any of the PI3K/AKT signaling pathways described above can be the mouse PI3K/AKT signaling pathway.

Any of the MAPK signaling pathways described above may be the mouse MAPK signaling pathway.

The expression level of any of the p-AKT proteins can be that of a mouse p-AKT protein.

The expression level of any one of the pp38 proteins can be the expression level of the pp38 protein of the mouse.

The expression level of any of the above p-JNK proteins may be that of mouse p-JNK protein.

Any of the mice described above may be BALB/c mice.

PR8 significantly up-regulates IGF1 expression after infection of A549 cells and BALB/c mice, while IGF1 regulates the expression of inflammatory factors caused by PR8 infection. In order to study the role of IGF1 in PR 8-mediated acute lung injury, a PR 8-infected mouse model was established, mice were killed at 3d, 5d, 7d and 9d after viral infection to take lung tissues, and the change in IGF1mRNA and protein expression in mouse lung tissues before and after PR8 infection was detected; the mice are divided into a PBS group, a PR8+ PBS group, a PR8+ IGF1 group and a PR8+ PPP group, the weight and survival rate change of the mice is monitored every day, the clinical symptoms of the mice are recorded, 5d after PR8 infection, the mice are killed, the serum and lung tissues of the mice are taken, the expression of inflammatory factors in the serum of the mice is detected by ELISA, the lung tissue damage condition of the mice is observed by HE staining, the change of lung virus load is detected by qPCR, and the expression change of main proteins of PI3K/AKT and MAPK signal channels is detected by Western Blot. The results indicate that IGF1 plays an important immune function in PR 8-mediated acute lung injury in the lung. Overexpression of IGF1 aggravates the influenza-mediated inflammatory response, while inhibition of IGF1 expression results in a reduction in the influenza-mediated inflammatory response. After PR8 is infected, IGF1 expression is up-regulated, the phosphorylation level of IGF1 receptor is increased, two signal pathways of downstream PI3K/AKT and MAPK are triggered, inflammation is triggered, and the inhibition of IGF1or IGF1R expression to block the downstream signal pathway is a new way for treating influenza. Therefore, IGF1 can regulate and control PR 8-mediated acute lung injury, and a regulation mechanism is initially explored, so that a new potential therapeutic target point is provided for human beings to cope with influenza large outbreaks. The invention has important application value.

Drawings

FIG. 1 shows that PR8 infection of A549 cells up-regulates IGF1 expression. Wherein indicates that the difference is extremely significant, P < 0.01; indicates significant difference, 0.01< P < 0.05.

FIG. 2 shows that IGF1 regulates the expression of inflammatory factors mediated by PR8 infection. Wherein indicates that the difference is extremely significant, P < 0.01; indicates significant difference, 0.01< P < 0.05.

FIG. 3 shows that PR 8-infected mice up-regulated IGF1 expression. Wherein indicates that the difference is extremely significant, P < 0.01; indicates significant difference, 0.01< P < 0.05.

FIG. 4 shows the clinical manifestations, body weight and survival changes after infection of BALB/c mice with PR 8. Wherein, a in A is PBS group mouse, b is PR8+ PBS group mouse, c is PR8+ IGF1 group mouse, and d is PR8+ PPP group mouse. n is 15.

FIG. 5 shows lung injury after infection of BALB/c mice with PR 8. Wherein A is lung morphological change of BALB/C mice after infection, B is lung index change of BALB/C mice after infection, C is lung injury area of BALB/C mice after infection, D is lung tissue pathological change of BALB/C mice after infection (a is PBS group mice, B is PR8+ PBS group mice, C is PR8+ IGF1 group mice, D is PR8+ PPP group mice), and E is lung viral load of BALB/C mice after infection. n is 6. Indicates that the difference is extremely significant, P < 0.01; indicates significant difference, 0.01< P < 0.05.

FIG. 6 shows the changes in IL-6, TNF-. alpha., INF-. gamma.and IL-1. beta. after infection of BALB/c mice with PR 8. Wherein indicates that the difference is extremely significant, P < 0.01; indicates significant difference, 0.01< P < 0.05.

FIG. 7 shows acute lung injury caused by IGF1 modulating mouse infection with PR8 through PI3K/AKT and MAPK pathway.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention.

The experimental procedures in the following examples are conventional unless otherwise specified.

The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

The quantitative tests in the following examples, all set up three replicates and the results averaged.

A549 cells are products of ATCC company. A549 cells at 37 ℃ with 5% CO₂The culture was carried out in the incubator of (1), and the medium used was DMEM medium containing 10% (v/v) FBS.

BALB/c mice are products of the institute of military medicine laboratory animal center, SPF grade. IGF1 is a product of Peprotech corporation. The human IGF1ORF is a product of Guangzhou pluripotent Gene biologies, catalog No. A0153. TRIZOL is a product of Invitrogen corporation and Cat is 15596-. TIANScript RT Kit is a product of TIANGEN, and Cat is KR 104. The cell lysate and BCA Protein Assay Kit are both products of Beijing Comwin, and the Cat is CW0074 and CW0014, respectively. IL-6ELISA Kit, TNF-alpha ELISA Kit, INF-gamma ELISA Kit and IL-1 beta ELISA Kit are all products of R & D systems. SYBR Premix Ex Taq II is a product of TAKARA, and Cat is RR 820A.

The virus liquid is obtained by amplifying H1N1 influenza virus A/Porto Rico/8/1934 (PR 8 for short) in 9-11 day-old SPF-level chick embryo, and collecting allantoic liquid. The hemagglutination test shows that the hemagglutination titer of the virus liquid is 1: 512.

The virus diluent is obtained by diluting the virus liquid to 10 times by adopting a DMEM medium (without serum and containing 2 per mill of TPCK pancreatin). PR8 was used to infect A549 cells, and then the Reed-Muench method was used to calculate TCID₅₀. BALB/c mice were infected with PR8, and then the median lethal LD was calculated by the Reed-Muench method₅₀。

In the following examples, data statistics were performed using SPSS20.0 statistical software, using one-way anova, indicating that P <0.05 and P < 0.01. The plots were made using GraphPad Prism 5 software. The WB images were subjected to grayscale analysis using Image J.

In the following examples, primers for detecting IGF1 gene, GAPDH gene and inflammatory factor-related genes are shown in Table 1.

TABLE 1

Example 1 infection of A549 cells with PR8 upregulates IGF1 expression

One, experiment one

1. A549 cells are taken and are infected by PR8 (with the MOI of 0.5) for 12h, 24h, 48h or 72h to obtain the infected A549 cells. Extracting total RNA of the infected A549 cells by TRIZOL, and carrying out reverse transcription by a TIANScript RT Kit to obtain cDNA of the infected A549 cells. Extracting total RNA of A549 cells by TRIZOL, and carrying out reverse transcription by TIANScript RT Kit to obtain cDNA of the A549 cells.

2. And taking the cDNA of the infected A549 cell, and carrying out PCR amplification by adopting a primer pair consisting of IGF1-F and IGF1-R to obtain the expression quantity of the IGF1 gene in the infected A549 cell. Taking cDNA of A549 cells, carrying out PCR amplification by using a primer pair consisting of IGF1-F and IGF1-R to obtain the expression quantity of IGF1 gene in the A549 cells, and using the expression quantity as a control.

3. The expression level of the IGF1 gene in the a549 cells was taken as 1 to obtain the relative expression level of the IGF1 gene in the infected a549 cells.

The results are shown in FIG. 1A (Mock is control). The results show that the relative expression level of the IGF1 gene in the infected A549 cells is increased and then slightly fallen down along with the increase of the PR8 infection time, the relative expression level of the IGF1 gene in the A549 cells is the highest and is 6.35 +/-0.30 times of that of the control at the infection time of 48h, and the relative expression level of the IGF1 gene in the A549 cells still reaches 4.23 +/-0.18 times of that of the control at the infection time of 72 h.

Second, experiment two

1. A549 cells were taken and infected with PR8 (MOI of 0.1, 0.5 or 1.0) for 48h to give infected A549 cells. Extracting total RNA of the infected A549 cells by TRIZOL, and carrying out reverse transcription by a TIANScript RT Kit to obtain cDNA of the infected A549 cells. Extracting total RNA of A549 cells by TRIZOL, and carrying out reverse transcription by TIANScript RT Kit to obtain cDNA of the A549 cells.

The relative expression of the IGF1 gene in infected a549 cells is shown in B of fig. 1 (Mock as control). The results showed that the relative expression amount of IGF1 gene increased with the increase of MOI of PR 8; when the MOI was 1.0, the relative expression amount of IGF1 gene in infected a549 cells was increased to 7.49 ± 0.38-fold compared to the control.

Third, experiment three

1. A549 cells are taken and are infected by PR8 (with the MOI of 0.5) for 12h, 24h, 48h or 72h to obtain the infected A549 cells.

2. Taking a cell 1 to be detected (an infected A549 cell or an infected A549 cell), extracting total Protein of the cell 1 to be detected by using a cell lysate, quantifying the total Protein of the cell 1 to be detected by using a BCA Protein Assay Kit, taking the total Protein of the cell 1 to be detected, and carrying out Western Blot detection on IGF1 Protein (GAPDH Protein is used as an internal reference). The primary antibody for detecting the IGF1 protein is goat anti-IGF 1(Abcam), and the working concentration is 1: 2000; the secondary antibody was HRP-rabbit anti-goat IgG (sequoia argyrodid), working concentration was 1: 5000. primary antibody for detecting GAPDH protein was rabbit anti-GAPDH (abcam), working concentration was 1: 2000; the secondary antibody was HRP-goat anti-rabbit IgG (sequoia arguta) with working concentration of 1: 5000.

the results are shown in FIG. 1C (Mock is control). The results show that with the increase of PR8 infection time, the content of IGF1 protein in the infected A549 cells is increased firstly and then slightly falls back, which is basically consistent with the result of experiment one.

3. To more intuitively compare the variation trend of IGF1 protein, grayscale analysis was performed on C in FIG. 1, and the ratio of IGF1 protein/GAPDH protein was plotted to obtain E in FIG. 1 (Mock is a control).

The results show that the protein level change trend of the infected A549 cells is basically consistent with the results of the experiment I along with the increase of the infection time of the PR 8; IGF1 protein levels were highest in a549 cells at 48h infection, 1.82-fold higher than controls.

Fourth, experiment four

1. A549 cells were taken and infected with PR8 (MOI of 0.1, 0.5 or 1.0) for 48h to give infected A549 cells.

2. Replacing the cell 1 to be detected in the step three 2 with the cell 2 to be detected, and keeping other steps unchanged. The test cells 2 are a549 cells or infected a549 cells obtained in step 1.

The levels of IGF1 protein in infected a549 cells are shown in fig. 1D (Mock for control). The results showed that IGF1 protein levels also increased with increasing MOI of PR8, in substantial agreement with the results of experiment two.

3. To more intuitively compare the variation trend of IGF1 protein, grayscale analysis was performed on D in FIG. 1, and the ratio of IGF1 protein/GAPDH protein was plotted to obtain F in FIG. 1 (Mock is control).

The results show that the protein level change trend of the infected A549 cells is basically consistent with the results of experiment two along with the increase of the MOI of PR 8; the levels of IGF1 protein in infected a549 cells were 2.26-fold higher than controls when the MOI was 1.0.

The above results indicate that PR8 infection of a549 cells up-regulates IGF1 protein expression.

Example 2 IGF1 regulates the expression of inflammatory factors mediated by PR8 infection

Firstly, constructing pcDNA3.1-IGF1 cell and pcDNA3.1-con cell

1. Construction of recombinant plasmid pcDNA3.1-IGF1

(1) Human IGF1ORF was used as template with F: 5' -TGCTCTAGAATGGGAAAAATCAGCAGTCT-3' (recognition site for restriction enzyme XbaI underlined) and R: 5' -CCGCTCGAGCTACATCCTGTAGTTCTTGT-3' (recognition sites for restriction enzyme XhoI are underlined) was subjected to PCR amplification, and a PCR amplification product of about 480bp was recovered.

(2) Taking the PCR amplification product, carrying out enzyme digestion by using restriction enzymes XbaI and XhoI, and recovering a DNA fragment of about 460 bp.

(3) The pcDNA3.1(+) vector (Invitrogen) was digested with restriction enzymes XbaI and XhoI, and the vector backbone of about 5400bp was recovered.

(4) The DNA fragment and the vector backbone were ligated to obtain recombinant plasmid pcDNA3.1-IGF 1.

The recombinant plasmid pcDNA3.1-IGF1 was sequenced. According to the sequencing results, the recombinant plasmid pcDNA3.1-IGF1 was structurally described as follows: the DNA fragment between the restriction enzymes XbaI and EcoRI of the pcDNA3.1(+) vector was replaced by the DNA fragment of SEQ ID NO: 1 (DNA molecule shown in SEQ ID NO: 1, namely IGF1 gene) to obtain the recombinant plasmid.

The recombinant plasmid pcDNA3.1-IGF1 expresses SEQ ID NO: 2, or IGF 1.

2. Construction of pcDNA3.1-IGF1 cell

(1) Adding 4 μ g of recombinant plasmid pcDNA3.1-IGF1 (about 8 μ L) into 250 μ L of serum-free DMEM, and mixing to obtain solution 1; adding 10 mu L of LiPO2000 into 250 mu L of serum-free DMEM, and uniformly mixing to obtain a solution 2; and (3) uniformly mixing the solution 1 and the solution 2 to obtain a system.

(2) Transfecting A549 cells by adopting the system prepared in the step (1), and carrying out 5% CO at 37 DEG C₂After 48h of culture, G418 was added to a final concentration of 500. mu.g/mL, and the cells were selected until the cell line was stably grown to obtain A549 cells overexpressing IGF 1.

Hereinafter, the A549 cell over-expressed by IGF1 is abbreviated as pcDNA3.1-IGF1 cell.

3. Construction of pcDNA3.1-con cell

According to the above step 2, the recombinant plasmid pcDNA3.1-IGF1 was replaced with pcDNA3.1(+) vector, and the cells obtained were abbreviated as pcDNA3.1-con cells without any change in the other steps.

Secondly, constructing Lenti + shIGF1 cells and Lenti + con cells

1. Adding 1 mu g of Lenti-IGF1shRNA plasmid (santa cruz) into 100 mu L of transfection medium (santacruz), and uniformly mixing to obtain solution A; adding 6 mu L of transfection reagent (santa cruz) into 100 mu L of transfection medium, and uniformly mixing to obtain solution B; and (3) uniformly mixing the solution A and the solution B, and standing at room temperature for 30min to obtain a system.

2. Washing A549 cells with 2mL of transfection medium, adding 800 μ L of transfection medium, transfecting A549 cells with the system prepared in step 1 at 37 deg.C and 5% CO₂After 48h of culture, puromycin was added to a final concentration of 1.5. mu.g/mL, and the cell line was screened until stable growth to obtain A549 cells expressing IGF 1.

Hereinafter, a549 cells in which IGF1 inhibits expression are abbreviated as Lenti + shIGF1 cells.

According to the steps, the Lenti-IGF1shRNA plasmid is replaced by a Control shRNA plasmid (santacruz), other steps are not changed, and the obtained cell is called Lenti + con cell for short.

Three, qPCR detection of the relative expression level of IGF1 gene

The cell to be detected is a Control cell (namely, A549 cell), a pcDNA3.1-IGF1 cell, a pcDNA3.1-con cell, a Lenti + shIGF1 cell or a Lenti + con cell.

1. And extracting the total RNA of the cell to be detected by TRIZOL, and then carrying out reverse transcription by using TIANScript RT Kit to obtain the cDNA of the cell to be detected.

2. After step 1, taking cDNA of the cell to be detected, and carrying out qPCR by using SYBR Premix Ex Taq II, using 2^-△△tThe method detects the relative expression level of IGF1 gene (GAPDH gene as internal control).

The results are shown in FIG. 2A. The results show that the relative expression level of the IGF1 gene in pcDNA3.1-IGF1 cell is increased to 15.28 +/-1.84 times of that of Control cell, and the relative expression level of the IGF1 gene in Lenti + shIGF1 cell is decreased to 0.21 +/-0.087 times of that of Control cell.

Fourthly, qPCR detection of relative expression quantity of genes related to inflammatory factors

1. And (3) taking a cell to be detected (pcDNA3.1-IGF1 cell, pcDNA3.1-con cell, Lenti + shIGF1 cell or Lenti + con cell), and infecting the cell with PR8 (MOI of 0.5) for 24h to obtain an infected cell to be detected.

2. Extracting total RNA of 'infected cells to be detected' by TRIZOL, and then carrying out reverse transcription by using TIANScript RT Kit to obtain cDNA of the infected cells to be detected.

3. Total RNA of Control cells (namely A549 cells) is extracted by TRIZOL, and then TIANscript RTkit is used for reverse transcription to obtain cDNA of the Control cells as a Control.

4. The "cDNA of infected test cell" or cDNA of Control cell was subjected to qPCR using SYBR Premix Ex TaqII, and 2 was used^-△△tThe method detects the relative expression level of genes related to inflammatory factors (IL-6 gene, IL-8 gene, IL-10 gene, TNF-alpha gene, IL-1 beta gene or CCL2 gene) (GAPDH gene as internal reference).

The results of the detection are shown in B of FIG. 2 (Mock is Control cell). The results showed that the level of inflammatory factor-related genes of infected pcDNA3.1-con cell or infected Lenti + con cell was significantly increased and the level of cytokines of infected pcDNA3.1-IGF1 cell was further increased, compared to the control; the cytokine level of the infected Lenti + shIGF1 cells was significantly reduced, not only much lower than that of the infected Lenti + con cells, but also lower than that of the Control cells, and the level of CCL2 and TNF-alpha with the lowest expression level was down-regulated to less than half of that of the Control cells. The results show that the inflammatory reaction caused by PR8 infection is aggravated by over-expressing IGF1, and the inflammatory reaction caused by PR8 infection can be relieved by inhibiting the expression of IGF 1.

Example 3 PR8 infection of mice upregulates IGF1 expression and IGF1 regulates acute lung injury caused by PR8 infection of mice

One, mouse grouping and IGF1 processing

1. Taking 120 female BALB/c mice with the weight of 18-20g and the week of 6-8, injecting pentobarbital sodium into the abdominal cavity of each mouse, wherein the injection dose is 50 mg/kg; after the mice entered the deep anesthesia state, the mice were randomly divided into four groups of 30 mice each. The following treatments were carried out:

PBS group (control): experiment 0h, injecting PBS buffer solution into abdominal cavity; experiment 6h, each mouse was nasally instilled with 30 μ L PBS buffer; the 30 th experiment, intraperitoneal injection of PBS buffer solution; injecting PBS buffer solution into abdominal cavity every 24h for 13 days; the volume of intraperitoneal injection of PBS buffer was the same as the volume of injection of IGF1 in PR8+ IGF1 group;

PR8+ PBS group: experiment 0h, injecting PBS buffer solution into abdominal cavity; experiment 6h, each mouse was nasally titrated with 30 μ L of virus diluent; the 30 th experiment, intraperitoneal injection of PBS buffer solution; injecting PBS buffer solution into abdominal cavity every 24h for 13 days; the volume of intraperitoneal injection of PBS buffer was the same as the volume of injection of IGF1 in PR8+ IGF1 group;

PR8+ IGF1 group: experiment 0h, i.p. IGF 1; experiment 6h, each mouse was nasally titrated with 30 μ L of virus diluent; experiment 30h, i.p. IGF 1; injecting IGF1 intraperitoneally every 24h for 13 days; the dose of the intraperitoneal injection of IGF1 is 20 mug/kg/day;

PR8+ PPP group: experiment 0h, intraperitoneally injecting picropodophyllin (PPP, IGF1 receptor inhibitor, product of Selleck); experiment 6h, each mouse was nasally titrated with 30 μ L of virus diluent; in the 18 th experiment, picropodophyllin is injected into the abdominal cavity; then intraperitoneally injecting the picropodophyllin every 12h for 13 days; the dose of the picropodophyllin for intraperitoneal injection is 20mg/kg/12 h.

Secondly, PR8 infection of mice up-regulates IGF1 expression (gene and protein level)

1. During step one, mice in the PBS group, PR8+ PBS group, PR8+ IGF1 group and PR8+ PPP group were sacrificed at 3d, 5d, 7d and 9d after PR8 infection, respectively, and blood was collected from the eyeball and then lung tissue was taken.

2. Taking the blood collected in the step 1, standing for 1h at room temperature, centrifuging for 15min at 12000r/min, collecting supernatant (the supernatant is serum), and preserving at-80 ℃.

3. The total RNA of lung tissues of PR8+ IGF1 mice or PBS mice is respectively extracted by TRIZOL, and then reverse transcription is carried out by utilizing TIANScript RT Kit to obtain cDNA of the lung tissues. Lung tissue cDNA was collected and qPCR was performed using SYBR Premix ExTaq II, using 2^-△△tThe method detects the relative expression level of IGF1 (GAPDH as an internal control).

The results are shown in FIG. 3A. The results show that the relative expression of IGF1 in the PR8+ IGF1 group is gradually increased with the increase of PR8 infection time, the 7d is increased to 5.81 +/-0.623 times of the PBS group, and the relative expression of IGF1 of the 9d is slightly reduced.

4. Extracting the total protein of lung tissues of PR8+ IGF1 group mice or PBS group mice by adopting cell lysate, and quantifying the total protein of the lung tissues by using BCAProtein Assay Kit; then, total protein of lung tissue was taken and Western Blot detection was performed on IGF1 protein (GAPDH protein as internal control). Detecting that the primary antibody of IGF1 protein is goat anti-IGF 1, and the working concentration is 1: 2000; the secondary antibody is HRP-rabbit anti-goat IgG, and the working concentration is 1: 5000. detecting primary antibody of GAPDH protein as rabbit anti-GAPDH, and the working concentration is 1: 2000; the secondary antibody is HRP-goat anti-rabbit IgG, and the working concentration is 1: 5000.

the detection result is shown in B in FIG. 3.

5. In order to more intuitively compare the variation trend of IGF1 protein, grayscale analysis was performed on B in FIG. 3, and the ratio of IGF1 protein/GAPDH protein was plotted to obtain C in FIG. 3.

The results show that with the increase of PR8 infection time, the content of IGF1 protein in the PR8+ IGF1 group is increased and then slightly falls back, which is basically consistent with the results of qPCR.

6. Serum of PR8+ IGF1 group mice or PBS group mice is taken, and content change of IGF1 protein in the serum is detected by ELISA.

The results are shown in FIG. 3D. The detection result shows that compared with the control, the content of the IGF1 protein in the serum of the PR 8-infected mouse at 5d is obviously increased, and the content of the IGF1 in the serum of the mouse at 9d is slightly reduced. This result is essentially consistent with the qPCR and Western Blot results.

It follows that PR8 infected mice can up-regulate IGF1 expression both at the gene level and at the protein level.

Thirdly, IGF1 regulates and controls acute lung injury caused by PR8 infection of mice

1. During step one, mice were observed daily for changes in clinical symptoms and for records of body weight changes and survival rates.

Changes in clinical symptoms in mice are shown in a in fig. 4: the skin and hair of the mouse in the PBS group (a) are smooth, the reaction is flexible, the mental state is good, and the food intake is large; the mice of PR8+ PBS group (b) began to develop flu symptoms at 3d after inoculation, began to lose weight, had tiny erections of hairs, continued coughing, delayed response, mice at 5d were extremely lean, eyes were slightly closed, there was secretion in the canthus, hairs stooped on the back, contracted into a mass, and had very little ingestion; the clinical symptoms of the mice in group (c) of PR8+ IGF1 were more severe than those in the group of PR8+ PBS; the mice in the PR8+ PPP group (d) exhibited less clinical signs than in the PR8+ PBS group.

The body weight change of the mice is shown in fig. 4B, and the survival rate curve is shown in fig. 4C: the body weight of the 3 rd mouse is obviously reduced after the PR8 is infected, and the body weight of the 9 th mouse is reduced to the lowest value; the body weight changes of the PR8+ PPP group and the PR8+ PBS group are basically consistent, but the survival rate of the PR8+ PBS group is only 25%, while the survival rate of the PR8+ PPP group is increased to 75%, and the first death time of the mice is delayed to 8 d; the first death in the PR8+ IGF1 group mice progressed to the 4d, to 8d post-infection, and all mice died. Therefore, the intraperitoneal injection of the IGF1 protein can promote the death of the PR8 infected mice, and the inhibition of the IGF1 can improve the survival rate of the PR8 infected mice.

2. During the first step, several groups of mice were sacrificed 5d after PR8 infection, and blood was collected from the eyeball and then lung tissue was collected.

3. The lung tissue was observed for lesions, and macroscopic lung lesions appeared dark red with edema.

The lung injury of some mice is shown as A in FIG. 5: after PR8 infected mouse, the lung of mouse is damaged to different extent, the color of the damaged part is changed from pink to dark red, and edema condition is appeared; the lung injury of the mice in the group of PR8+ IGF1 is obviously more severe than that of the group of PR8+ PBS, the lung color is darker, and the injury area is larger, while the lung injury of the mice in the group of PR8+ PPP is obviously lighter than that of the group of PR8+ PBS.

4. Estimating the area ratio of the lung injury part to lung tissues, estimating each sample by at least 3 different persons to obtain an average value, and counting the lung injury area of each group of mice at least by 6 effective samples. And (3) taking mouse lung tissues, removing redundant tissues, weighing lung wet weight, and calculating a lung index. Lung index is lung wet weight/body weight.

Statistical results of lung injury are shown in fig. 5B and C: lung index of mice not infected with PR8 (i.e., PBS group) was around 1%; compared with the PR8+ PBS group mice, the lung index of the PR8+ IGF1 group mice is obviously increased from 1.953 +/-0.074% to 2.515 +/-0.121%, and the lung injury area is also increased from 0.38 +/-0.042 to 0.78 +/-0.069; the lung index of the PR8+ PPP group is reduced to 1.393 plus or minus 0.032%, and the lung injury area is also reduced to 0.25 plus or minus 0.062, which are all lower than that of the PR8+ PBS group.

5. The mice in each group were observed for lung injury by sectioning. The pathological section results are shown in fig. 5D: the lung structures of the mice in the PBS group (a) are clear, the complete alveoli are clearly separated, bleeding and inflammatory cell infiltration conditions are avoided, the alveoli of the mice in the PR8+ PBS group (b), the PR8+ IGF1 group (c) and the PR8+ PPP group (d) are damaged to different degrees, the inflammatory cell infiltration condition of lung tissues in the PR8+ IGF1 group is stronger than that of the PR8+ PBS group, and the inflammatory infiltration condition of the PR8+ PPP group is lighter than that of the PR8+ PBS group.

6. And respectively taking mouse lung tissues, and calculating the virus load of the mouse lung by using a real-time fluorescent quantitative PCR probe method.

The probe is as follows: 5 '-FAM-TGCAGTCCTCGCTCACTGGGCACG-BHQ 1-3', and the primer sequences are 5 '-GACCRATCCTGTCACCTCTGAC-3' and 5 '-GGGCATTYTGGACAAAKCGTCTACG-3'.

The reaction conditions are as follows: 30sec at 95 ℃; 5sec at 95 ℃, 30sec at 60 ℃, 40 cycles; and (4) analyzing a dissolution curve.

The results of the pulmonary viral load test in mice are shown in fig. 5E: compared with the PR8+ PBS group, the lung viral load of mice in the PR8+ IGF1 group is remarkably increased and is increased by 1.598X 10^-2±5.42×10^-4ng/. mu.L is increased to 3.256X 10^-2±1.19×10^-2ng/. mu.L, but the viral loads of the PR8+ PPP group and the PR8+ PBS group were substantially the same. It follows that IGF1 affects the effect of PR8 on the body only by modulating the biological effects of the body itself, and not by acting on the replication of PR 8.

7. And (3) taking the blood collected in the step (2), standing at room temperature for 1h, centrifuging at 12000r/min for 15min, collecting supernatant (the supernatant is serum), and preserving at-80 ℃.

8. And (3) taking the serum collected in the step (7), detecting the expression level of IL-6 by adopting an IL-6ELISA Kit, detecting the expression level of TNF-alpha by adopting a TNF-alpha ELISA Kit, detecting the expression level of INF-gamma by adopting an INF-gamma ELISA Kit, and detecting the expression level of IL-1 beta by adopting an IL-1 beta ELISA Kit. IL-6, TNF-alpha, INF-gamma and IL-1 beta are inflammatory factors.

The results are shown in FIG. 6. The result shows that the content of the inflammatory factors in the serum of the mouse is obviously increased after PR8 infection, the content of the inflammatory factors is further increased by injecting IGF1 protein into the abdominal cavity, wherein the IL-1 beta has larger error due to individual difference and has no statistical difference with a PR8+ PBS group; and the serum contents of inflammatory factors INF-gamma, TNF-alpha, IL-6 and IL-1 beta in the mice in the PR8+ PPP group are obviously reduced, wherein the content of IL-1 beta is lower than that in the PBS group.

Therefore, IGF1 aggravates the inflammatory response caused by PR8, and inhibition of IGF1 can relieve the inflammatory response caused by PR 8.

Example 4 IGF1 Regulation of acute Lung injury caused by mice infected with PR8 through PI3K/AKT and MAPK pathways

In order to explore the mechanism that IGF1 regulates PR8 to cause acute lung injury, Western Blot was used to detect the expression level of key molecules of relevant signaling pathways in mouse lung tissues.

1. The PBS group (control), PR8+ PBS group, PR8+ IGF1 group, and PR8+ PPP group were the same as in step one of example 3.

PBS + PPP group: taking 30 female BALB/c mice with the weight of 18-20g and the week of 6-8, and injecting pentobarbital sodium into the abdominal cavity of each mouse, wherein the injection dose is 50 mg/kg; after the mice enter a deep anesthesia state, the following treatment is carried out: in the 0h of experiment, picropodophyllin is injected into the abdominal cavity; experiment 6h, each mouse was nasally instilled with 30 μ L PBS buffer; in the 18 th experiment, picropodophyllin is injected into the abdominal cavity; then intraperitoneally injecting the picropodophyllin every 12h for 13 days; the dose of the picropodophyllin for intraperitoneal injection is 20mg/kg/12 h.

2. During step 1, mice in the PR8+ PBS and PR8+ IGF1 groups were sacrificed at 3d, 5d, 7d and 9d post PR8 infection, respectively, and lung tissue was taken.

3. Extracting the total protein of lung tissues of PR8+ IGF1 group mice or PBS group mice by adopting cell lysate, and quantifying the total protein of the lung tissues by using BCAProtein Assay Kit; total protein from lung tissue was then taken and Western Blot detection was performed on IGF1R protein and p-IGF1R protein (GAPDH protein as internal control).

The primary antibody for detecting IGF1R protein was rabbit anti-IGF 1R (product of Abcam Co.).

The primary antibody for detecting p-IGF1R protein was rabbit anti-p-IGF 1R (product of Cell singling Technology).

The primary antibody for detecting GAPDH protein is rabbit anti-GAPDH.

The results are shown in FIG. 7A. The results show that the levels of phosphorylation of IGF1 receptor gradually increased after PR8 infection, peaked at 7d post infection, followed by a slight drop back in receptor phosphorylation at 9d, consistent with the trend of the IGF1 protein changes in step two of example 3.

4. During step 1, mice in the PBS group, PBS + PPP group, PR8+ PBS group, PR8+ IGF1 group, and PR8+ PPP group were sacrificed at 5d after PR8 infection, respectively, and then lung tissue was taken.

5. Extracting the total Protein of the lung tissue obtained in the step 4 by adopting a cell lysate, and quantifying the total Protein of the lung tissue by using a BCA Protein assay kit; then, the total protein of lung tissue was extracted and Western Blot detection was performed on p-JNK protein, p38 protein, pp38 protein, p-AKT protein and AKT protein (GAPDH protein as internal reference).

The primary antibody for detecting p-JNK protein was rabbit anti-p-JNK (product of Cell singling Technology).

The primary antibody for detecting JNK protein was rabbit anti-JNK (product of Cell singling Technology).

The primary antibody for detecting p38 protein was rabbit anti-p 38 (product of Cell Singaling Technology).

The primary antibody to detect pp38 protein was rabbit anti-pp 38 (product of Cell singling Technology).

The primary antibody to be detected as p-AKT protein was rabbit anti-p-AKT (product of Cell singling Technology).

The primary antibody to the AKT protein was detected as rabbit anti-AKT (product of Cell singling Technology).

The results are shown in B, C and D in FIG. 7. The result shows that PR8 activates PI3K/AKT and MAPK signal pathway after infection, p-AKT expression is up-regulated in PI3K/AKT signal pathway, and pp38 and p-JNK expression are up-regulated in MAPK signal pathway. PR8+ IGF1 group p-AKT and pp38 levels were further elevated. The expression level of the PR8+ PPP group was between that of the PBS group and that of the PR8+ PBS group. There was no significant difference in p-JNK expression between groups infected with PR 8.

Thus, it can be seen that administration of IGF1 protein following PR8 infection promotes activation of the P38 signaling pathway of PI3K/AKT and MAPK associated with inflammation. The use of IGF1R inhibitor PPP for dry prognosis has inhibitory effect on PR8 mediated P38 signaling pathway of PI3K/AKT and MAPK. IGF1 does influence the expression of key proteins of the P38 signaling pathway and PI3K/AKT signaling pathway of MAPK in PR 8-mediated inflammation.

<110> China people liberation force disease prevention control center

Application of <120> IGF1 protein in regulation and control of acute lung injury mediated by influenza virus infection

<160>2

<170>PatentIn version 3.5

<210>1

<211>462

<212>DNA

<213>Artificial sequence

<400>1

atgggaaaaa tcagcagtct tccaacccaa ttatttaagt gctgcttttg tgatttcttg 60

aaggtgaaga tgcacaccat gtcctcctcg catctcttct acctggcgct gtgcctgctc 120

accttcacca gctctgccac ggctggaccg gagacgctct gcggggctga gctggtggat 180

gctcttcagt tcgtgtgtgg agacaggggc ttttatttca acaagcccac agggtatggc 240

tccagcagtc ggagggcgcc tcagacaggc atcgtggatg agtgctgctt ccggagctgt 300

gatctaagga ggctggagat gtattgcgca cccctcaagc ctgccaagtc agctcgctct 360

gtccgtgccc agcgccacac cgacatgcccaagacccaga aggaagtaca tttgaagaac 420

gcaagtagag ggagtgcagg aaacaagaac tacaggatgt ag 462

<210>2

<211>153

<212>DNA

<213>Artificial sequence

<400>2

Met Gly Lys Ile Ser Ser Leu Pro Thr Gln Leu Phe Lys Cys Cys Phe

1 5 10 15

Cys Asp Phe Leu Lys Val Lys Met His Thr Met Ser Ser Ser His Leu

20 25 30

Phe Tyr Leu Ala Leu Cys Leu Leu Thr Phe Thr Ser Ser Ala Thr Ala

35 40 45

Gly Pro Glu Thr Leu Cys Gly Ala Glu Leu Val Asp Ala Leu Gln Phe

50 55 60

Val Cys Gly Asp Arg Gly Phe Tyr Phe Asn Lys Pro Thr Gly Tyr Gly

65 70 75 80

Ser Ser Ser Arg Arg Ala Pro Gln Thr Gly Ile Val Asp Glu Cys Cys

85 90 95

Phe Arg Ser Cys Asp Leu Arg Arg Leu Glu Met Tyr Cys Ala Pro Leu

100 105 110

Lys Pro Ala Lys Ser Ala Arg Ser Val Arg Ala Gln Arg His Thr Asp

115120 125

Met Pro Lys Thr Gln Lys Glu Val His Leu Lys Asn Ala Ser Arg Gly

130 135 140

Ser Ala Gly Asn Lys Asn Tyr Arg Met

145 150

Claims

1. The application of the substance for inhibiting the activity and/or expression of IGF1 protein is K1) or K2):

C1) preventing acute lung injury caused by influenza virus infection;

C2) treating acute lung injury caused by influenza virus infection;

C3) relieving inflammatory reaction caused by influenza virus infection;

C4) reducing the content of inflammatory factors;

C5) inhibit the PI3K/AKT signaling pathway;

C6) inhibition of the MAPK signaling pathway;

C7) reducing the expression level of the p-AKT protein;

C8) reducing the expression level of pp38 protein;

C9) reducing the expression level of p-JNK protein;

2. The application of the substance taking IGF1 protein as a drug target is K1) or K2):

C1) preventing acute lung injury caused by influenza virus infection;

C2) treating acute lung injury caused by influenza virus infection;

C3) relieving inflammatory reaction caused by influenza virus infection;

C4) reducing the content of inflammatory factors;

C5) inhibit the PI3K/AKT signaling pathway;

C6) inhibition of the MAPK signaling pathway;

C7) reducing the expression level of the p-AKT protein;

C8) reducing the expression level of pp38 protein;

C9) reducing the expression level of p-JNK protein;

The application of IGF1 protein or 'a substance for improving the activity and/or expression of IGF1 protein' in preparing products; the product has a function of at least one of D1) to D5):

D1) activating PI3K/AKT signaling pathway;

D2) activating a MAPK signaling pathway;

D3) improving the expression level of the p-AKT protein;

D4) increasing the expression level of pp38 protein;

D5) improving the expression level of p-JNK protein.

Use of IGF1 protein or "an IGF1 protein activity and/or expression increasing substance" in preparation of an animal model for inflammatory diseases.

5. Product A comprising an amount of a substance which inhibits the activity and/or expression of IGF1 protein; the product A has at least one of the functions of C1) to C9):

C1) preventing acute lung injury caused by influenza virus infection;

C2) treating acute lung injury caused by influenza virus infection;

C3) relieving inflammatory reaction caused by influenza virus infection;

C4) reducing the content of inflammatory factors;

C5) inhibit the PI3K/AKT signaling pathway;

C6) inhibition of the MAPK signaling pathway;

C7) reducing the expression level of the p-AKT protein;

C8) reducing the expression level of pp38 protein;

C9) reduces the expression level of p-JNK protein.

6. Product B, which contains IGF1 protein or 'a substance for improving the activity and/or expression level of IGF1 protein'; the application of the product B is at least one of D1) to D6):

D1) activating PI3K/AKT signaling pathway;

D2) activating a MAPK signaling pathway;

D3) improving the expression level of the p-AKT protein;

D4) increasing the expression level of pp38 protein;

D5) improving the expression level of the p-JNK protein;

D6) preparing an animal model of inflammatory diseases.

7. The use according to claim 4 or the product b according to claim 6, characterized in that: the inflammation animal model is an acute inflammation animal model.

8. Use according to claim 1, 2, 3, 4 or 7, or a product a or a product b according to any one of claims 5 to 7, wherein: the influenza virus is H1N1 influenza virus.

9. Use according to claim 1, 2, 3, 4, 7 or 8, or product a or product b according to any one of claims 5 to 8, wherein: the inflammatory factor is at least one of INF-gamma, TNF-alpha, IL-6 and IL-1 beta.

10. Use according to claim 1, 2, 3, 4, 7, 8 or 9, or product a or product b according to any one of claims 5 to 9, wherein: the acute lung injury is acute inflammatory lung injury.