CN110669113B - Lanthionine precursor peptide amyA2, and preparation method and application thereof - Google Patents
Lanthionine precursor peptide amyA2, and preparation method and application thereof Download PDFInfo
- Publication number
- CN110669113B CN110669113B CN201910997808.4A CN201910997808A CN110669113B CN 110669113 B CN110669113 B CN 110669113B CN 201910997808 A CN201910997808 A CN 201910997808A CN 110669113 B CN110669113 B CN 110669113B
- Authority
- CN
- China
- Prior art keywords
- amya2
- precursor peptide
- lantibiotic
- peptide
- bacillus amyloliquefaciens
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/38—Chemical stimulation of growth or activity by addition of chemical compounds which are not essential growth factors; Stimulation of growth by removal of a chemical compound
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P1/00—Preparation of compounds or compositions, not provided for in groups C12P3/00 - C12P39/00, by using microorganisms or enzymes
- C12P1/04—Preparation of compounds or compositions, not provided for in groups C12P3/00 - C12P39/00, by using microorganisms or enzymes by using bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/07—Bacillus
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a lantibiotic peptide precursor peptide amyA2, a preparation method and application thereof, and relates to the technical field of biology. The amino acid sequence of the lantibiotic precursor peptide amyA2 is shown in SEQ ID NO 1. The lantibiotic peptide precursor amyA2 is added in the fermentation process of the bacillus amyloliquefaciens, so that the antibacterial activity of the metabolite of the bacillus amyloliquefaciens can be obviously improved, and the duration of the antibacterial activity is more than 3 times of the original antibacterial activity.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a lantibiotic peptide precursor amyA2, a preparation method thereof and application thereof in the process of improving the antibacterial activity of a bacillus amyloliquefaciens metabolite.
Background
In the modern agricultural production process, the biggest problem is that the crop yield is influenced by plant diseases. At present, plant diseases can be divided into the following types according to pathogen transmission modes: soil-borne diseases, air-borne diseases, seed-borne diseases, mediator-borne diseases and the like. Among them, soil-borne diseases and air-borne diseases are the most common. Soil-borne diseases are diseases caused by pathogens such as fungi, bacteria, nematodes and viruses that live in the soil with disease residues and, where appropriate, attack crops from their roots or stems. The infection pathogen comprises fungi, bacteria, actinomycetes and the like, wherein the fungi are the main pathogens. The most common and serious harmful bacteria in the greenhouse are the early blight bacteria. Airborne diseases refer to the spread of germs or spores with the airflow, generally at relatively long distances. In the disease development period, the air carries a large amount of germs, and the disease can be infected once the conditions are proper. For example, gray mold is caused by botrytis cinerea infection, belongs to fungal diseases, and can be attacked by flowers, fruits, leaves and stems. The disease is an air-borne disease and can be spread along with air, water flow and farm work.
At present, the traditional method of spreading chemical pesticide is mostly adopted for preventing and treating agricultural diseases. The method not only causes pollution to the environment, but also harms other animals, plants and human health. In recent years, researchers begin to adopt biological control methods to treat plant diseases, and biological pesticides have a series of advantages of high efficiency, environmental protection, no drug resistance and the like. Therefore, the search for new highly effective biological control means to solve plant diseases has been largely delayed. The current research on biocontrol strains mainly includes biocontrol bacteria (bacillus, actinobacillus, pseudomonas) and biocontrol fungi (trichoderma). Wherein, the bacillus amyloliquefaciens of the bacillus has better inhibiting effect on various plant diseases. Although the bacillus amyloliquefaciens metabolite has higher economic value, the problems of low yield, complicated extraction process and the like exist in the aspect of industrial production.
Disclosure of Invention
The invention aims to solve the technical problem of providing a lantibiotic peptide precursor amyA2, and a preparation method and application thereof, wherein the lantibiotic peptide precursor amyA2 is added in the fermentation process of bacillus amyloliquefaciens, so that the bacteriostatic activity of the metabolite of the bacillus amyloliquefaciens can be obviously improved, and the duration of the bacteriostatic activity is more than 3 times of the original bacteriostatic activity.
In order to solve the technical problems, the technical scheme adopted by the invention is as follows: a lantibiotic precursor peptide, amyA2, having the amino acid sequence of amyA2 shown in SEQ ID NO 1.
The preparation method of the lantibiotic precursor peptide amyA2 comprises the following steps: the lantibiotic peptide precursor amyA2 is obtained by heterologous expression or artificial synthesis of the lantibiotic peptide precursor amyA2 gene with a specific gene sequence in Escherichia coli.
The above-mentioned lantibiotic precursor peptide amyA2 gene is derived from Bacillus amyloliquefaciens WS-8. Extracting genome of Bacillus amyloliquefaciens WS-8 as template, taking primer A2-S, A2-A as upstream and downstream primers (SEQ ID NO: 3; SEQ ID NO:4), and carrying out PCR amplification to obtain the gene segment of lantibiotic peptide precursor amyA 2.
The gene sequence of the above-mentioned lantibiotic precursor peptide amyA2, amyA2, is shown in SEQ ID NO 2.
The heterologous expression method of the escherichia coli comprises the following steps:
(1) construction and transformation of the recombinant vector for the lantibiotic precursor peptide amyA 2: the lantibiotic precursor peptide amyA2 gene fragment is constructed on a PET-28a vector by a gene recombination method. The recombinant vector was transformed into E.coli BL21(DE3) by heat shock transformation.
(2) Induction of expression of the lantibiotic precursor peptide amyA 2: BL21 expression strain is cultured in liquid LB culture medium, heterologous expression of lanthionine precursor peptide amyA2 protein is induced by adding IPTG, the thalli is re-suspended by 8M urea solution, and then the thalli is crushed by ultrasound, and the lanthionine precursor peptide amyA2 is released. The supernatant was collected by centrifugation, dialyzed for three days using a dialysis bag with a pore size of 1000Da and finally freeze-dried to powder of the lantibiotic precursor peptide amyA 2.
The application of the lantibiotic precursor peptide amyA2 is as follows: application of lantibiotic precursor peptide amyA2 in the process of improving the antibacterial activity of a bacillus amyloliquefaciens metabolite.
Preferably, the lantibiotic precursor peptide amyA2 is added for the following period: the fermentation of the bacillus amyloliquefaciens starts to the end of the logarithmic phase of growth.
Preferably, the lantibiotic precursor peptide amyA2 is added in an amount of: 0.001-10mg/L of lanthionine precursor peptide amyA2 is added into the fermentation liquor of bacillus amyloliquefaciens.
Specifically, the application comprises the following steps: culturing (fermenting) Bacillus amyloliquefaciens in liquid NB culture medium for 12 hours to logarithmic phase, taking out the shaking table, adding 0.001-10mg/L lanthionine precursor peptide amyA2 into the fermentation liquid, continuing fermentation culture, centrifuging after 24 hours, and collecting supernatant.
Adopt the produced beneficial effect of above-mentioned technical scheme to lie in:
firstly, the lantibiotic peptide precursor peptide amyA2 is added into the bacillus amyloliquefaciens fermentation liquor, so that the bacteriostatic activity of the lantibiotic peptide precursor peptide amyA2 can be obviously enhanced. The results show that the diameter of the inhibition zone of the experimental group is enlarged by more than 2 times compared with the control group, and the existence time of the inhibition zone can be prolonged by more than 3 times compared with the control group, namely the lantibiotic peptide precursor peptide amyA2 is added in the fermentation process of the bacillus amyloliquefaciens, so that the bacteriostatic activity of the metabolite of the bacillus amyloliquefaciens can be obviously improved by more than 2 times, and the duration time of the bacteriostatic effect is prolonged by more than 3 times. Secondly, the method has low production cost, short production period, simple process and high yield. Finally, the method does not produce secondary pollution and does not cause harm to human bodies, animals, plants and ecological environment. Therefore, the method has wide application prospect.
Detailed Description
The present invention will be described in further detail with reference to specific embodiments.
Experimental materials and reagents required in the first and following examples
1. Strains and vectors:
the Bacillus amyloliquefaciens WS-8 is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms with the serial number of CGMCC No. 11787. Coli BL21(DE3) was purchased from TransGen Biotech, Inc., Beijing Korea. pET-28a vectors were purchased from Tiannze Biotechnology Inc. (TIANDZ).
2. Enzymes and other biochemical reagents:
KOD-Plus polymerase was purchased from Shanghai Gentianbio Ltd (TOYOBO). The TIANGEN bacterial genome DNA extraction kit is a product of Tiangen Biochemical technology Co. The Axygen gel recovery kit is a product of American Seikagan company. The Vazyme kit is a product of Nanjing Novozam Biotech Co.
3. Unless otherwise indicated, the biochemical techniques used in the present invention are conventional in the art.
II, the formula of the culture medium required in the following examples:
LB culture medium: 10g of tryptone, 5g of NaCl and 5g of yeast extract, adding deionized water to reach the constant volume of 1000ml, and adjusting the pH value to 7.0-7.2.
NB medium: 10g of peptone, 5g of NaCl, 5g of beef extract and 10g of glucose, adding deionized water to reach the constant volume of 1000ml, and adjusting the pH value to 7.0-7.2.
PDA culture medium: 200g of potatoes and 20g of glucose, and adding deionized water to the volume of 1000 ml.
The culture medium is liquid culture medium, and 12g agar is added into corresponding solid culture medium.
Example 1 Source of lanthionine precursor peptide amyA2
The lanthionine precursor peptide amyA2 gene was derived from Bacillus amyloliquefaciens WS-8.
The whole genome of Bacillus amyloliquefaciens WS-8 was extracted using a TIANGEN bacterial genomic DNA extraction kit.
Primer 5.0 was used to design lantibiotic precursor peptide amyA2 primers, with homologous fragments at both ends of pET-28a added as homology arms at both ends of the precursor peptide sequence (A2-S: CTTTAAGAAGGAGATATACCATGGATTCAAATCCAATATA, SEQ ID NO: 3; A2-A: CCTTTCGGGCTTTGTTAACACCAGCAAGTGTGAG, SEQ ID NO: 4).
The lantibiotic precursor peptide amyA2 gene fragment was PCR amplified. The PCR reaction was carried out using KOD-Plus polymerase and the genomic DNA of Bacillus amyloliquefaciens WS-8 as a template and primers A2-S, A2-A as upstream and downstream primers, and PCR was carried out to obtain the lantibiotic peptide precursor peptide amyA2 gene fragment.
The gene sequence of the precursor peptide amyA2 is:
ATGGATTCAAATCCAATATATTTCAAAAACTCAAGGGGAGGAATATTAGTGAATGAGAAAATGTATCGTTTTGCCGGTGATTTAAGAGAAGAACTTGAGGAAATTTCTTTAAATGAATTCAGCGGAGGAGGAGGCGCAGAACAGCGGGGGATTTCTCAAGGAAATGATGGTAAGCTTTGTACGTTAACTTGGGAATGCGGTCTTTGCCCTACTCACACTTGCTGGTGTTAA is added. Shown as SEQ ID NO. 2.
The PCR reaction system is as follows: DNA template, about 100 ng; 10 μ M of upstream and downstream primers, each 1.5 μ L; 10 × Buffer, 5 μ L; 2Mm dNTPs, 5 μ L; 25mM MgSO4, 2. mu.L; KOD-Plus, 1. mu.L, water was added to make volume 50. mu.L. The PCR reaction program is: pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 30 s; tm-5 ℃, and renaturation is 40 s; extending for 1min at 68 ℃; stretching at 68 deg.C for 10 min; and preserving at 4 ℃.
EXAMPLE 2 heterologous expression of E.coli
(1) Construction of precursor peptide Gene expression vector
A precursor peptide Primer and a pET-28a vector sequence specific Primer are designed by using Primer 5.0, and homologous fragments at two ends of pET-28a are added at two ends of the precursor peptide sequence to be used as homologous arms. PCR is carried out on the precursor peptide gene fragment and the pET-28a carrier fragment, a PCR amplification product is verified through 1% agarose gel electrophoresis, and an Axygen gel recovery kit is used for recovering a target band. The purified precursor peptide gene fragment and the pET-28a vector fragment are connected by ligase in a Vazyme kit to construct a recombinant vector. The recombinant vector was transformed into E.coli BL21(DE3) by heat shock transformation, and positive transformants were selected on LB plates containing kanamycin (50. mu.g/mL) and verified by sequencing.
(2) Obtaining of inducible expression precursor peptide protein
The precursor peptide protein is obtained by adopting a molecular biology technology heterologous expression mode. BL21 expression strain is cultured in liquid LB culture medium, heterologous expression of precursor peptide protein is induced by adding IPTG (Isopropyl Thiogalactoside, isoproyl beta-D-Thiogalactoside), the thallus is re-suspended by 8M urea solution, and the thallus is broken by ultrasonic wave to release the precursor peptide. The supernatant was collected by centrifugation, dialyzed for three days using a dialysis bag with a pore size of 1000Da and finally freeze-dried to powder of the lantibiotic precursor peptide amyA 2.
The amino acid sequence of the precursor peptide amyA2 is:
Met-Asp-Ser-Asn-Pro-Ile-Tyr-Phe-Lys-Asn-Ser-Arg-Gly-Gly-Ile-Leu-Val-Asn-Glu-Lys-Met-Tyr-Arg-Phe-Ala-Gly-Asp-Leu-Arg-Glu-Leu-Glu-Glu-Ile-Ser-Leu-Asn-Glu-Phe-Ser-Gly-Gly-Gly-Gly-Ala-Glu-Gln-Arg-Gly-Ile-Ser-Gln-Gly-Asn-Asp-Gly-Lys-Leu-Cys-Thr-Leu-Thr-Trp-Glu-Gly-Leu-Cys-Pro-Thr-His-Thr -Cys-Trp-Cys. Shown as SEQ ID NO. 1.
Example 3
The application of the lantibide precursor peptide amyA2 in the process of improving the antibacterial activity of the metabolite of the bacillus amyloliquefaciens comprises the following steps:
(1) fermentation of bacillus amyloliquefaciens:
experimental groups: culturing (fermenting) bacillus amyloliquefaciens in a liquid NB culture medium for 12 hours to a logarithmic phase, taking out a shaking table, adding 0.001-10mg/L lanthionine precursor peptide amyA2 into a fermentation liquid, continuing fermentation culture, and centrifuging after 24 hours to collect a supernatant (supernatant 1);
control group: culturing (fermenting) bacillus amyloliquefaciens in a liquid NB medium for 12 hours to the logarithmic phase, taking out the shaking table simultaneously with the experimental group, adding no lantibiotic precursor peptide amyA2, continuing the fermentation culture, and centrifuging after 24 hours to collect the supernatant (supernatant 2).
(2) Plate confrontation test:
carrying out a plate confrontation experiment by taking Botrytis cinerea, Fusarium sambucinum and Alternaria solani as indicator bacteria;
experimental groups: preparing an indicator bacterium suspension, pouring the indicator bacterium suspension into a preheated and melted solid PDA culture medium, uniformly mixing, and pouring 30mL of the indicator bacterium suspension into each flat plate in a quantitative manner; after the flat plate is solidified, punching by using a puncher with the diameter of 8 mm; 100uL of prepared fermentation supernatant liquid 1 is added into the holes, and finally the mixture is placed in a constant temperature incubator at 26 ℃ for culturing for several days, and the result is observed.
Control group: 100uL of the prepared fermentation broth "supernatant 2" was added to another well as a control, and the mixture was cultured in a constant temperature incubator at 26 ℃ for several days, and the results were observed.
Example 4 application of lanthionine precursor peptide amyA2 in improving antibacterial Activity of metabolites of Bacillus amyloliquefaciens
Bacillus amyloliquefaciens was cultured in NB medium until logarithmic phase, and 0.05mg/L of lanthionine precursor peptide amyA2 was added to the fermentation broth, which was used as experimental group (supernatant 1). The control was the fermentation broth without the addition of the lantibiotic precursor peptide amyA2 (supernatant 2). And collecting the fermentation broth supernatant after the culture is finished. The plate confrontation experiment is carried out by taking Botrytis cinerea, Fusarium sambucinum and Alternaria solani as indicator bacteria. The prepared bacterial suspension is poured into a preheated and melted solid PDA culture medium, mixed evenly and placed on plates, and 30mL of the prepared bacterial suspension is poured into each plate quantitatively. After the plates are solidified, a puncher with the diameter of 8mm is used for punching, two holes are punched on each plate, 100uL of the prepared fermentation broth supernatant 1 (experimental group) is added into one hole, 100uL of the prepared fermentation broth supernatant 2 (control group) is added into the other hole, and finally the plates are placed in a constant-temperature incubator at 26 ℃ for culturing for several days, and the results are observed. The results show that the diameter of the inhibition zone of the experimental group is enlarged by more than 2 times compared with the control group, and the existence time of the inhibition zone can be prolonged by more than 3 times compared with the control group.
EXAMPLES 5-8 results of applications of lanthionine precursor peptide amyA2 at various addition levels
Different addition amounts of the precursor peptides are set, and the operation is carried out according to the embodiment 3, and the influence of the different addition amounts of the precursor peptides on the activity of the bacillus amyloliquefaciens for inhibiting the botrytis cinerea, the fusarium sambucinum and the alternaria solani is observed through experiments.
TABLE 1 Effect of different amounts of precursor peptide on the bacteriostatic activity of Bacillus amyloliquefaciens
The result shows that the addition of the lantibiotic peptide precursor peptide amyA2 can obviously improve the bacteriostatic activity of the bacillus amyloliquefaciens metabolite and prolong the duration of the bacteriostatic effect.
Sequence listing
<110> institute of biological research of academy of sciences of Hebei province
<120> lanthionine precursor peptide amyA2, and preparation method and application thereof
<130> 2019
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 76
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Met Asp Ser Asn Pro Ile Tyr Phe Lys Asn Ser Arg Gly Gly Ile Leu
1 5 10 15
Val Asn Glu Lys Met Tyr Arg Phe Ala Gly Asp Leu Arg Glu Glu Leu
20 25 30
Glu Glu Ile Ser Leu Asn Glu Phe Ser Gly Gly Gly Gly Ala Glu Gln
35 40 45
Arg Gly Ile Ser Gln Gly Asn Asp Gly Lys Leu Cys Thr Leu Thr Trp
50 55 60
Glu Cys Gly Leu Cys Pro Thr His Thr Cys Trp Cys
65 70 75
<210> 2
<211> 231
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atggattcaa atccaatata tttcaaaaac tcaaggggag gaatattagt gaatgagaaa 60
atgtatcgtt ttgccggtga tttaagagaa gaacttgagg aaatttcttt aaatgaattc 120
agcggaggag gaggcgcaga acagcggggg atttctcaag gaaatgatgg taagctttgt 180
acgttaactt gggaatgcgg tctttgccct actcacactt gctggtgtta a 231
<210> 3
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ctttaagaag gagatatacc atggattcaa atccaatata 40
<210> 4
<211> 34
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cctttcgggc tttgttaaca ccagcaagtg tgag 34
Claims (5)
1. A lantibiotic precursor peptide, amyA2, comprising: the amino acid sequence of the lantibiotic precursor peptide amyA2 is shown in SEQ ID NO: 1.
2. The method of claim 1, wherein the preparation of the lantibiotic precursor peptide amyA2 comprises: the lantibiotic precursor peptide amyA2 was obtained by heterologous expression in E.coli or by artificial synthesis.
3. The use of the lantibiotic precursor peptide amyA2 according to claim 1, wherein: application of lantibiotic precursor peptide amyA2 in the process of improving the antibacterial activity of a bacillus amyloliquefaciens metabolite.
4. The use of the lantibiotic precursor peptide amyA2 according to claim 3, wherein: the addition period of the lantibiotic precursor peptide amyA2 was: the fermentation of the bacillus amyloliquefaciens starts to the end of the logarithmic phase of growth.
5. The use of the lantibiotic precursor peptide amyA2 according to claim 3, wherein: the addition amounts of the lantibiotic precursor peptide amyA2 were: 0.001-10mg/L of lanthionine precursor peptide amyA2 is added into the fermentation liquor of bacillus amyloliquefaciens.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910997808.4A CN110669113B (en) | 2019-10-21 | 2019-10-21 | Lanthionine precursor peptide amyA2, and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910997808.4A CN110669113B (en) | 2019-10-21 | 2019-10-21 | Lanthionine precursor peptide amyA2, and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110669113A CN110669113A (en) | 2020-01-10 |
| CN110669113B true CN110669113B (en) | 2022-05-17 |
Family
ID=69082962
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910997808.4A Active CN110669113B (en) | 2019-10-21 | 2019-10-21 | Lanthionine precursor peptide amyA2, and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110669113B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114644688A (en) * | 2020-12-17 | 2022-06-21 | 中国科学院微生物研究所 | Bacillus licheniformis for producing lantibiotic peptide and inhaul cable peptide |
| CN112812157B (en) * | 2021-02-03 | 2022-10-28 | 河北省科学院生物研究所 | Lanthionine AmylocinA3, and preparation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101939328A (en) * | 2007-08-03 | 2011-01-05 | 森蒂内拉制药公司 | Genes and proteins for the biosynthesis of the lantibiotic 107891 |
| CN106366168A (en) * | 2016-08-26 | 2017-02-01 | 上海交通大学 | Wool sulfur peptide antimicrobial peptide and preparation method of dehydrogenation derivative of wool sulfur peptide antimicrobial peptide |
| CN108093637A (en) * | 2015-07-01 | 2018-05-29 | 德诺百迪克斯公司 | Novel bicyclic fat lanthiopeptin, preparation and the purposes as antimicrobial |
-
2019
- 2019-10-21 CN CN201910997808.4A patent/CN110669113B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101939328A (en) * | 2007-08-03 | 2011-01-05 | 森蒂内拉制药公司 | Genes and proteins for the biosynthesis of the lantibiotic 107891 |
| CN108093637A (en) * | 2015-07-01 | 2018-05-29 | 德诺百迪克斯公司 | Novel bicyclic fat lanthiopeptin, preparation and the purposes as antimicrobial |
| CN106366168A (en) * | 2016-08-26 | 2017-02-01 | 上海交通大学 | Wool sulfur peptide antimicrobial peptide and preparation method of dehydrogenation derivative of wool sulfur peptide antimicrobial peptide |
Non-Patent Citations (2)
| Title |
|---|
| Complete genome sequence of Bacillus subtilis BSD-2, a microbial germicide isolated from cultivated cotton;Liu, Hongwei等;《JOURNAL OF BIOTECHNOLOGY》;20160720;第230卷;26-27 * |
| 解淀粉芽胞杆菌WS-8中LanM基因的克隆及生物信息学分析;崔丽婷等;《基因组学与应用生物学》;20190225;第38卷(第2期);644-649 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110669113A (en) | 2020-01-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110194790B (en) | Plant immune activator protein FoPII1 secreted by fusarium oxysporum and application thereof | |
| CN110669113B (en) | Lanthionine precursor peptide amyA2, and preparation method and application thereof | |
| CN111171123B (en) | Plant immune activation protein PsPII1 and application thereof | |
| CN110922457B (en) | Plant immune induced resistance protein FgPII1 secreted by fusarium graminearum and application thereof | |
| CN111690054B (en) | Pinctada martensii Kunitz type serine protease inhibitor gene, encoded protein and application | |
| CN110669114B (en) | Lanthionine precursor peptide amyA6, and preparation method and application thereof | |
| CN113215058B (en) | Strain capable of degrading collagen and application thereof | |
| CN108486085B (en) | Yersinia pseudotuberculosis antifungal protein and coding gene and application thereof | |
| CN112028981B (en) | Recombinant white high-foot spider toxin polypeptide and preparation method thereof | |
| CN112852794B (en) | Clostridium perfringens bacteriophage lyase and application thereof | |
| KR101144987B1 (en) | Nematocide Compound containing amino acids extracted by using chicken feather-degrading bacterium Chryseobacterium sp. FBF-7 | |
| CN110699288B (en) | Bacillus amyloliquefaciens strain for preventing and treating potato black nevus, microbial inoculum and application | |
| CN110684087B (en) | Lanthionine precursor peptide amyA16, and preparation method and application thereof | |
| CN109305996A (en) | Fusarium graminearum secreted protein exciton FgHrip1 and its application | |
| CN114317317B (en) | Bacillus belicus strain capable of resisting salt and producing lipopeptid at high yield and application thereof | |
| CN101942473A (en) | Procambrus clarkii type i lysozyme gene, lysozyme coded by lysozyme gene and application of lysozyme | |
| CN116004665A (en) | Mutant insecticidal gene Cry1Ah-1 and application thereof | |
| CN113150087B (en) | Plant immune activator protein Fg62 secreted by fusarium graminearum and application thereof | |
| CN115725551A (en) | Application of MmBBK2 in preparation of trypsin and chymotrypsin inhibitors | |
| CN108359673A (en) | A kind of Bt cry11 genes, coding albumen and its application efficiently killing edible mushroom eye fungus gnat | |
| CN102703355B (en) | Staphylococcus sp. LZ16 strain and application thereof | |
| CN109251936B (en) | Smooth turtle shell serine protease inhibitor fusion protein and preparation and application thereof | |
| CN111139207A (en) | Brevibacillus brevis gene recombinant strain and preparation method and application thereof | |
| CN109706136A (en) | Lyases and its preparation method and application as PCR preservative | |
| CN109234253B (en) | Mhp non-specific nuclease, coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |