CN110669679B - Penicillium oxalicum - Google Patents
Penicillium oxalicum Download PDFInfo
- Publication number
- CN110669679B CN110669679B CN201911054300.7A CN201911054300A CN110669679B CN 110669679 B CN110669679 B CN 110669679B CN 201911054300 A CN201911054300 A CN 201911054300A CN 110669679 B CN110669679 B CN 110669679B
- Authority
- CN
- China
- Prior art keywords
- lignite
- penicillium oxalicum
- benzoic acid
- treated
- dissolving
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
Abstract
The invention provides Penicillium oxalicum and application thereof in preparation of benzoic acid by dissolving lignite, wherein the Penicillium oxalicum is classified and named as Penicillium oxalicum, and is preserved in China general microbiological culture collection management center in 2019, 10 months and 25 days, and the preservation number is CGMCC No. 18600; the method for preparing benzoic acid by dissolving lignite comprises the steps of culturing Penicillium oxalicum, adding lignite, and continuously culturing. The Penicillium oxalicum is a high-efficiency lignite dissolving bacterium, is inoculated in a CDA culture medium for culturing for 48 hours, and is added with acid-treated or alkali-treated lignite, so that the lignite can be well dissolved after being fermented for 15 days, and high-concentration benzoic acid can be detected in fermentation liquor after fermentation.
Description
Technical Field
The invention relates to the technical field of microbial dissolution of low-rank coal, and in particular relates to penicillium oxalicum and application thereof in preparation of benzoic acid by dissolution of lignite.
Background
China has rich coal resources, particularly low-rank coal resources such as lignite and weathered coal, the storage amount of lignite is rich in the eastern part of Mongolia, northeast and Yunnan and other areas in China, and the proven storage amount of lignite is up to 2100 hundred million tons and accounts for about 13 percent of the total coal resource amount in China.
Lignite is low-quality coal with low coalification degree, has the characteristics of good chemical activity, high water content, low calorific value, high volatile content and the like, is low in direct combustion heat efficiency and serious in pollution, and is easy to weather and natural and difficult to store and transport after being stacked in the open air for a long time. Coal resources account for more than 70% of energy structures in China, and with the exhaustion of clean coal resources, development and utilization of low-rank coal are more and more concerned.
Lignite can be used as a fuel energy source, and can also be used for producing chemical raw materials, adsorbents, catalyst carriers, purified sewage and the like. At present, the lignite is developed and utilized by mainly converting the lignite into liquid or gas through physical and chemical methods through means of high temperature, high pressure and the like to replace oil fuels or prepare chemical products, and the method is characterized by higher cost and rigorous conditions; the microbial conversion of lignite to dissolve or convert lignite into another product as fuel or to extract chemical product has the advantages of simple process, no pollution, low treatment cost, etc. The low-rank coal such as lignite keeps a large amount of similar lignin substance structures due to low coalification degree, which is the key point for degrading lignite by using microorganisms. Therefore, the method has feasibility for degrading low-rank coal such as lignite by using microorganisms, particularly mould.
As most of the mould can generate extracellular peroxidases, the microorganisms capable of degrading lignin are separated from the lignite or other environments to degrade the low-rank coal such as the lignite, and industrial chemical products with special values are obtained from the microorganisms, so that a new effective way is provided for the efficient and clean utilization of the lignite.
Disclosure of Invention
One of the purposes of the invention is to provide Penicillium oxalicum which is classified and named as Penicillium oxalicum, and is preserved in China general microbiological culture collection center with the preservation number of CGMCC number 18600, the preservation address of the institute of microorganisms (100101) of the Chinese academy of sciences, namely Siro 1 of Beijing republic of the sunward district, and the preservation date of the Penicillium oxalicum is 2019, 10 months and 25.
The morphological and physiological and biochemical identification of the strain is carried out according to the fungal identification manual.
Through morphological identification and biological characteristic research, the Penicillium oxalicum is aerobic bacteria, after being cultured in a solid CDA culture medium at 28 ℃ for 72 hours, bacterial colonies are dark green with the density of 0.5-1.0 cm and are approximately round, white villous hyphae are arranged at the edges, the bacterial colonies are flat, have no folds and no bulges, a large number of spore blocks are easy to pick, and spores are easy to fall off; the Penicillium oxalicum catalase and oxidase activities are positive, and can hydrolyze starch.
Specifically, the optimum growth conditions of the Penicillium oxalicum Penicillium oxyalicum are as follows: the temperature was 28 ℃ and the pH was 7.0, the medium was CDA (sodium nitrate 3 g, dipotassium hydrogen phosphate 1 g, magnesium sulfate MgSO4·7H20.5 g of O, 0.5 g of potassium chloride, 0.01 g of ferrous sulfate, 30 g of sucrose, 15-20 g of agar, 1000 mL of distilled water and pH of 7.0-7.2); incubation time 48h, gray green spores began to produce.
By taking ITS rDNA as a Marker fragment, an ITS gene sequence amplified by a primer is compared with an NT database for BLAST analysis, a phylogenetic tree is constructed to obtain information of a near-source species, a strain HM-M1 and penicillium oxalicumPenicillium oxalicumAt the smallest branch, is the approximate species.
Extracting the ITS serial number of the strainThe accession numbers granted for the transfer to the NCBI gene bank are: GQ 851779.1; the isolated strain numbered HM-M1 was finally identified asPenicillium oxalicum. For preservation, the strain is inoculated on a CDA agar slant and cultured for 72 h at 28 ℃, 3 mL of sterilized 50% glycerol/50% CDA liquid culture medium is added, then slant spores and hyphae are scraped by an inoculating ring, and 2 mL of spore and hyphae suspension is filled into a strain freezing tube for long-term preservation (2 years) at-80 ℃; the strain is preserved on CDA solid inclined plane at ordinary times, preserved in a refrigerator at 4 ℃, and transferred periodically (2 months).
The other purpose of the invention is to provide the application of the penicillium oxalicum in the preparation of benzoic acid by dissolving lignite.
The invention also provides a method for preparing benzoic acid by dissolving lignite with the penicillium oxalicum, which comprises the following steps: culturing the Penicillium oxalicum, and adding the pretreated lignite into a culture solution for continuous culture.
In the technical scheme, the culture medium of the Penicillium oxalicum Penicillium oxalicum is a CDA liquid culture medium, and the culture time is 24-48 h.
Further, in the above technical scheme, the lignite is pretreated by crushing and sieving lignite, and then carrying out acid treatment or alkali treatment on the lignite.
Specifically, in the technical scheme, the acid treatment method comprises the steps of soaking the raw materials in a nitric acid solution with the concentration of 3-5 mol/L for 18-32 h, continuously stirring in the soaking process, repeatedly washing the raw materials with distilled water until the pH value is neutral, sterilizing at 121 ℃, and drying for later use.
Specifically, in the technical scheme, the alkali treatment method comprises the steps of soaking the raw materials in a sodium hydroxide solution with the concentration of 3-5 mol/L for 18-32 h, continuously stirring in the soaking process, repeatedly washing the raw materials with distilled water until the pH value is neutral, sterilizing at 121 ℃, and drying for later use.
Still further, in the above technical solution, the mesh number of the sieve is 80-120 meshes.
Still further, in the above technical scheme, after the Penicillium oxalicum is cultured, the pulverized, sieved and acid-treated lignite is added into the culture solution for continuous culture for 10-15 days, the dissolution and liquefaction rate of the lignite is 34.5-48.0%, and the concentration of benzoic acid in the culture solution is 52.1-73.6 mg/L; after the Penicillium oxalicum is cultured, the pulverized, sieved and alkali-treated lignite is added into the culture solution for continuous culture for 10-15 days, the dissolution and liquefaction rate of the lignite is 27.3-35.2%, and the concentration of benzoic acid in the culture solution is 21.4-26.0 mg/L.
The invention has the following beneficial effects:
(1) the Penicillium oxalicum is a high-efficiency lignite dissolving bacterium, is inoculated in a CDA culture medium for culturing for 48 hours, and is added with an acid-treated and alkali-treated lignite sample, so that the acid-treated and alkali-treated lignite is well dissolved after being fermented for 15 days, and high-concentration benzoic acid can be detected in fermented liquid after fermentation;
(2) the method comprises the steps of coating Penicillium oxalicum on a CDA plate culture medium, culturing for 48 hours at 28 ℃, then uniformly scattering acid-treated lignite crushed to 100 meshes on the surface of a bacterial colony, continuously culturing for 7 days, obviously seeing black liquid drops generated after dissolution of the lignite, and verifying through multiple tests that the effect of Penicillium oxalicum in lignite dissolution is obvious.
Description of the drawings:
FIG. 1 is a colony morphology and a hyphal microscopic morphology of Penicillium oxalicum in accordance with an embodiment of the present invention;
FIG. 2 is a schematic diagram of a phylogenetic tree of Penicillium oxalicum and homologous strain 18S rDNA gene sequences according to an embodiment of the present invention;
FIG. 3 shows the dissolution effect of Penicillium oxalicum in CDA liquid medium on lignite (A: inactivated Penicillium HM-M1+ acid-treated lignite; B: Penicillium HM-M1+ acid-treated lignite; C: Penicillium HM-M1+ alkali-treated lignite) according to the present invention;
FIG. 4 shows the result of the dissolution rate of Penicillium oxalicum in lignite according to the example of the present invention;
FIG. 5 is a graph showing the concentration of benzoic acid in a Penicillium oxalicum fermentation broth in accordance with an embodiment of the present invention;
FIG. 6 is a liquid chromatogram of benzoic acid from a Penicillium oxalicum fermentation broth according to an embodiment of the present invention.
Detailed Description
The following examples are given to further illustrate the embodiments of the present invention. The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.
Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are commercially available.
Example 1 isolation and characterization of the strains
Taking a fresh lignite sample of a Nengyueli coal mine, and obtaining 23 microbial strains capable of dissolving lignite from the lignite through pretreatment, separation and screening, wherein the screening steps are as follows:
(1) weighing 10g of granular brown coal, washing the granular brown coal with sterile water for three times, grinding the brown coal into fine powder by using a sterilized mortar, dissolving the powder in 90 mL of sterile physiological saline water, and diluting the powder by 10 and 10 degrees in a gradient manner2、103Then evenly coating the mixture on CDA and LB solid plate culture mediums, carrying out inverted culture at 28 ℃, after bacterial colonies fully grow out, respectively picking single bacterial colonies by using an inoculating needle to carry out streak purification culture on the corresponding solid culture mediums, repeatedly purifying for 4-5 times until the streak plate has only single bacterial colonies, and finally obtaining 13 strains of mould, 1 strain of saccharomycete and 9 strains of bacillus through physiological biochemical and morphological identification;
(2) a bacterial strain HM-M1 with a good lignite dissolving effect is finally obtained through a coal dissolving experiment, the bacterial strain HM-M1 is inoculated in a tissue culture bottle filled with a CDA solid culture medium, pretreated lignite powder is scattered on the surface of a bacterial colony after the bacterial strain is cultured for 48 hours at 28 ℃, the culture is continued for 7 days, and the bacterial strain HM-M1 is observed to dissolve acid-treated lignite and generate black liquid drops. Inoculating the strain HM-M1 into 100mL of liquid Czochralski culture medium, performing shake culture at 28 ℃ for 48h, adding 2 g of acid to treat the lignite, performing shake culture for 10 days, centrifuging the fermentation liquid at 1000 rpm for 20min, filtering the supernatant with a 0.45-micrometer membrane, and detecting by high performance liquid chromatography, wherein the result proves that the strain HM-M1 dissolves high-concentration benzoic acid in the degradation product of the lignite.
(3) And (3) repeatedly streaking and purifying the single bacterial colony of the strain HM-M1 in the step (1) on a CDA agar plate for 3 times, and performing physiological and biochemical identification on the single bacterial colony of the strain HM-M1 on a solid plate.
As shown in FIG. 1, the colony morphology of the strain HM-M1 provided by the embodiment of the invention is an approximately circular dark green colony with the diameter of 0.5-1.0 cm, the edge of the colony is white villous, the colony is flat and has no bulge, the surface of the colony has no wrinkles, a large number of spores are generated, the spores are easy to pick up and fall off, the pH adaptation range in a liquid Mach's medium is wide, the spores can grow well within the pH range of 4.5-8.5, and the optimal growth temperature is 28 ℃. The strain can dissolve and liquefy acid-treated and alkali-treated lignite to form black liquid drops, and the dissolution effect of the acid-treated lignite is better than that of the alkali-treated lignite.
Molecular biology level identification:
taking 10 mL strain HM-M1 liquid culture, freeze-centrifuging at 10000 rpm for 15 min, suspending mycelia with sterile water, repeatedly centrifuging and cleaning for 3 times, and extracting DNA.
PCR operation:
PCR primers were amplified using fungal ITS universal primers.
(1) Primer sequences
ITS1： TCCGTAGGTGAACCTGCGG
ITS4： TCCTCCGCTTATTGATATGC
(2) PCR amplification
And (3) PCR reaction system: 10 XEx Taq buffer 2.0. mu.l; 5U Ex Taq 0.2. mu.l; 2.5 mM dNTP Mix 1.6. mu.l; 27F 1. mu.l; 1492R 1 μ l; DNA 0.5. mu.l; ddH2O 13.7.7. mu.l.
(3) And (3) PCR reaction conditions: 5 min at 95 ℃; 25 cycles of 95 ℃ 30 s, 56 ℃ 30 s, 72 ℃ 90 s; 10 min at 72 ℃.
After the PCR amplification is finished, 1% agarose gel electrophoresis (electrophoresis at 120V for 30 min) is adopted, and the PCR product is about500 bp, PCR products were directly sequenced one-generation double-ended using 3730XL sequencer. Obtaining AB1 sequencing peak map file, assembling with software, comparing with NT library, performing BLAST analysis, constructing phylogenetic tree to obtain information of near-source species (phylogenetic tree is shown in figure 2), and obtaining strain HM-M1 and strain HM-M1Penicillium oxalicum is the approximate species with minimal branching. The permissive accession number obtained by submitting the ITS sequence of the strain to NCBI gene bank on line is as follows: GQ 851779.1.
Combining the morphological characteristics and physiological and biochemical identification results of HM-M1, and determining that the result isPenicillium oxalicumHM-M1; the strain is preserved in China center for type culture Collection in 2019, 10 months and 25 days, and the preservation number is CGMCC number 18600.
Example 2 Effect of benzoic acid, phenol and salt concentration on Penicillium oxalicum growth
In the experimental process, solid PDA culture media containing benzoic acid and phenol with the concentrations of 20 mg/L, 50 mg/L, 100 mg/L, 300 mg/L and 500 mg/L are respectively prepared, NaCl with the concentrations of 5%, 10%, 15% and 20% is respectively prepared, and Penicillium oxalicum is streaked and inoculated on a corresponding PDA plate for culture at 28 ℃.
The result shows that the phenol with the concentration of below 500 mg/L has no obvious inhibition effect on the Penicillium oxalicum; the benzoic acid with the concentration of below 300 mg/L has no obvious inhibition effect on Penicillium oxalicum; the NaCl tolerance concentration of the Penicillium oxalicum Penicillium oxalicum is 10 percent; when the concentration of phenol is higher than 800 mgL, the concentration of benzoic acid is higher than 500 mg/L and the concentration of NaCl is higher than 15%, the growth of HM-M1 is obviously inhibited.
Researches show that phenols, benzoic acid, esters thereof and inorganic salts are generated in the lignite dissolving process, so that the researches on the tolerance of the Penicillium oxalicum to the phenols, the benzoic acid and the inorganic salts are of great significance for the researches on the preparation of the benzoic acid by dissolving the lignite with the Penicillium oxalicum.
Example 3 dissolution test and fermentation broth benzoic acid content determination of acid treated lignite by Penicillium oxalicum
In order to further study the dissolving liquefaction and fermentation capacity of the Penicillium oxalicum to lignite to generate benzoic acid, lignite powder after acid treatment (the lignite powder is crushed to be below 100 meshes, soaked in 3 mol/L nitric acid for 48 hours, washed to be neutral by tap water, sterilized at 121 ℃, dried at 80 ℃) is added into a CDA liquid culture medium containing the Penicillium oxalicum for 48 hours of shaking culture according to the proportion of 5 wt%, and the shaking culture is continued for 15 days at the condition of 28 ℃ and 120 rpm.
The coal dissolving effect is measured by a dry weight method, and the content of benzoic acid in the culture solution is measured by an HPLC method. The results of the coal-dissolving effect and the benzoic acid content measurement are shown in fig. 4 and 5, and the results show that the liquefaction and dissolution rate of acid-treated lignite can reach 42% by culturing 10 days of Penicillium oxalicum, the liquefaction and dissolution rate of acid-treated lignite can reach 48% by culturing 15 days of Penicillium oxalicum, and in addition, the benzoic acid concentration in the fermentation broth can reach 73mg/L at 15 days.
Example 4 dissolution test and fermentation broth benzoic acid content determination of Penicillium oxalicum on alkali-treated lignite
Adding brown coal powder treated by NaOH (the brown coal powder is crushed to be below 100 meshes, soaked by 3 mol/L NaOH for 48h, washed by tap water to be neutral, mildewed at 121 ℃ and dried at 80 ℃) into a CDA liquid culture medium which contains 48h of Penicillium oxalicum and is subjected to shake culture at 28 ℃ and 120 rpm for 15 days according to the proportion of 5 wt%.
The coal dissolving effect is measured by a dry weight method, and the content of benzoic acid in the culture solution is measured by an HPLC method. The results of the coal dissolving effect and the benzoic acid content are shown in fig. 4 and 5, and the results show that the liquefaction and dissolution rate of alkali-treated lignite can reach 35% by culturing 15-day Penicillium oxalicum, and in addition, the benzoic acid concentration in the fermentation liquor can reach 26.0 mg/L.
In addition, the culture solution of Penicillium oxalicum after culturing for 48 hours under shaking was inactivated at 121 ℃ for 20min to obtain Penicillium oxalicum culture solutionPenicillium oxalicumWhen HM-M1 was completely dead, the same ratio as in example 3 was added with pulverized brown coal (pulverized brown coal is crushed to below 100 mesh and is treated with 3 mol-L in nitric acid for 48h, then washed with tap water to neutrality, sterilized at 121 c, and oven-dried at 80 c), as compared with examples 3 and 4, the comparison results are shown in fig. 3.
It can be seen from fig. 3 that the inactivated Penicillium oxalicum has almost no dissolving and liquefying effect on the added acid-treated lignite, while the inactivated Penicillium oxalicum can dissolve the acid-treated and alkali-treated lignite to generate black dissolved matter, which indicates that the pretreated lignite is dissolved and liquefied Penicillium oxalicum, but is not naturally dissolved in lignite.
The above description is of the preferred embodiment of the present invention, but the present invention is not limited to the embodiment disclosed, and all equivalent implementations and modifications without departing from the spirit of the present invention are within the scope of the present invention.
Sequence listing
<110> university of inner Mongolia science and technology
<120> penicillium oxalicum and application thereof in preparation of benzoic acid by dissolving lignite
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 559
<212> DNA
<213> Penicillium oxalicum (Penicillium oxalicum)
<400> 1
tggctcgagt gagctctggg tcacctccca cccgtgttta tcgtaccttg ttgcttcggc 60
gggcccgcct cacggccgcc ggggggcatc cgcccccggg cccgcgcccg ccgaagacac 120
acaaacgaac tcttgtctga agattgcagt ctgagtactt gactaaatca gttaaaactt 180
tcaacaacgg atctcttggt tccggcatcg atgaagaacg cagcgaaatg cgataagtaa 240
tgtgaattgc agaattcagt gaatcatcga gtctttgaac gcacattgcg ccccctggta 300
ttccgggggg catgcctgtc cgagcgtcat tgctgccctc aagcacggct tgtgtgttgg 360
gctctcgccc cccgcttccg gggggcgggc ccgaaaggca gcggcggcac cgcgtccggt 420
cctcgagcgt atggggcttc gtcacccgct ctgtaggccc ggccggcgcc cgccggcgaa 480
caccatcaat cttaaccagg ttgacctcgg atcaggtagg gatacccgct gaacttaagc 540
atatcaataa gcggaggaa 559
Claims (1)
1. A penicillium oxalicum, which is classified and namedPenicillium oxalicumThe strain has been preserved in China general microbiological culture collection center in 2019, 10 months and 25 days, and the preservation number is CGMCC number 18600;
the penicillium oxalicum is aerobic bacteria, and after being cultured in a CDA culture medium at 28 ℃ for 72 hours, the bacterial colony is dark green with the color of 0.5-1.0 cm, is approximately circular, has white villous hyphae at the edge, is flat, has no folds and no bulges, is easy to pick a large number of spore blocks and is easy to fall off; the penicillium oxalicum catalase and oxidase activities are positive and can hydrolyze starch.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911054300.7A CN110669679B (en) | 2019-10-31 | 2019-10-31 | Penicillium oxalicum |
| CN202011409095.4A CN112430548B (en) | 2019-10-31 | 2019-10-31 | Application of penicillium oxalicum in preparation of benzoic acid by dissolving lignite |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911054300.7A CN110669679B (en) | 2019-10-31 | 2019-10-31 | Penicillium oxalicum |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011409095.4A Division CN112430548B (en) | 2019-10-31 | 2019-10-31 | Application of penicillium oxalicum in preparation of benzoic acid by dissolving lignite |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110669679A CN110669679A (en) | 2020-01-10 |
| CN110669679B true CN110669679B (en) | 2021-02-23 |
Family
ID=69085293
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911054300.7A Active CN110669679B (en) | 2019-10-31 | 2019-10-31 | Penicillium oxalicum |
| CN202011409095.4A Active CN112430548B (en) | 2019-10-31 | 2019-10-31 | Application of penicillium oxalicum in preparation of benzoic acid by dissolving lignite |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011409095.4A Active CN112430548B (en) | 2019-10-31 | 2019-10-31 | Application of penicillium oxalicum in preparation of benzoic acid by dissolving lignite |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN110669679B (en) |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101410719B1 (en) * | 2012-05-11 | 2014-07-01 | 수원대학교 산학협력단 | Fungal strain Penicillium oxalicum KL1 and production method of lignocellulose-degrading enzymes using the strain |
| JP6223778B2 (en) * | 2013-10-28 | 2017-11-01 | 積水アクアシステム株式会社 | Microorganism, water purification method, wastewater treatment method, and anionic substance adsorbent |
| RU2014116670A (en) * | 2014-04-23 | 2015-10-27 | Петров Алексей Иванович | METHOD FOR COMPREHENSIVE PROCESSING OF BROWN COAL AND LEONARDITIS IN HUMIC FERTILIZERS, PREPARATIONS AND IN FUEL BRIQUETTES AND MECHANOCHEMICAL REACTOR FOR PROCESSING HIGH-VISCOUS MEDIA |
| CN105296363B (en) * | 2015-10-28 | 2019-06-04 | 南京农业大学 | A kind of penicillium oxalicum NJDL-03 bacterial strain and its application |
| CN107286007B (en) * | 2016-04-12 | 2019-12-24 | 北京化工大学 | Method for preparing benzene carboxylic acid and micromolecular fatty acid by lignite grading alkali-oxygen oxidation |
| CN107815433B (en) * | 2017-12-08 | 2021-03-12 | 青岛益佰农肥业有限公司 | Compound microbial agent and application thereof in producing fulvic acid by fermenting humic acid lignite |
-
2019
- 2019-10-31 CN CN201911054300.7A patent/CN110669679B/en active Active
- 2019-10-31 CN CN202011409095.4A patent/CN112430548B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112430548B (en) | 2021-09-14 |
| CN110669679A (en) | 2020-01-10 |
| CN112430548A (en) | 2021-03-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102533601B (en) | Bacillus simplex, and culture method and application thereof | |
| CN110257365B (en) | Preparation method and application of immobilized microbial agent for kitchen waste treatment | |
| CN110484471B (en) | Acid-resistant strain for high yield of bacterial cellulose and method for producing bacterial cellulose by using acid-resistant strain | |
| CN104087525B (en) | A kind of novel biosurfactant production seawater fermented type bacterial strain | |
| WO2017133331A1 (en) | Pseudomonas aeruginosa and use thereof in production of protease | |
| Liu et al. | Characteristics for production of hydrogen and bioflocculant by Bacillus sp. XF-56 from marine intertidal sludge | |
| CN107619802B (en) | Marine bacillus psychrobacter and method for preparing flocculant by using same | |
| KR101920557B1 (en) | Mixed Strain for Decomposing Food Waste and Method for Treating Food Waste Using the Same | |
| CN110484462B (en) | Novel species of genus Shen-shi and application thereof | |
| CN114164133B (en) | Geobacillus thermodenitrification DC8 strain and application thereof | |
| CN110669679B (en) | Penicillium oxalicum | |
| CN108913629B (en) | Bacterium for producing cellulase, preparation method and application thereof | |
| CN108841743B (en) | Cold region straw rotten bacterial strain and preparation method and application thereof | |
| CN107012222A (en) | It is a kind of that preparation method is oriented based on the pickle starter that 16S rDNA are sequenced | |
| CN108865901B (en) | Aspergillus oryzae strain and application thereof in aflatoxin degradation | |
| RU2673971C1 (en) | Strain of bacteria paenibacillus species - a producer of xylanase | |
| CN113913347B (en) | Paenibacillus balun TZ-1 and application thereof | |
| Zhuge et al. | A novel strain of Planomicrobium isolated from paper mill and its capacity of cellulose degradation | |
| CN109337837B (en) | Bacillus thermophilus DF7 strain and application thereof | |
| CN103289905B (en) | Low-rank coal degrading bacteria and application thereof in brown coal liquefaction | |
| CN114507614A (en) | Bacillus for degrading straw and inhibiting plant pathogenic fungi and application thereof | |
| CN108060094B (en) | Soil composting bacillus and microbial agent and application thereof | |
| CN108841742B (en) | Saline-alkali-tolerant bacillus strain ZH-1 and preparation method and application thereof | |
| CN112574918A (en) | Ammonia nitrogen degrading bacteria, microbial agent and application thereof | |
| De et al. | An insight into the celluloytic potential of three strains of Bacillus spp. isolated from benthic soil of aquaculture farms in East Kolkata Wetlands, India. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |