CN110643555B - Genetically engineered bacterium, construction method thereof and application thereof in production of nylon 12 monomer 12-aminolauric acid - Google Patents

Genetically engineered bacterium, construction method thereof and application thereof in production of nylon 12 monomer 12-aminolauric acid Download PDF

Info

Publication number
CN110643555B
CN110643555B CN201910749344.5A CN201910749344A CN110643555B CN 110643555 B CN110643555 B CN 110643555B CN 201910749344 A CN201910749344 A CN 201910749344A CN 110643555 B CN110643555 B CN 110643555B
Authority
CN
China
Prior art keywords
ala
gly
val
leu
glu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910749344.5A
Other languages
Chinese (zh)
Other versions
CN110643555A (en
Inventor
叶丽丹
于洪巍
葛佳炜
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University ZJU
Original Assignee
Zhejiang University ZJU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University ZJU filed Critical Zhejiang University ZJU
Priority to CN201910749344.5A priority Critical patent/CN110643555B/en
Publication of CN110643555A publication Critical patent/CN110643555A/en
Application granted granted Critical
Publication of CN110643555B publication Critical patent/CN110643555B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0077—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with a reduced iron-sulfur protein as one donor (1.14.15)
    • C12N9/0079—Steroid 11 beta monooxygenase (P-450 protein)(1.14.15.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
    • C12N9/0016—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with NAD or NADP as acceptor (1.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1096—Transferases (2.) transferring nitrogenous groups (2.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/001—Amines; Imines
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/99—Oxidoreductases acting on the CH-OH group of donors (1.1) with other acceptors (1.1.99)
    • C12Y101/9901—Glucose dehydrogenase (acceptor) (1.1.99.10)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/15—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with reduced iron-sulfur protein as one donor, and incorporation of one atom of oxygen (1.14.15)
    • C12Y114/15004—Steroid 11-beta-monooxygenase (1.14.15.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y206/00—Transferases transferring nitrogenous groups (2.6)
    • C12Y206/01—Transaminases (2.6.1)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a genetic engineering bacterium, a construction method thereof and application thereof in producing nylon 12 monomer 12-aminolauric acid, wherein the name of the genetic engineering bacterium is as follows: escherichia coli BL21(DE 3): P1-1-CGCAB with the preservation number of CCTCC NO: m2019571; the construction method comprises the following steps: firstly, constructing a plasmid containing a recombinant expression vector A and a recombinant expression vector B; secondly, knocking out a beta-oxidation pathway key enzyme FadD of the host bacteria; thirdly, constructing a recombinant strain; the problems of excessive oxidation of intermediate products of the strains and competitive loss of substrates are solved by a genetic engineering method, the synthesis efficiency of the strains on target products is improved, and the self-sufficiency of intracellular coenzyme and auxiliary substrates can be realized; finally, the genetic engineering bacteria have the capability of efficiently converting lauric acid to produce nylon 12 monomer.

Description

Genetically engineered bacterium, construction method thereof and application thereof in production of nylon 12 monomer 12-aminolauric acid
Technical Field
The invention relates to the field of genetic engineering and strain culture, in particular to a genetic engineering bacterium, a construction method thereof and application thereof in producing nylon 12 monomer 12-aminolauric acid.
Background
The nylon 12 has the advantages of small density, high decomposition temperature, excellent low temperature resistance, good noise-proof effect and the like, and is widely applied. Nylon 12 can be obtained by polymerizing omega-aminolauric acid or omega-laurolactam monomers, and the industrial production of the nylon 12 is mainly to synthesize omega-laurolactam by a chemical method and then carry out ring-opening polymerization. The synthesis of the omega-laurolactam by using butadiene as a raw material needs a plurality of steps of trimerization, catalytic hydrogenation, oxidation, ketonization, oximation, Beckmann rearrangement and the like, and has the problems of long flow, high process requirement, difficult product extraction, low yield and the like. In addition, since butadiene is derived from petroleum C4 fraction, its supply is greatly influenced by fluctuations in petroleum markets, and toxic and corrosive raw materials such as benzene and fuming sulfuric acid are used in the synthesis process, and a large amount of waste is generated, causing a great pressure on the environment. In recent years, in order to partially fill the domestic blank of long carbon chain nylon production, researchers in China developed a fermentation method for producing dodecanedioic acid for synthesizing nylon 1212 (liu folk english, etc., 2002), but the reaction is based on the polymerization of diacyl and diamine, three chemical synthesis steps are needed besides the fermentation process to obtain the monomers, and the fermentation raw material is n-dodecane in petroleum, and the supply of the n-dodecane is also influenced by the petroleum market. Considering the non-renewable nature of petroleum feedstocks and the complexity of the petroleum market, it would be of great interest if synthetic biological methods could be developed to synthesize long carbon chain nylon monomers from renewable feedstocks. Regarding the biosynthesis of nylon 12 monomer, only research papers published in the buhler topic group of the german multi-tesmonte industrial university and the Yun topic group of the korean national institute university were published in 2 months in 2013, 7 months in 2016 and 4 months in 2018, respectively. The Buhler topic group firstly expresses alkane monooxygenase AlkBGT and omega-transaminase CV2025 in Escherichia coli, preliminarily realizes the biosynthesis of 12-aminolauric acid methyl ester (Schrewe et al, 2013), then further expresses alcohol dehydrogenase AlkJ, outer membrane protein AlkL and alanine dehydrogenase AlaDH2 derived from Bacillus subtilis, optimizes the biosynthesis pathway of 12-aminolauric acid methyl ester, and finally realizes the 12-aminolauric acid methyl ester yield synthesized by catalyzing 3.2mM methyl laurate through whole cells (Ladka et al, 2016). Recent studies in Yun project group split the biosynthetic pathway of 12-aminolauric acid into two parts, and expressed P450 enzyme (CYP 153A derived from Mycobacterium scrofulaceum) and CamA and CamB responsible for electron transfer, as well as alcohol dehydrogenase AlkJ and ω -transaminase mll1207 ω -TA in Escherichia coli, and finally catalyzed 2mM lauric acid by two recombinant cells in one pot, resulting in a yield of 30% of synthesized 12-aminolauric acid (Ahsan et al, 2018). In the research of the above two groups, the problems of the intermediate product 12-carbonyl lauric acid (methyl ester) being over-oxidized to generate dodecanedioic acid as a byproduct and the problem of the imbalance of intracellular cofactors caused by the introduction of artificial routes are not solved, and the key problems can cause adverse effects on the synthesis efficiency and the separation and purification of the target product. The invention solves the problems, combines metabolic engineering and enzyme engineering means, successfully constructs a 12-aminolauric acid biosynthesis pathway and carries out preliminary optimization.
Disclosure of Invention
In order to solve the defects of the prior art, the invention aims to provide a genetic engineering bacterium and a construction method thereof and application thereof in producing nylon 12 monomer 12-aminolauric acid, solves the problems of over-oxidation of intermediate products of strains and competitive loss of substrates by the genetic engineering method, improves the synthesis efficiency of the strains on target products, and can realize self-sufficiency of intracellular coenzyme and auxiliary substrates; finally, the genetic engineering bacteria have the capability of efficiently converting lauric acid to produce nylon 12 monomer.
In order to achieve the above object, the present invention adopts the following technical solutions:
a genetically engineered bacterium is named as a new strain: escherichia coli BL21(DE 3): P1-1-CGCAB with the preservation number of CCTCC NO: m2019571.
A construction method of a genetic engineering bacterium comprises the following steps: firstly, constructing a recombinant plasmid, wherein the vector plasmid comprises: pETDuet series, pACYCDuet series, pRSFDuet series, pCDFDuet series plasmids;
the recombinant plasmid comprises: a vector plasmid of a chimeric P450 enzyme CYP153A-NCP gene; chimeric BsADHC257LVector plasmids for the gene and the Cv2025 gene; the recombinant plasmid A is a vector plasmid containing a chimeric P450 enzyme CYP153A-NCP gene and a glucose dehydrogenase GDH1 gene; the recombinant plasmid B is a BsADH containing alcohol dehydrogenase mutantC257LA vector plasmid of the gene, omega-transaminase Cv-2025 gene and L-alanine dehydrogenase AlaDH2 gene; secondly, constructing a recombinant strain, introducing the recombinant plasmid into host escherichia coli BL21(DE3) to obtain the recombinant strain, and storing.
A base as described aboveThe construction method of the engineering bacteria comprises the following steps: constructing a recombinant plasmid; the sequence of CYP153A was obtained from the genome of M.aquaeolei (DSM 11845) by PCR using designed primers, and the NCP of P450 BM3 oxidoreductase domain was obtained from the genome of B.megaterium (KCCM 11745) by PCR using designed primers; CYP153A and NCP are fused into CYP153A-NCP by utilizing overlap extension PCR, and the CYP153A-NCP is connected into an expression vector pETDuet-1 to construct a plasmid pET-T7-CYP 153A-NCP; the Cv2025 sequence was obtained from the genome of Chromobacterium violacea (DSM 30191) by PCR using designed primers and ligated into vector pCD-T7-BsADHC257LAnd constructing a recombinant plasmid: pCD-T7-Cv2025-T7-BsADHC257L(ii) a Secondly, constructing a recombinant strain, and mixing the plasmid pET-T7-CYP153A-NCP and pCD-T7-Cv2025-T7-BsADHC257LColi BL21(DE3) was introduced to obtain a recombinant strain:
BL-CCB:BL21(DE3)(pET-T7-CYP153A-NCP+pCD-T7-Cv2025-T7-BsADHC257L) And preserving in the form of glycerol bacteria or freeze-dried bacteria.
The construction method of the genetic engineering bacteria comprises the following steps: firstly, constructing a recombinant plasmid, obtaining a CYP153A sequence from the genome of M.aquaeolei (DSM 11845) by utilizing designed primer PCR, and obtaining P450 BM3 oxidoreductase domain NCP from the genome of B.megaterium (KCCM 11745) by utilizing designed primer PCR; CYP153A and NCP are fused into CYP153A-NCP by utilizing overlap extension PCR, and the CYP153A-NCP is connected into an expression vector pETDuet-1 to construct a plasmid pET-T7-CYP 153A-NCP; the Cv2025 sequence was obtained from the genome of Chromobacterium violacea (DSM 30191) by PCR using a designed primer and ligated into the vector pCD-T7-BsADHC257LThe recombinant plasmid pCD-T7-Cv2025-T7-BsADH is constructedC257L(ii) a The sequence AlaDH2 obtained from the genome of Bacillus subtilis str.168 by PCR using designed primers was ligated into the vector pCD-T7-Cv2025-T7-BsADHC257LThe recombinant plasmid B is constructed as pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257L(ii) a Secondly, constructing a recombinant strain, namely mixing the plasmid pET-T7-CYP153A-NCP and the recombinant plasmid B pCD-T7-Cv2025-RBS-AlaDH 2-T7-BsAADHC257LColi BL21(DE3) was introduced to obtain a recombinant strain BL-CCAB: BL21(DE3) (pET-T7-CYP153A-NCP + pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257L) And preserving in the form of glycerol bacteria or freeze-dried bacteria.
A construction method of a genetic engineering bacterium comprises the following steps: firstly, constructing a recombinant plasmid, wherein the vector plasmid comprises: pETDuet series, pACYCDuet series, pRSFDuet series, pCDFDuet series plasmids; the recombinant plasmid comprises: a vector plasmid of a chimeric P450 enzyme CYP153A-NCP gene; chimeric BsADHC257LA vector plasmid for the gene; chimeric BsADHC257LVector plasmids for the gene and the Cv2025 gene; the recombinant plasmid A is a vector plasmid containing a chimeric P450 enzyme CYP153A-NCP gene and a glucose dehydrogenase GDH1 gene; the recombinant plasmid B is a BsADH containing alcohol dehydrogenase mutantC257LA vector plasmid of the gene, omega-transaminase Cv-2025 gene and L-alanine dehydrogenase AlaDH2 gene; secondly, the genetic background of a host escherichia coli BL21(DE3) is modified, and the modified host bacteria comprise: transforming a host B-delta D, transforming a host B1-1 and transforming a host P1-1; knocking out a beta-oxidation pathway key enzyme FadD of host escherichia coli BL21(DE3) by using a CRISPR/Cas9 technology to obtain a modified host B-delta D; knocking in an AlkL gene with a LacUV5 promoter at an original FadD position of an escherichia coli B-delta D genome by using a CRISPR/Cas9 technology to obtain a modified host B1-1; the yaaDE gene with a T7 promoter is knocked into the original FadD position of the Escherichia coli B1-1 genome by using a CRISPR/Cas9 technology to obtain a modified host P1-1; thirdly, constructing a recombinant strain, introducing the recombinant plasmid into the transformed host bacterium to obtain the recombinant strain, and storing.
The construction method of the genetic engineering bacteria comprises the following steps: firstly, constructing a recombinant plasmid, obtaining a CYP153A sequence from the genome of M.aquaeolei (DSM 11845) by utilizing designed primer PCR, and obtaining P450 BM3 oxidoreductase domain NCP from the genome of B.megaterium (KCCM 11745) by utilizing designed primer PCR; CYP153A and NCP are fused into CYP153A-NCP by utilizing overlap extension PCR, and the CYP153A-NCP is connected into an expression vector pETDuet-1 to construct a plasmid pET-T7-CYP 153A-NCP; the Cv2025 sequence was obtained from the genome of Chromobacterium violacea (DSM 30191) by PCR using a designed primer and ligated into the vector pCD-T7-BsADHC257LThe recombinant plasmid pCD-T7-Cv2025-T7-BsADH is constructedC257L(ii) a From the genome of Bacillus subtilis str.168The sequence AlaDH2 obtained by using the designed primer PCR was ligated into the vector pCD-T7-Cv2025-T7-BsADHC257LThe recombinant plasmid B is constructed as pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257L(ii) a Secondly, modifying the gene background of host escherichia coli BL21(DE3), knocking out a beta-oxidation pathway key enzyme FadD of host escherichia coli BL21(DE3) by using a CRISPR/Cas9 technology, and obtaining a modified host B-delta D; thirdly, constructing a recombinant strain, and mixing the plasmid pET-T7-CYP153A-NCP and the recombinant plasmid B pCD-T7-Cv2025-RBS-AlaDH 2-T7-BsAADHC257LAnd introducing escherichia coli B-delta D to obtain a recombinant bacterium B-delta D-CCAB: BL21(DE3) Δ fadD (pET-T7-CYP153A-NCP + pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257L) And preserving in the form of glycerol bacteria or freeze-dried bacteria.
The construction method of the genetic engineering bacteria comprises the following steps: firstly, constructing a recombinant plasmid, obtaining a CYP153A sequence from the genome of M.aquaeolei (DSM 11845) by utilizing designed primer PCR, and obtaining P450 BM3 oxidoreductase domain NCP from the genome of B.megaterium (KCCM 11745) by utilizing designed primer PCR; CYP153A and NCP are fused into CYP153A-NCP by utilizing overlap extension PCR, and the CYP153A-NCP is connected into an expression vector pETDuet-1 to construct a plasmid pET-T7-CYP 153A-NCP; the Cv2025 sequence was obtained from the genome of Chromobacterium violacea (DSM 30191) by PCR using a designed primer and ligated into the vector pCD-T7-BsADHC257LThe recombinant plasmid pCD-T7-Cv2025-T7-BsADH is constructedC257L(ii) a The sequence AlaDH2 obtained from the genome of Bacillus subtilis str.168 by PCR using designed primers was ligated into the vector pCD-T7-Cv2025-T7-BsADHC257LThe recombinant plasmid B is constructed as pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257L(ii) a Secondly, the genetic background of host escherichia coli BL21(DE3) is modified, and the beta-oxidation pathway key enzyme FadD of host escherichia coli BL21(DE3) is knocked out by using the CRISPR/Cas9 technology to obtain a modified host B-delta D. Introducing outer membrane protein alkL in a pseudomonas putida alkane degradation operon, knocking in an alkL gene with a LacUV5 promoter at an original FadD position of an escherichia coli B-delta D genome by using a CRISPR/Cas9 technology, and obtaining a modified host B1-1; thirdly, constructing a recombinant strain, and mixing the plasmid pET-T7-CYP153A-NCP and the recombinant plasmid B pCD-T7-Cv2025-RBS-AlaDH 2-T7-BsAADHC257LIntroducing Escherichia coli B1-1 to obtain recombinant bacteria B1-1-CCAB: BL21(DE3) Δ fadD:: PLacUV5-alkL(pET-T7-CYP153A-NCP+pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257L) And preserving in the form of glycerol bacteria or freeze-dried bacteria.
The construction method of the genetic engineering bacteria comprises the following steps: firstly, constructing a recombinant expression vector A and a recombinant expression vector B, obtaining a CYP153A sequence from a genome of M.aquaeolei (DSM 11845) by using designed primer PCR, and obtaining a P450 BM3 oxidoreductase domain NCP from a genome of B.megaterium (KCCM 11745) by using designed primer PCR; CYP153A and NCP are fused into CYP153A-NCP by utilizing overlap extension PCR, and the CYP153A-NCP is connected into an expression vector pETDuet-1 to construct a plasmid pET-T7-CYP 153A-NCP; taking the constructed plasmid pET-T7-CYP153A-NCP as a template, and obtaining a CYP153A-NCP-RBS sequence by utilizing a designed primer PCR; using plasmid pET30a-GDH1 as a template, and obtaining a GDH1-RBS sequence by utilizing designed primer PCR; the CYP153A-NCP-RBS sequence and the GDH1-RBS sequence are fused by utilizing overlap extension PCR and are connected into an expression vector pETDuet-1 to construct a recombinant plasmid A, namely pET-T7-CYP153A-NCP-RBS-GDH 1; the Cv2025 sequence was obtained from the genome of Chromobacterium violacea (DSM 30191) by PCR using a designed primer and ligated into the vector pCD-T7-BsADHC257LThe recombinant plasmid pCD-T7-Cv2025-T7-BsADH is constructedC257L(ii) a The sequence AlaDH2 obtained from the genome of Bacillus subtilis str.168 by PCR using designed primers was ligated into the vector pCD-T7-Cv2025-T7-BsADHC257LThe recombinant plasmid B is constructed as pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257L(ii) a Secondly, modifying the gene background of host escherichia coli BL21(DE3), knocking out a beta-oxidation pathway key enzyme FadD of host escherichia coli BL21(DE3) by using a CRISPR/Cas9 technology, and obtaining a modified host B-delta D; introducing outer membrane protein alkL in a pseudomonas putida alkane degradation operon, knocking in an alkL gene with a LacUV5 promoter at an original FadD position of an escherichia coli B-delta D genome by using a CRISPR/Cas9 technology, and obtaining a modified host B1-1; thirdly, constructing a recombinant strain, namely, plasmid A, namely pET-T7-CYP153A-NCP-RBS-GDH1 and recombinant plasmid B, namely pCD-T7-Cv2025-RBS-AlaDH 2-T7-BsAADHC257LIntroducing Escherichia coli B1-1 to obtain a recombinant strain B1-1-CGCAB: BL21(DE3) Δ fadD:: PLacUV5-alkL(pET-T7-CYP153A-NCP-RBS-GDH1+pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257L) And preserving in the form of glycerol bacteria or freeze-dried bacteria.
The construction method of the genetic engineering bacteria comprises the following steps: firstly, constructing a recombinant expression vector A and a recombinant expression vector B, obtaining a CYP153A sequence from a genome of M.aquaeolei (DSM 11845) by using designed primer PCR, and obtaining a P450 BM3 oxidoreductase domain NCP from a genome of B.megaterium (KCCM 11745) by using designed primer PCR; CYP153A and NCP are fused into CYP153A-NCP by utilizing overlap extension PCR, and the CYP153A-NCP is connected into an expression vector pETDuet-1 to construct a plasmid pET-T7-CYP 153A-NCP; taking the constructed plasmid pET-T7-CYP153A-NCP as a template, and obtaining a CYP153A-NCP-RBS sequence by utilizing a designed primer PCR; using plasmid pET30a-GDH1 as a template, and obtaining a GDH1-RBS sequence by utilizing designed primer PCR; the CYP153A-NCP-RBS sequence and the GDH1-RBS sequence are fused by utilizing overlap extension PCR and are connected into an expression vector pETDuet-1 to construct a recombinant plasmid A, namely pET-T7-CYP153A-NCP-RBS-GDH 1; the Cv2025 sequence was obtained from the genome of Chromobacterium violacea (DSM 30191) by PCR using a designed primer and ligated into the vector pCD-T7-BsADHC257LThe recombinant plasmid pCD-T7-Cv2025-T7-BsADH is constructedC257L(ii) a The sequence AlaDH2 obtained from the genome of Bacillus subtilis str.168 by PCR using designed primers was ligated into the vector pCD-T7-Cv2025-T7-BsADHC257LThe recombinant plasmid B is constructed as pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257L(ii) a Secondly, modifying the gene background of host escherichia coli BL21(DE3), knocking out a beta-oxidation pathway key enzyme FadD of host escherichia coli BL21(DE3) by using a CRISPR/Cas9 technology, and obtaining a modified host B-delta D; introducing outer membrane protein alkL in a pseudomonas putida alkane degradation operon, knocking in an alkL gene with a LacUV5 promoter at an original FadD position of an escherichia coli B-delta D genome by using a CRISPR/Cas9 technology, and obtaining a modified host B1-1; introducing pyridoxal phosphate synthesis pathway genes yaaD and yaaE, knocking in a yaaDE gene with a T7 promoter at the original FadD position of an escherichia coli B1-1 genome by using a CRISPR/Cas9 technology, and obtaining a modified host P1-1; thirdly, constructing a recombinant strain, namely, mixing the plasmid A pET-T7-CYP153A-NCP-RBS-GDH1 and the recombinant plasmid B pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257LIntroducing escherichia coli P1-1 to obtain a recombinant bacterium P1-1-CGCAB: BL21(DE3) Δ fadD:: PLacUV5-alkL-PT7-yaaDE(pET-T7-CYP153A-NCP-RBS-GDH1+pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257L) And preserving in the form of glycerol bacteria or freeze-dried bacteria.
An application of a genetic engineering bacterium in producing nylon 12 monomer 12-aminolauric acid, wherein the name of a new strain is as follows: escherichia coli BL21(DE 3): P1-1-CGCAB with the preservation number of CCTCC NO: m2019571; the process for producing 12-aminolauric acid by converting lauric acid through the recombinant strain P1-1-CGCAB is as follows: inoculating the recombinant strain P1-1-CGCAB to a TB culture medium at 22-26 ℃, inducing by using an inducer, adding an accelerant and a nutritional additive during induction, and harvesting after inducing for 11-14 hours; preparing bacterial mud by using a reaction buffer solution with the pH value of 7.0-8.5, adding lauric acid, reacting at 25-35 ℃, adding acetonitrile after 8 hours of reaction, centrifuging and taking supernatant to obtain 12-aminolauric acid.
The invention has the advantages that: the problem of excessive oxidation of intermediate products is well solved by selectively introducing P450 monooxygenase fusion protein CYP153A-NCP and alcohol dehydrogenase mutant BsAdC 257L which have no detected excessive oxidation problem; aiming at the problem of competitive loss of a substrate, metabolic modification is carried out on the underpan cells, and a beta-oxidation path is blocked by knocking out FadD; in order to improve the transmembrane transport efficiency of the substrate, a heterologous outer membrane transporter AlkL is expressed, and the uptake of a hydrophobic substrate by a cell is increased; aiming at the problem of the unbalance of cofactors among the reaction steps, coenzyme circulation and cosubstrate circulation are elaborately designed through screening and matching of enzyme libraries, and NADP is coexpressed+Glucose dehydrogenase GDH1 with NAD+The dependence of L-alanine dehydrogenase AlaDH2 realizes the intracellular self-compensation of cofactor NADPH, NADH and co-substrate L-alanine; the self-sufficiency of intracellular coenzyme PLP is realized by inserting and expressing a coenzyme pyridoxal phosphate PLP synthesis gene yaaDE required by transaminase into the genome of the genetic engineering bacteria. When the concentration of substrate lauric acid is 5.0mM, the 8-hour yield of the catalytic synthesis of 12-aminolauric acid (ADA) by the recombinant strain P1-1-CGCAB reaches over 95.6%.
Drawings
FIG. 1 is a flow chart of one embodiment of a construction method of the present invention; FIG. 2 is a liquid phase diagram of synthesis of 12-aminolauric acid (ADA) from 2.5mM lauric acid catalyzed by crude enzyme liquid of recombinant strain BL-CCB cell disruption, wherein arrows indicate that a 12-aminolauric acid standard product generates a peak, a synthesis pathway enzyme catalysis reaction product generates a peak, and a comparison generates a peak; in FIG. 3, a is the peak of the over-oxidized dodecanedioic acid (DDA) standard (retention time 12.893 min); b is a phase diagram of synthesizing 12-aminolauric acid solution by catalyzing 2.5mM lauric acid by using a crude enzyme solution of a bacterial strain BL-CCB cell breaking, ADA is a product 12-aminolauric acid peak (the retention time is 10.344min), and HAD is an intermediate product 12-hydroxylauric acid peak (the retention time is 13.954 min); FIG. 4 is a graph showing the concentration change of the recombinant strain BL-CCB with alanine as an amino donor to catalyze the biosynthesis of 12-aminolauric acid with 2.5mM of lauric acid, along with the synthesis time, wherein ADA is 12-aminolauric acid and HDA is 12-hydroxylauric acid; FIG. 5 is a schematic diagram showing the concentration change with the synthesis time of the biosynthesis of 12-aminolauric acid by catalyzing 2.5mM lauric acid with inorganic ammonium as an amino donor after the recombination strain BL-CCAB completes the cycle modification of the cosubstrate alanine and the cycle modification of coenzyme NADH, wherein ADA is 12-aminolauric acid, and HDA is 12-hydroxylauric acid; FIG. 6 is a graph showing the concentration change with synthesis time of biosynthesis of 12-aminolauric acid using inorganic ammonium as an amino donor to catalyze 2.5mM lauric acid after beta-oxidation pathway is blocked by recombinant strain B- Δ D-CCAB, wherein ADA is 12-aminolauric acid and HDA is 12-hydroxylauric acid; FIG. 7 is a graph showing the concentration change with time of synthesis of 12-aminolauric acid in the case of the recombinant strain B1-1-CCAB knocked in alkL, wherein ADA is 12-aminolauric acid and HDA is 12-hydroxylauric acid, using inorganic ammonium as an amino donor to catalyze the biosynthesis of 12-aminolauric acid; FIG. 8 is a graph showing the concentration change with synthesis time of recombinant strain B1-1-CCAB catalyzing the biosynthesis of 12-aminolauric acid using inorganic ammonium as an amino donor to catalyze 5.0mM lauric acid, wherein ADA is 12-aminolauric acid and HDA is 12-hydroxylauric acid; FIG. 9 is a graph showing the concentration change with synthesis time of recombinant strain B1-1-CGCAB catalyzing the biosynthesis of 12-aminolauric acid using inorganic ammonium as an amino donor to catalyze 5.0mM of lauric acid, wherein ADA is 12-aminolauric acid and HDA is 12-hydroxylauric acid; FIG. 10 is a graph showing the concentration change with synthesis time of the recombinant strain P1-1-CGCAB catalyzing the biosynthesis of 12-aminolauric acid using inorganic ammonium as an amino donor and 5.0mM lauric acid, wherein ADA is 12-aminolauric acid and HDA is 12-hydroxylauric acid; FIG. 11 is a schematic diagram of the production of 12-aminolauric acid (ADA) by multi-enzyme cascade catalysis of a self-sufficient recombinant bacterium with cofactors and cosubstrates using lauric acid (DA) as a substrate.
Detailed Description
The invention is described in detail below with reference to the figures and the embodiments. A genetically engineered bacterium is named as a new strain: escherichia coli BL21(DE 3): P1-1-CGCAB with the preservation number of CCTCC NO: m2019571; the preservation organization is as follows: china Center for Type Culture Collection (CCTCC); the preservation place is Wuhan in China; the preservation date is as follows: 7/19/2019. The construction method of the genetic engineering bacteria shown in FIG. 1 comprises the following steps: firstly, constructing a recombinant plasmid, wherein the vector plasmid comprises: pETDuet series, pACYCDuet series, pRSFDuet series, pCDFDuet series plasmids; the recombinant plasmid comprises: a vector plasmid of a chimeric P450 enzyme CYP153A-NCP gene; chimeric BsADHC257LVector plasmids for the gene and the Cv2025 gene; the recombinant plasmid A is a vector plasmid containing a chimeric P450 enzyme CYP153A-NCP gene and a glucose dehydrogenase GDH1 gene; the recombinant plasmid B is a BsADH containing alcohol dehydrogenase mutantC257LA vector plasmid of the gene, omega-transaminase Cv-2025 gene and L-alanine dehydrogenase AlaDH2 gene; the amino acid sequence of the expressed CYP153A-NCP is the amino acid sequence shown in SEQ ID NO. 8 or a mutant thereof; SEQ ID NO 8. The amino acid sequence of the expression glucose dehydrogenase GDH1 is SEQ ID NO: 13 or a mutant thereof, SEQ ID NO: 13. expression of alcohol dehydrogenase mutant BsADHC257LThe amino acid sequence of (a) is SEQ ID NO: 9 or a mutant thereof, SEQ ID NO: 9. the amino acid sequence of the expression omega-transaminase Cv-2025 is SEQ ID NO: 10 or a mutant thereof, SEQ ID NO: 10. the amino acid sequence of the expression L-alanine dehydrogenase AlaDH2 is SEQ ID NO: 11 or a mutant thereof; SEQ ID NO: 11. secondly, the gene background of the host escherichia coli BL21(DE3) is modifiedThe manufactured host bacteria comprise: transforming a host B-delta D, transforming a host B1-1 and transforming a host P1-1; knocking out a beta-oxidation pathway key enzyme FadD of host escherichia coli BL21(DE3) by using a CRISPR/Cas9 technology to obtain a modified host B-delta D; knocking in an AlkL gene with a LacUV5 promoter at an original FadD position of an escherichia coli B-delta D genome by using a CRISPR/Cas9 technology to obtain a modified host B1-1; the yaaDE gene with a T7 promoter is knocked into the original FadD position of the Escherichia coli B1-1 genome by using a CRISPR/Cas9 technology to obtain a modified host P1-1; it should be noted that: the host bacteria comprise: BL21(DE3) series, JM101 series, JM109 series; in addition to BL21(DE3), other series may be used without limitation. After knocking out the host bacterium's beta-oxidation pathway key enzyme FadD, the outer membrane protein alkL from Pseudomonas putida alkane degradation operon with LacUV5 promoter is knocked in the original FadD position. This can improve the lauric acid uptake ability of Escherichia coli. The amino acid sequence of the outer membrane protein AlkL is expressed as SEQ ID NO: 12 or a mutant thereof; SEQ ID NO: 12. a pyridoxal phosphate (PLP) synthetic gene yaaDE with a T7 promoter is knocked in at the position of FadD, which is a key enzyme FadD of the beta-oxidation pathway of a host bacterium. It should be noted that: the origin of the pyridoxal phosphate (PLP) synthesis gene yaaDE dependent on the ribose-5-phosphate pathway is not particularly limited, but a gene derived from a prokaryote such as Bacillus spp, for example, is preferably used. The amino acid sequence of the expression pyridoxal phosphate (PLP) synthetic gene yaaD is SEQ ID NO: 14 or a mutant thereof; SEQ ID NO: 14. the amino acid sequence of the expression pyridoxal phosphate (PLP) synthetic gene yaaE is SEQ ID NO: 15 or a mutant thereof, SEQ ID NO: 15. thirdly, constructing a recombinant strain, introducing the recombinant plasmid into host bacteria to obtain the recombinant strain, and storing. Preparing 12-aminolauric acid according to the reaction liquid of the recombinant strain whole cell catalytic lauric acid, which comprises the following steps: inoculating the genetically engineered bacteria to a TB culture medium, inducing by using IPTG (isopropyl thiogalactoside) with the final concentration of 0.05-0.15mM at the temperature of 22-26 ℃, adding 5-aminolevulinic acid, vitamin B1 and trace metal elements during induction, and collecting the bacteria after induction for 11-14 hours. Slowing the reaction of the bacterial mud with pH of 7.0-8.5Making the flushing liquid into a certain bacterial concentration, adding 2.0-5.0mM of lauric acid, and reacting at 25-35 ℃. After 8 hours of reaction, the same volume of acetonitrile is added, and the supernatant is centrifuged to obtain 12-aminolauric acid. IPTG is used as an inducer, 5-aminolevulinic acid is used as an accelerant, and vitamin B1 and trace metal elements are used as nutritional additives. The following specific examples demonstrate the construction of a 12-aminolauric acid-producing strain: a) constructing a recombinant plasmid; the genome of M.aquaeolei (DSM 11845) was purified using design primers (forward primer: CYP 153A-XbaI-F:
CCTCTAGAAATAATTTTGTTTAACTTTAACAGGAGGAACGGCATGCCGACTTTACCGCGTAC, respectively; downstream primer CYP 153A-R:
GCTGCCGCCGCTGCCGCCGCTGCCGCCGCTATTCGGGGTCAGTTTCACC) PCR to obtain CYP153A sequence, PCR was performed from the genome of b.megaterium (KCCM 11745) using a designed primer (upstream primer: NCP-F: (ii) a Downstream primer NCP-XhoI-R: ) PCR to obtain P450 BM3 oxidoreductase domain NCP. CYP153A and NCP are fused into CYP153A-NCP by overlap extension PCR, and the CYP153A-NCP is connected into an expression vector pETDuet-1 to construct a plasmid pET-T7-CYP 153A-NCP. CYP153A-NCP nucleotide sequence is shown in SEQ ID NO: 1. The constructed plasmid pET-T7-CYP153A-NCP was used as a template, and a design primer (upstream primer: CYP 153A-XbaI-F:
CCTCTAGAAATAATTTTGTTTAACTTTAACAGGAGGAACGGCATGCCGACTTTACCGCGTAC, respectively; downstream primer NCP-RBS-R:
TATATATCTCCTTAGAATTCTTACCCAGCCCACACGTCTTTTG) PCR to obtain CYP153A-NCP-RBS sequence. The GDH1-RBS sequence was obtained by PCR using the original laboratory plasmid pET30a-GDH1 as a template and the designed primers (upstream primer: GDH 1-RBS-F: GAATTCTAAGGAGATATATAATGGGTTACAGCGATCTGGAAGG; downstream primer: GDH 1-XhoI-R: ACTGCTCGAGTTAACCACGACCGGCCTGGAAG). The CYP153A-NCP-RBS sequence was fused with the GDH1-RBS sequence by overlap extension PCR and ligated into the expression vector pETDuet-1 to construct the recombinant plasmid A pET-T7-CYP153A-NCP-RBS-GDH 1. GDH1 has a nucleotide sequence shown as SEQ ID NO 6. BsADH was obtained from NCBIC257L(GenBank: KR611715.1) sequence information, the nucleotide sequence is shown as SEQ ID NO: 2. The plasmid pET30a-BsADH was obtained after synthesis by Anhui general-purpose companyC257LUsing this as a template, a designed primer (upstream primer: BS-KpnI-F: CGTCGGTACCATGGCAA)GCTGGAGCCATCCG, respectively; downstream primer BS-XhoI-R:
CAGACTCGAGTTATTTATCTTCCAGGGTCAG) PCR to obtain BsADHC257LThe sequence of (1), the recombinant plasmid pCD-T7-BsADH-1 constructed by ligating it into the vector pCDFDuet-1C257L. The sequence of Cv2025 was obtained by PCR from the genome of Chromobacterium violaceum (DSM 30191) using the designed primer (forward primer: BS-C257L-F:; reverse primer: BS-C257L-R:) and ligated to vector pCD-T7-BsADHC257LThe recombinant plasmid pCD-T7-Cv2025-T7-BsADH is constructedC257L. Cv2025 nucleotide sequence is shown as SEQ ID NO 3. The genome of Bacillus subtilis str.168 was purified using a designed primer (upstream primer: AlaDH 2-EcoRI-RBS-F: GCCAGGATCCGATGCAAAAACAACGCACCACCTC; downstream primer: AlaDH 2-NotI-R:
AAGCATTATGCGGCCGCTTAAGCACCCGCCACAGATGATTC) PCR to obtain the sequence AlaDH2, which was ligated to the vector pCD-T7-Cv2025-T7-BsADHC257LThe recombinant plasmid B is constructed as pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257L. The nucleotide sequence of AlaDH2 is shown in SEQ ID NO. 4. b) Genetic background modification of host escherichia coli BL21(DE 3); in order to prevent the substrate from being consumed by the internal fatty acid metabolic pathway of the host, the beta-oxidation pathway key enzyme FadD of the host escherichia coli BL21(DE3) is knocked out by using the CRISPR/Cas9 technology, and the modified host B-delta D is obtained. Further, in order to enhance the uptake of lauric acid, which is a hydrophobic substrate, into the host, outer membrane protein AlkL in the pseudomonas putida alkane degradation operon was introduced. An AlkL gene with a LacUV5 promoter is knocked in an original FadD position of an Escherichia coli B-delta D genome by using a CRISPR/Cas9 technology to obtain a modified host B1-1. Further to the AlkL nucleotide sequence shown in SEQ ID NO 5, pyridoxal phosphate PLP acts as a coenzyme for transaminases and decarboxylases, and is sufficiently supplied to facilitate transamination and decarboxylation. The introduction of pyridoxal phosphate synthesis pathway genes yaaD and yaaE from bacillus subtilis promotes the regeneration of pyridoxal phosphate in the cells of the chassis, provides sufficient coenzyme for the transamination reaction, and further improves the synthesis efficiency of 12-aminolauric acid. Escherichia coli B1-1 by using CRISPR/Cas9 technologyThe yaaDE gene with T7 promoter is knocked in the original FadD position of the genome to obtain a modified host P1-1. The yaaDE nucleotide sequence is shown as SEQ ID NO 7. c) Constructing a recombinant strain; example 1 plasmids pET-T7-CYP153A-NCP and pCD-T7-Cv2025-T7-BsADHC257LThe recombinant strain BL-CCB was obtained by introducing Escherichia coli BL21(DE3) in the conventional manner to obtain BL-CCB BL21(DE3) (pET-T7-CYP153A-NCP + pCD-T7-Cv2025-T7-BsADHC257L) And preserving in the form of glycerol bacteria or freeze-dried bacteria. Example 2 plasmid pET-T7-CYP153A-NCP and recombinant plasmid B pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257LThe recombinant strain BL-CCAB: BL21(DE3) (pET-T7-CYP153A-NCP + pCD-T7-Cv2025-RBS-AlaDH 2-T7-BsADH) was obtained by introducing Escherichia coli BL21(DE3) by a conventional methodC257L) And preserving in the form of glycerol bacteria or freeze-dried bacteria. Example 3 plasmid pET-T7-CYP153A-NCP and recombinant plasmid B pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257LAnd introducing Escherichia coli B-delta D by a conventional method to obtain a recombinant strain B-delta D-CCAB: BL21(DE3) Δ fadD (pET-T7-CYP153A-NCP + pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257L) And preserving in the form of glycerol bacteria or freeze-dried bacteria. Example 4 plasmid pET-T7-CYP153A-NCP and recombinant plasmid B pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257LIntroducing Escherichia coli B1-1 by conventional method to obtain recombinant strain B1-1-CCAB: BL21(DE3) Δ fadD:: PLacUV5-alkL(pET-T7-CYP153A-NCP+pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257L) And preserving in the form of glycerol bacteria or freeze-dried bacteria. Example 5 plasmid A pET-T7-CYP153A-NCP-RBS-GDH1 and recombinant plasmid B pCD-T7-Cv2025-RBS-AlaDH 2-T7-BsAADHC257LIntroducing Escherichia coli B1-1 by a conventional method to obtain a recombinant strain B1-1-CGCAB: BL21(DE3) Δ fadD:: PLacUV5-alkL(pET-T7-CYP153A-NCP-RBS-GDH1+pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257L) And preserving in the form of glycerol bacteria or freeze-dried bacteria. Example 6 plasmid A pET-T7-CYP153A-NCP-RBS-GDH1 and recombinant plasmid B pCD-T7-Cv2025-RBS-AlaDH 2-T7-BsAADHC257LIntroducing Escherichia coli P1-1 by a conventional method to obtain a recombinant strain P1-1-CGCAB: BL21(DE3) Δ fadD:: PLacUV5-alkL-PT7-yaaDE(pET-T7-CYP153A-NCP-RBS-GDH1+pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADHC257L) And preserving in the form of glycerol bacteria or freeze-dried bacteria. The genetically engineered bacteria of 6 examples were transformed with lauric acid to produce 12-aminolauric acid, and a yield verification experiment was performed: a) converting lauric acid into the recombinant strain BL-CCB to produce 12-aminolauric acid; single colonies were picked in 5ml LB liquid medium containing 100. mu.g/ml ampicillin and 50. mu.g/ml streptomycin, and the strain was activated overnight at 37 ℃ and 220 rpm. The activated strain was inoculated at 2% inoculum size into 50ml TB liquid fermentation medium containing the corresponding antibiotic (100. mu.g/ml ampicillin, 50. mu.g/ml streptomycin), cultured at 37 ℃ and 200rpm to OD600About 0.6. IPTG was added to a final concentration of 0.1mM, 0.25mM 5-aminolevulinic acid, 0.2mM vitamin B1, trace metal element additive (0.5mg MgCl)2，30mgFeCl2.6H2O，1mg ZnCl2.4H2O，0.2mg CoCl2.6H2O，1mg Na2MoO4.2H2O，0.5mg CaCl2.2H2O，1mg CuCl2And 0.2mg of H2BO3) Carrying out induction culture at 22-26 ℃ and 220rpm for 12h, and then centrifuging at 4000Xg to collect bacterial cells. To verify CYP153A-NCP, BsADHC257LAnd CV2025 whether or not it is possible to catalyze lauric acid to produce 12-aminolauric acid, the collected cells were washed twice with 0.9% sodium chloride solution, and then the conversion reaction solution (100mM Na)2HPO4-NaH2PO4Buffer, pH 8.0, 1% glucose, 50mM L-alanine) was resuspended at a cell concentration of 50g (wet weight)/L, disrupted by sonication, and centrifuged to collect the supernatant crude enzyme solution. Lauric acid was added to 2mL of the crude enzyme solution to a final concentration of 2.5mM (final concentration of DMSO: 2%), and after conversion at 30 ℃ and 220rpm for 8 hours, the reaction was terminated by adding an equal volume of acetonitrile, and after centrifugation at 12000Xg, the content of 12-aminolauric acid in the supernatant was measured. After 8 hours of reaction, 1.0mM of the final product, omega-aminolauric acid, was successfully obtained (FIG. 2). Furthermore, the absence of the over-oxidation product dodecanedioic acid (DDA) in the product indicates that the over-oxidation problem was not detected by the selective introduction of the P450 monooxygenase fusion protein CYP153A-NCP and the alcohol dehydrogenase mutant BsADHC257LThe problem of excessive oxidation of the intermediate product is well solved (fig. 3). The collected cells were washed twice with 0.9% sodium chloride solution and then with the conversion reaction solution (100mM N)a2HPO4-NaH2PO4 buffer, pH 8.0, 1% glucose, 50mM L-alanine) was resuspended at a cell concentration of 50g (wet weight)/L. Whole cell catalysis is 2.5mM (DMSO final concentration is 2%), the reaction is stopped by sampling and adding equal volume of acetonitrile at 30 ℃ and 220rpm, and the content of 12-aminolauric acid in the supernatant is detected after 12000Xg centrifugation. The 12-aminolauric acid content was determined using reverse phase high performance liquid chromatography. HPLC analysis used an agilent 1100 definition system, and the column was a luna C8(2) reverse phase column (250 mm. times.4.6 mm. times.5 μm). The HPLC conditions were as follows: mobile phase A: 0.1% TFA water, mobile phase B: 0.1% TFA methanol. Gradient elution was used, conditions were as follows: initially: 70% of A; 3 min: 70% of A; 20 min: 15% of A; and (28 min): 2% a, flow rate: 0.8 ml/min; column temperature: 40 +/-1 ℃; sample introduction amount: 25 μ l. An ELSD detector was used for detection (detection temperature: 65 ℃ C., flow rate of N2: 1.5 ml/min). The yield of 12-aminolauric acid (ADA) reached 62% after 20h of reaction time was detected (FIG. 4). b) Converting lauric acid into the recombinant strain BL-CCAB to produce 12-aminolauric acid; in the transamination reaction of 12-carbonyl lauric acid to 12-amino lauric acid catalyzed by 12-transaminase, alanine is required to be used as an amino donor. In order to reduce the cost, alanine dehydrogenase derived from bacillus subtilis is over-expressed in cells and used for catalyzing intracellular pyruvate to generate alanine, so that the alanine is regenerated. Meanwhile, since this enzyme is NADH-dependent, the alcohol dehydrogenase BsADH catalyzing the oxidation reaction of 12-hydroxy lauric acidC257LThen is NAD+Dependent, this makes it possible to form a pathway internal coenzyme NADH cycle without disrupting the cell's own coenzyme balance. The bacteria culture process is shown in the step (a) of the construction process. The collected cells were washed twice with 0.9% sodium chloride solution, and then resuspended in a cell concentration of 50g (wet weight)/L using a transformation reaction solution (100mM Na2HPO4-NaH2PO4 buffer, pH 8.0, 1% glucose, 200mM NH3/NH4Cl (NH3: NH4Cl ═ 1: 10)). Whole cell catalysis is 2.5mM (DMSO final concentration is 2%), after 220rpm conversion at 30 ℃, a sample is taken and added with equal volume of acetonitrile to stop the reaction, and after 12000Xg centrifugation, the content of 12-aminolauric acid in the supernatant is detected. The method for detecting the content of the 12-aminolauric acid is shown in the step (a) of the construction process. By introducing NADH-dependent AlaDH2 with NAD+BsADH dependent on BsADHC257LIn combination realize cofactor NADHAnd the combination of the omega-transaminase Cv-2025 with L-Ala as a cosubstrate realizes the utilization of inorganic ammonium NH4 +The cosubstrate L-Ala was recycled ((FIG. 11)). The yield of 12-aminolauric acid reached 65.6% after 16 hours of reaction (FIG. 5), compared with the recombinant strain BL-CCB which can only realize transamination by adding a large amount of L-Ala, the recombinant strain BL-CCAB reached a conversion rate of more than 62% faster by using inorganic ammonium reaction due to the construction of regeneration cycle of NADH and L-Ala by using AlaDH2 (FIG. 4). c) Converting lauric acid into 12-aminolauric acid by the recombinant strain B-delta D-CCAB; because FadD, a key enzyme of a beta-oxidation pathway in Escherichia coli, can catalyze lauric acid to form fatty acyl coenzyme A, so that a substrate enters the beta-oxidation pathway to compete with a target pathway for the substrate, the FadD is knocked out from the constructed recombinant Escherichia coli strain BL-CCAB producing omega-amino lauric acid to reduce the loss of substrate lauric acid. The bacteria culture process is shown in the step (a) of the construction process. Whole cell reaction procedure is shown in example 2-b. The method for detecting the content of the 12-aminolauric acid is shown in the step (a) of the construction process. Finally, the recombinant strain B-. DELTA.D-CCAB was constructed at 200mM NH3.H2O/NH4Cl (1:10) was used as an amino donor, 2.5mM of lauric acid was used as a substrate, and the yield of 12-aminolauric acid reached 76.6% at 18 hours (FIG. 6). Compared with a recombinant strain BL-CCAB without the FadD knockout, the FadD knockout blocks a beta-oxidation path, so that the conversion rate of the recombinant strain B-delta D-CCAB for catalyzing and producing 12-aminolauric acid is improved by 11%. d) The recombinant strain B1-1-CCAB is used for converting lauric acid to produce 12-aminolauric acid; considering that lauric acid is poor in water solubility and difficult to transport across membranes, outer membrane protein AlkL derived from pseudomonas putida alkane degradation operon is introduced to improve the lauric acid uptake ability of escherichia coli. The alkL with LacUV5 promoter was knocked in at the original FadD position of the E.coli B-delta D-CCAB genome using CRISPR/Cas9 technology. The bacteria culture process is shown in the step (a) of the construction process. Whole cell reaction procedure is shown in example 2-b. The method for detecting the content of the 12-aminolauric acid is shown in the step (a) of the construction process. Recombinant strain B1-1-CCAB (Δ fadD:: P) with final insertion of AlkL to facilitate substrate transportLacUV5-alkL) at 200mM NH3.H2O/NH4Cl (1:10) as an amino donor, whole cell catalyzed 2.5mM laurelThe 8-hour yield of the acid, 12-aminolauric acid reaches 94.8 percent; in the same case, the 8-hour yield of the recombinant strain BL-CCAB (BL21(DE3) WT) without the insertion of AlkL was 61.6%, and the 8-hour yield of the recombinant strain B-. DELTA.D-CCAB (. DELTA.fadD) was 68.2% (FIG. 7). Further increasing the substrate concentration to 5mM, whole cell catalysis was performed under the same conditions, and the 24h yield of 12-aminolauric acid was 53.0% (FIG. 8). e) Converting lauric acid into 12-aminolauric acid by using the recombinant strain B1-1-CGCAB; in order to achieve intracellular regeneration of coenzyme NADPH and further improve the yield of 12-aminolauric acid, NADP is added+The dependent glucose dehydrogenase GDH1 was introduced into the host to obtain recombinant strain B1-1-CGCAB. The bacteria culture process is shown in the step (a) of the construction process. Whole cell reaction procedure is shown in example 2-b. The method for detecting the content of the 12-aminolauric acid is shown in the step (a) of the construction process. Introduced NADP+Glucose dehydrogenase dependent GDH1 with NADPH dependent CYP 153A-NCP; recombinant strain B1-1-CGCAB coordinated to achieve cyclic regeneration of NADPH (FIG. 11), eventually achieving intracellular regeneration of the coenzyme NADPH at 200mM NH3.H2O/NH4Cl (1:10) was used as an amino donor, 5.0mM lauric acid was catalyzed by whole cells, and the yield of 12-aminolauric acid reached 81.0% at 6 hours (FIG. 9). f) Converting lauric acid into 12-aminolauric acid by using the recombinant strain P1-1-CGCAB; in order to realize sufficient intracellular supply of coenzyme pyridoxal phosphate PLP of transaminase Cv2025, Bacillus subtilis-derived pyridoxal phosphate synthesis pathway genes yaaD and yaaE are introduced into host bacteria to promote accumulation of pyridoxal phosphate in Chassis cells. The CRISPR-Cas9 system is used for carrying out genome editing on an escherichia coli recombinant strain B1-1-CGCAB for producing 12-aminolauric acid, and the modified recombinant strain P1-1-CGCAB is obtained. The bacteria culture process is shown in the step (a) of the construction process. Whole cell reaction procedure is shown in example 2-b. The method for detecting the content of the 12-aminolauric acid is shown in the step (a) of the construction process. The recombinant strain P1-1-CGCAB for enhancing intracellular coenzyme pyridoxal phosphate synthesis by inserting yaaDE into genome finally at 200mM NH3.H2O/NH4Cl (1:10) was used as an amino donor, 5.0mM lauric acid was catalyzed by whole cells, and the yield of 12-aminolauric acid reached 95.6% at 8 hours (FIG. 10), which is 14.6% higher than the conversion rate of B1-1-CGCAB without yaaDE insertion. The results of the above 6 examples illustrate the use of the inventionThe genetic engineering bacteria obtained by the clear construction strategy can effectively promote the uptake of hydrophobic substrate lauric acid, can realize the intracellular self-sufficiency of coenzyme and cosubstrate in the whole cell catalysis process without adding cofactors, and can efficiently catalyze lauric acid to synthesize 12-aminolauric acid. Particularly, the recombinant bacterium P1-1-CGCAB obtained in example 6 is an optimal genetic engineering bacterium, can almost completely convert 5.0mM lauric acid, and has the yield of over 95.6 percent in 8 hours for catalytic synthesis of 12-aminolauric acid, which is far superior to that reported in the prior art. The invention provides a gene construction strategy for effectively improving the content of intracellular PLP, realizes the high-efficiency synthesis of the intracellular PLP, and ensures the normal growth of thalli; the chassis combined metabolic engineering based on the artificial enzyme cascade design realizes the regeneration circulation of NADPH, NADH and L-alanine by the design and matching of a catalytic module; the gene yaaDE is synthesized by heterologously expressing pyridoxal phosphate (PLP) dependent on a ribose-5-phosphate pathway to meet the requirement of transaminase on coenzyme PLP, the coenzyme and a cosubstrate are not required to be added exogenously in the whole catalytic process, and the GDH1 and pyruvic acid are used for connecting the synthesis pathway and the central metabolic pathway. The obtained genetic engineering bacteria have high catalytic activity, and the yield of the 12-aminolauric acid synthesized by catalysis in 8 hours reaches over 95.6 percent when the concentration of substrate lauric acid is 5.0 mM. The foregoing illustrates and describes the principles, general features, and advantages of the present invention. It should be understood by those skilled in the art that the above embodiments do not limit the present invention in any way, and all technical solutions obtained by using equivalent alternatives or equivalent variations fall within the scope of the present invention.
Sequence listing
<110> Zhejiang university
<120> genetically engineered bacterium, construction method thereof and application thereof in production of nylon 12 monomer 12-aminolauric acid
<141> 2019-08-13
<160> 27
<170> SIPOSequenceListing 1.0
<210> 1
<211> 3213
<212> DNA
<213> Marinobacter aqua;B. megaterium
<400> 1
atgccgactt taccgcgtac ctttgatgat atccagagcc gtctgattaa cgccaccagc 60
cgtgttgtgc ctatgcagcg tcagatccaa ggtttaaaat tcttaatgag cgcaaaacgt 120
aaaacctttg gtccgcgccg tccgatgccg gagtttgtgg aaaccccgat tccggatgtg 180
aacacactgg ctttagaaga tatcgacgtg agcaatccgt ttctgtaccg tcaaggccag 240
tggcgcgcct attttaaacg tctgcgcgac gaagccccgg ttcattacca gaaaaacagt 300
ccgttcggcc cgttctggag cgttacccgc ttcgaggaca ttttatttgt ggacaagagt 360
cacgatttat ttagcgcaga gccgcagatt attctgggcg acccgccgga aggtctgagc 420
gtggagatgt tcattgctat ggaccctccg aaacacgacg tgcagcgtag cagtgtgcaa 480
ggtgtggttg ccccgaagaa tttaaaagag atggaaggtt taattcgcag ccgtactggt 540
gatgtgctgg attctttacc gaccgataaa ccgtttaatt gggtgccggc cgttagtaaa 600
gagctgactg gtcgcatgct ggcaacactg ctggattttc cgtacgagga acgccacaag 660
ttagtggagt ggagcgatcg catggctggt gcagcaagcg caaccggtgg tgagtttgcc 720
gatgaaaacg ccatgttcga cgacgcagcc gacatggcac gcagttttag ccgtctgtgg 780
cgcgataaag aagcacgtcg tgccgccggc gaagaaccgg gctttgattt aatcagtctg 840
ctgcagagta ataaagaaac caaagattta attaatcgcc cgatggagtt tattggcaac 900
ttaactttac tgatcgtggc tggtaacgat accacccgta acagcatgag cggcggtctg 960
gttgccatga acgaatttcc gcgcgagttc gaaaagctga aggccaaacc ggagctgatt 1020
cctaacatgg tgagcgagat catccgctgg cagacaccgc tggcatatat gcgtcgcatt 1080
gccaaacaag atgtggagct gggcggtcaa accattaaga aaggcgaccg cgtggtgatg 1140
tggtatgcca gcggcaaccg cgatgaacgc aagtttgata acccggacca attcatcatc 1200
gaccgcaaag acgcccgtaa ccacatgagc tttggctatg gcgtgcatcg ctgcatgggc 1260
aaccgtttag cagaactgca actgcgcatt ctgtgggagg agattttaaa acgcttcgac 1320
aatatcgagg tggtggaaga gccggaacgc gttcagagca atttcgtgcg cggttatagc 1380
cgtttaatgg tgaaactgac cccgaatagc ggcggcagcg gcggcagcgg cggcagcatt 1440
ccttcaccta gcactgaaca gtctgctaaa aaagtacgca aaaaggcaga aaacgctcat 1500
aatacgccgc tgcttgtgct atacggttca aatatgggaa cagctgaagg aacggcgcgt 1560
gatttagcag atattgcaat gagcaaagga tttgcaccgc aggtcgcaac gcttgattca 1620
cacgccggaa atcttccgcg cgaaggagct gtattaattg taacggcgtc ttataacggt 1680
catccgcctg ataacgcaaa gcaatttgtc gactggttag accaagcgtc tgctgatgaa 1740
gtaaaaggcg ttcgctactc cgtatttgga tgcggcgata aaaactgggc tactacgtat 1800
caaaaagtgc ctgcttttat cgatgaaacg cttgccgcta aaggggcaga aaacatcgct 1860
gaccgcggtg aagcagatgc aagcgacgac tttgaaggca catatgaaga atggcgtgaa 1920
catatgtgga gtgacgtagc agcctacttt aacctcgaca ttgaaaacag tgaagataat 1980
aaatctactc tttcacttca atttgtcgac agcgccgcgg atatgccgct tgcgaaaatg 2040
cacggtgcgt tttcaacgaa cgtcgtagca agcaaagaac ttcaacagcc aggcagtgca 2100
cgaagcacgc gacatcttga aattgaactt ccaaaagaag cttcttatca agaaggagat 2160
catttaggtg ttattcctcg caactatgaa ggaatagtaa accgtgtaac agcaaggttc 2220
ggcctagatg catcacagca aatccgtctg gaagcagaag aagaaaaatt agctcatttg 2280
ccactcgcta aaacagtatc cgtagaagag cttctgcaat acgtggagct tcaagatcct 2340
gttacgcgca cgcagcttcg cgcaatggct gctaaaacgg tctgcccgcc gcataaagta 2400
gagcttgaag ccttgcttga aaagcaagcc tacaaagaac aagtgctggc aaaacgttta 2460
acaatgcttg aactgcttga aaaatacccg gcgtgtgaaa tgaaattcag cgaatttatc 2520
gcccttctgc caagcatacg cccgcgctat tactcgattt cttcatcacc tcgtgtcgat 2580
gaaaaacaag caagcatcac ggtcagcgtt gtctcaggag aagcgtggag cggatatgga 2640
gaatataaag gaattgcgtc gaactatctt gccgagctgc aagaaggaga tacgattacg 2700
tgctttattt ccacaccgca gtcagaattt acgctgccaa aagaccctga aacgccgctt 2760
atcatggtcg gaccgggaac aggcgtcgcg ccgtttagag gctttgtgca ggcgcgcaaa 2820
cagctaaaag aacaaggaca gtcacttgga gaagcacatt tatacttcgg ctgccgttca 2880
cctcatgaag actatctgta tcaagaagag cttgaaaacg cccaaagcga aggcatcatt 2940
acgcttcata ccgctttttc tcgcatgcca aatcagccga aaacatacgt tcagcacgta 3000
atggaacaag acggcaagaa attgattgaa cttcttgatc aaggagcgca cttctatatt 3060
tgcggagacg gaagccaaat ggcacctgcc gttgaagcaa cgcttatgaa aagctatgct 3120
gacgttcacc aagtgagtga agcagacgct cgcttatggc tgcagcagct agaagaaaaa 3180
ggccgatacg caaaagacgt gtgggctggg taa 3213
<210> 2
<211> 1296
<212> DNA
<213> Bacillus stearothermophilus
<400> 2
atgccgactt taccgcgtac ctttgatgat atccagagcc gtctgattaa cgccaccagc 60
cgtgttgtgc ctatgcagcg tcagatccaa ggtttaaaat tcttaatgag cgcaaaacgt 120
aaaacctttg gtccgcgccg tccgatgccg gagtttgtgg aaaccccgat tccggatgtg 180
aacacactgg ctttagaaga tatcgacgtg agcaatccgt ttctgtaccg tcaaggccag 240
atggcaagct ggagccatcc gcagtttgaa aaaggtgcca aagcagcagt tgttgaacag 300
tttaaagaac cgctgaaaat taaggaagtg gaaaaaccga ccattagtta tggcgaagtt 360
ctggttcgca ttaaggcatg tggtgtttgt cataccgatc tgcatgcagc ccacggtgac 420
tggccggtga aaccgaaact gccgctgatt ccgggtcatg aaggtgttgg cattgttgaa 480
gaagttggtc cgggcgttac ccatctgaaa gtgggcgata gagtgggcat tccgtggctg 540
tatagcgcct gtggtcattg tgattattgt ctgagcggcc aggaaaccct gtgtgaacat 600
cagaaaaatg ccggctatag cgttgatggc ggttatgcag aatattgtcg cgcagcagca 660
gattatgttg ttaaaattcc ggataatctg agttttgaag aagcagcacc gattttctgt 720
gccggtgtga ccacctataa agccctgaaa gttaccggtg ccaaaccggg tgaatgggtt 780
gcaatctatg gtattggtgg cctgggtcat gtggcagttc agtatgcaaa agcaatgggt 840
ctgaatgtgg ttgcagttga tattggtgac gaaaaactgg aactggccaa agaactgggc 900
gcagatctgg ttgttaatcc gctgaaagaa gatgcagcaa aattcatgaa agaaaaagtt 960
ggcggcgtgc atgcagcagt tgtgaccgcc gtgagcaaac cggcatttca gagtgcctat 1020
aatagtattc gtcgtggcgg cgccctggtg ctggtgggtt tacctccgga agaaatgccg 1080
attccgattt ttgataccgt gctgaatggt attaagatta ttggcagtat tgtgggcacc 1140
cgcaaagatc tgcaagaagc cctgcaattt gccgcagaag gtaaagtgaa aaccattatt 1200
gaagttcagc cgctggaaaa aattaatgaa gtttttgatc gcatgctgaa aggtcagatt 1260
aatggtcgtg tggttctgac cctggaagat aaataa 1296
<210> 3
<211> 1380
<212> DNA
<213> Chromobacterium violaceum
<400> 3
atgcaaaaac aacgcaccac ctcacaatgg cgcgaactgg atgccgcaca ccacctgcac 60
ccgtttaccg acaccgcaag cctgaatcag gccggcgccc gtgttatgac ccgcggcgaa 120
ggtgtgtatc tgtgggattc tgagggtaac aaaattatcg acggcatggc tggtctgtgg 180
tgcgttaatg tcggctatgg tcgtaaagat tttgccgaag cggcccgtcg ccaaatggaa 240
gaactgccgt tctacaacac ctttttcaaa accacgcatc cggcggtggt tgaactgagc 300
agcctgctgg cggaagttac gccggccggc tttgatcgtg tgttctatac caattcaggt 360
tcggaaagcg tggatacgat gatccgcatg gttcgtcgct actgggacgt ccagggcaaa 420
ccggaaaaga aaaccctgat cggtcgttgg aacggctatc atggttctac gattggcggt 480
gcaagtctgg gcggtatgaa atacatgcac gaacagggcg atctgccgat tccgggtatg 540
gcgcatatcg aacaaccgtg gtggtacaaa cacggcaaag atatgacccc ggacgaattt 600
ggtgtcgtgg cagctcgctg gctggaagaa aaaattctgg aaatcggcgc cgataaagtg 660
gcggcctttg ttggcgaacc gattcagggt gcgggcggtg tgattgttcc gccggccacc 720
tattggccgg aaattgaacg tatctgccgc aaatacgatg ttctgctggt cgcagacgaa 780
gttatttgtg gctttggtcg taccggcgaa tggttcggtc atcagcactt tggcttccaa 840
ccggacctgt ttacggcagc taaaggcctg agttccggtt atctgccgat cggcgccgtc 900
ttcgtgggta aacgcgttgc agaaggtctg attgctggcg gtgattttaa tcatggcttc 960
acctatagcg gtcacccggt ctgtgcggcc gtggcacatg ctaatgtggc agctctgcgt 1020
gacgaaggca tcgtgcagcg cgttaaagat gacattggtc cgtatatgca aaaacgttgg 1080
cgcgaaacgt ttagccgttt cgaacacgtc gatgacgtgc gcggcgttgg tatggtccag 1140
gcatttaccc tggtgaaaaa taaagctaaa cgcgaactgt ttccggattt cggcgaaatt 1200
ggtacgctgt gccgtgacat ctttttccgc aacaatctga ttatgcgtgc gtgtggtgat 1260
cacattgtta gcgccccgcc gctggttatg acccgcgcag aagtcgacga aatgctggcc 1320
gtggcggaac gctgcctgga agaatttgaa cagaccctga aagctcgtgg cctggcgtaa 1380
<210> 4
<211> 969
<212> DNA
<213> Bacillus Subtilisin
<400> 4
atggaaaccc tgattctgac ccaggaagaa gttgaaagcc tgattagcat ggatgaagcc 60
atgaatgccg tggaagaagc ctttcgtctg tatgcactgg gtaaagccca gatgccgccg 120
aaagtgtatc tggaatttga aaaaggtgac ctgcgtgcca tgccggccca tctgatgggt 180
tatgcaggcc tgaaatgggt gaatagtcat ccgggcaatc cggataaagg cctgccgacc 240
gtgatggccc tgatgattct gaatagtccg gaaaccggtt ttccgctggc cgtgatggat 300
gccacctata ccaccagtct gcgtaccggt gcagcaggtg gcattgcagc aaaatatctg 360
gcacgtaaaa atagcagcgt gtttggcttt attggctgtg gcacccaggc atattttcag 420
ctggaagccc tgcgccgtgt ttttgatatt ggcgaagtga aagcatacga tgttcgcgaa 480
aaagcagcaa aaaagtttgt tagttactgc gaagatcgtg gtattagtgc aagtgttcag 540
ccggccgaag aagcaagccg ctgcgatgtt ctggtgacca ccaccccgag ccgtaaaccg 600
gtggtgaaag cagaatgggt tgaagaaggt acccatatta atgccattgg cgcagatggt 660
ccgggtaaac aggaactgga tgttgaaatt ctgaaaaaag ccaaaatcgt ggtggatgat 720
ctggaacagg caaaacatgg cggtgaaatt aatgttgcag tgagcaaagg cgtgattggt 780
gttgaagatg ttcatgcaac cattggtgaa gtgattgcag gtctgaaaga tggtcgtgaa 840
agtgatgaag aaattaccat ttttgacagt accggtctgg caattcagga tgttgccgtt 900
gccaaagtgg tgtatgaaaa tgccctgagc aaaaatgttg gcagtaaaat taagttcttc 960
cgtatttaa 969
<210> 5
<211> 693
<212> DNA
<213> Pseudomonas Putida GPO1
<400> 5
atgagcttta gcaattacaa ggttattgcc atgccggtgc tggttgccaa ttttgttctg 60
ggcgccgcca ccgcatgggc aaatgaaaat tatccggcca aaagtgccgg ctataatcag 120
ggtgactggg tggccagttt taattttagc aaagtgtatg ttggcgaaga actgggtgac 180
ctgaatgtgg gtggtggtgc cctgccgaat gcagatgtta gcattggtaa tgataccacc 240
ctgacctttg atattgccta ttttgttagc agtaacattg cagtggattt ctttgtgggt 300
gttccggccc gtgccaaatt tcagggtgaa aaaagcatta gcagtctggg tcgtgttagt 360
gaagtggatt atggcccggc aattctgagt ctgcagtatc attatgatag ctttgaacgc 420
ctgtatccgt atgttggcgt tggcgttggt cgcgttctgt ttttcgataa aaccgatggt 480
gccctgagca gctttgatat taaggataaa tgggccccgg catttcaggt gggcctgcgt 540
tatgatctgg gtaatagctg gatgctgaat agtgatgttc gctatattcc gtttaaaacc 600
gatgttaccg gcaccctggg cccggttccg gttagtacca aaattgaagt ggatccgttt 660
attctgagcc tgggcgcaag ctatgtgttt taa 693
<210> 6
<211> 789
<212> DNA
<213> Bacillus cereus
<400> 6
atgggttaca gcgatctgga aggtaaagtt gttgtgatta ctggctctgc taccggtctg 60
ggccgcgcga tgggtgtacg tttcgcgaaa gagaaggcta aagtcgtgat caattaccgt 120
agccgtgatt ctgaggccaa cgatgtactg gaagaaatta agaaggtggg cggcgaagct 180
atcgctgtca aaggcgatgt aaccgtggaa gcagatgtta tgaacctgat tcaatctgcg 240
gttaaagagt tcggtactct ggatgtgatg atcaacaacg ctggcattga gaacgctgtt 300
ccaagccacg aaatgccgct ggaggattgg aacaaagtca tcaacaccaa cctgaccggt 360
gcgttcctgg gttcccgtga agccatcaaa tatttcgtag agcacgacat taaaggcagc 420
gttatcaaca tgagctctgt acacgaaaaa atcccgtggc cgctgtttgt gcactacgct 480
gcatctaaag gtggcattaa actgatgacc gaaactctgg cactggaata cgctccgaaa 540
ggcattcgcg ttaataacat cggcccgggc gcgatcaaca ccccgatcaa cgctgaaaaa 600
ttcgcggatc caaaacagcg tgcggatgtt gagtccatga tcccgatggg ctatattggt 660
aaaccggaag agattgcggc ggtcgcaacc tggctggctt cctctgaggc ttcctatgta 720
accggtatta ccctgttcgc ggatggcggt atgacgctgt acccatcctt ccaggccggt 780
cgtggttaa 789
<210> 7
<211> 1497
<212> DNA
<213> Bacillus subtilis
<400> 7
atggctcaaa caggtactga acgtgtaaaa cgcggaatgg cagaaatgca aaaaggcggc 60
gtcatcatgg acgtcatcaa tgcggaacaa gcgaaaatcg ctgaagaagc tggagctgtc 120
gctgtaatgg cgctagaacg tgtgccagca gatattcgcg cggctggagg agttgcccgt 180
atggctgacc ctacaatcgt ggaagaagta atgaatgcag tatctatccc ggtaatggca 240
aaagcgcgta tcggacatat tgttgaagcg cgtgtgcttg aagctatggg tgttgactat 300
attgatgaaa gtgaagttct gacgccggct gacgaagaat ttcatttaaa taaaaatgaa 360
tacacagttc cttttgtctg tggctgccgt gatcttggtg aagcaacacg ccgtattgcg 420
gaaggtgctt ctatgcttcg cacaaaaggt gagcctggaa caggtaatat tgttgaggct 480
gttcgccata tgcgtaaagt taacgctcaa gtgcgcaaag tagttgcgat gagtgaggat 540
gagctaatga cagaagcgaa aaacctaggt gctccttacg agcttcttct tcaaattaaa 600
aaagacggca agcttcctgt cgttaacttt gccgctggcg gcgtagcaac tccagctgat 660
gctgctctca tgatgcagct tggtgctgac ggagtatttg ttggttctgg tatttttaaa 720
tcagacaacc ctgctaaatt tgcgaaagca attgtggaag caacaactca ctttactgat 780
tacaaattaa tcgctgagtt gtcaaaagag cttggtactg caatgaaagg gattgaaatc 840
tcaaacttac ttccagaaca gcgtatgcaa gaacgcggct ggtaagaaca taggagcgct 900
gctgacatgt taacaatagg tgtactagga cttcaaggag cagttagaga gcacatccat 960
gcgattgaag catgcggcgc ggctggtctt gtcgtaaaac gtccggagca gctgaacgaa 1020
gttgacgggt tgattttgcc gggcggtgag agcacgacga tgcgccgttt gatcgatacg 1080
tatcaattca tggagccgct tcgtgaattc gctgctcagg gcaaaccgat gtttggaaca 1140
tgtgccggat taattatatt agcaaaagaa attgccggtt cagataatcc tcatttaggt 1200
cttctgaatg tggttgtaga acgtaattca tttggccggc aggttgacag ctttgaagct 1260
gatttaacaa ttaaaggctt ggacgagcct tttactgggg tattcatccg tgctccgcat 1320
attttagaag ctggtgaaaa tgttgaagtt ctatcggagc ataatggtcg tattgtagcc 1380
gcgaaacagg ggcaattcct tggctgctca ttccatccgg agctgacaga agatcaccga 1440
gtgacgcagc tgtttgttga aatggttgag gaatataagc aaaaggcact tgtataa 1497
<210> 8
<211> 1070
<212> PRT
<213> CYP153A-NCP of Marinobacter aqua&B. megaterium
<400> 8
Met Pro Thr Leu Pro Arg Thr Phe Asp Asp Ile Gln Ser Arg Leu Ile
1 5 10 15
Asn Ala Thr Ser Arg Val Val Pro Met Gln Arg Gln Ile Gln Gly Leu
20 25 30
Lys Phe Leu Met Ser Ala Lys Arg Lys Thr Phe Gly Pro Arg Arg Pro
35 40 45
Met Pro Glu Phe Val Glu Thr Pro Ile Pro Asp Val Asn Thr Leu Ala
50 55 60
Leu Glu Asp Ile Asp Val Ser Asn Pro Phe Leu Tyr Arg Gln Gly Gln
65 70 75 80
Trp Arg Ala Tyr Phe Lys Arg Leu Arg Asp Glu Ala Pro Val His Tyr
85 90 95
Gln Lys Asn Ser Pro Phe Gly Pro Phe Trp Ser Val Thr Arg Phe Glu
100 105 110
Asp Ile Leu Phe Val Asp Lys Ser His Asp Leu Phe Ser Ala Glu Pro
115 120 125
Gln Ile Ile Leu Gly Asp Pro Pro Glu Gly Leu Ser Val Glu Met Phe
130 135 140
Ile Ala Met Asp Pro Pro Lys His Asp Val Gln Arg Ser Ser Val Gln
145 150 155 160
Gly Val Val Ala Pro Lys Asn Leu Lys Glu Met Glu Gly Leu Ile Arg
165 170 175
Ser Arg Thr Gly Asp Val Leu Asp Ser Leu Pro Thr Asp Lys Pro Phe
180 185 190
Asn Trp Val Pro Ala Val Ser Lys Glu Leu Thr Gly Arg Met Leu Ala
195 200 205
Thr Leu Leu Asp Phe Pro Tyr Glu Glu Arg His Lys Leu Val Glu Trp
210 215 220
Ser Asp Arg Met Ala Gly Ala Ala Ser Ala Thr Gly Gly Glu Phe Ala
225 230 235 240
Asp Glu Asn Ala Met Phe Asp Asp Ala Ala Asp Met Ala Arg Ser Phe
245 250 255
Ser Arg Leu Trp Arg Asp Lys Glu Ala Arg Arg Ala Ala Gly Glu Glu
260 265 270
Pro Gly Phe Asp Leu Ile Ser Leu Leu Gln Ser Asn Lys Glu Thr Lys
275 280 285
Asp Leu Ile Asn Arg Pro Met Glu Phe Ile Gly Asn Leu Thr Leu Leu
290 295 300
Ile Val Ala Gly Asn Asp Thr Thr Arg Asn Ser Met Ser Gly Gly Leu
305 310 315 320
Val Ala Met Asn Glu Phe Pro Arg Glu Phe Glu Lys Leu Lys Ala Lys
325 330 335
Pro Glu Leu Ile Pro Asn Met Val Ser Glu Ile Ile Arg Trp Gln Thr
340 345 350
Pro Leu Ala Tyr Met Arg Arg Ile Ala Lys Gln Asp Val Glu Leu Gly
355 360 365
Gly Gln Thr Ile Lys Lys Gly Asp Arg Val Val Met Trp Tyr Ala Ser
370 375 380
Gly Asn Arg Asp Glu Arg Lys Phe Asp Asn Pro Asp Gln Phe Ile Ile
385 390 395 400
Asp Arg Lys Asp Ala Arg Asn His Met Ser Phe Gly Tyr Gly Val His
405 410 415
Arg Cys Met Gly Asn Arg Leu Ala Glu Leu Gln Leu Arg Ile Leu Trp
420 425 430
Glu Glu Ile Leu Lys Arg Phe Asp Asn Ile Glu Val Val Glu Glu Pro
435 440 445
Glu Arg Val Gln Ser Asn Phe Val Arg Gly Tyr Ser Arg Leu Met Val
450 455 460
Lys Leu Thr Pro Asn Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Ile
465 470 475 480
Pro Ser Pro Ser Thr Glu Gln Ser Ala Lys Lys Val Arg Lys Lys Ala
485 490 495
Glu Asn Ala His Asn Thr Pro Leu Leu Val Leu Tyr Gly Ser Asn Met
500 505 510
Gly Thr Ala Glu Gly Thr Ala Arg Asp Leu Ala Asp Ile Ala Met Ser
515 520 525
Lys Gly Phe Ala Pro Gln Val Ala Thr Leu Asp Ser His Ala Gly Asn
530 535 540
Leu Pro Arg Glu Gly Ala Val Leu Ile Val Thr Ala Ser Tyr Asn Gly
545 550 555 560
His Pro Pro Asp Asn Ala Lys Gln Phe Val Asp Trp Leu Asp Gln Ala
565 570 575
Ser Ala Asp Glu Val Lys Gly Val Arg Tyr Ser Val Phe Gly Cys Gly
580 585 590
Asp Lys Asn Trp Ala Thr Thr Tyr Gln Lys Val Pro Ala Phe Ile Asp
595 600 605
Glu Thr Leu Ala Ala Lys Gly Ala Glu Asn Ile Ala Asp Arg Gly Glu
610 615 620
Ala Asp Ala Ser Asp Asp Phe Glu Gly Thr Tyr Glu Glu Trp Arg Glu
625 630 635 640
His Met Trp Ser Asp Val Ala Ala Tyr Phe Asn Leu Asp Ile Glu Asn
645 650 655
Ser Glu Asp Asn Lys Ser Thr Leu Ser Leu Gln Phe Val Asp Ser Ala
660 665 670
Ala Asp Met Pro Leu Ala Lys Met His Gly Ala Phe Ser Thr Asn Val
675 680 685
Val Ala Ser Lys Glu Leu Gln Gln Pro Gly Ser Ala Arg Ser Thr Arg
690 695 700
His Leu Glu Ile Glu Leu Pro Lys Glu Ala Ser Tyr Gln Glu Gly Asp
705 710 715 720
His Leu Gly Val Ile Pro Arg Asn Tyr Glu Gly Ile Val Asn Arg Val
725 730 735
Thr Ala Arg Phe Gly Leu Asp Ala Ser Gln Gln Ile Arg Leu Glu Ala
740 745 750
Glu Glu Glu Lys Leu Ala His Leu Pro Leu Ala Lys Thr Val Ser Val
755 760 765
Glu Glu Leu Leu Gln Tyr Val Glu Leu Gln Asp Pro Val Thr Arg Thr
770 775 780
Gln Leu Arg Ala Met Ala Ala Lys Thr Val Cys Pro Pro His Lys Val
785 790 795 800
Glu Leu Glu Ala Leu Leu Glu Lys Gln Ala Tyr Lys Glu Gln Val Leu
805 810 815
Ala Lys Arg Leu Thr Met Leu Glu Leu Leu Glu Lys Tyr Pro Ala Cys
820 825 830
Glu Met Lys Phe Ser Glu Phe Ile Ala Leu Leu Pro Ser Ile Arg Pro
835 840 845
Arg Tyr Tyr Ser Ile Ser Ser Ser Pro Arg Val Asp Glu Lys Gln Ala
850 855 860
Ser Ile Thr Val Ser Val Val Ser Gly Glu Ala Trp Ser Gly Tyr Gly
865 870 875 880
Glu Tyr Lys Gly Ile Ala Ser Asn Tyr Leu Ala Glu Leu Gln Glu Gly
885 890 895
Asp Thr Ile Thr Cys Phe Ile Ser Thr Pro Gln Ser Glu Phe Thr Leu
900 905 910
Pro Lys Asp Pro Glu Thr Pro Leu Ile Met Val Gly Pro Gly Thr Gly
915 920 925
Val Ala Pro Phe Arg Gly Phe Val Gln Ala Arg Lys Gln Leu Lys Glu
930 935 940
Gln Gly Gln Ser Leu Gly Glu Ala His Leu Tyr Phe Gly Cys Arg Ser
945 950 955 960
Pro His Glu Asp Tyr Leu Tyr Gln Glu Glu Leu Glu Asn Ala Gln Ser
965 970 975
Glu Gly Ile Ile Thr Leu His Thr Ala Phe Ser Arg Met Pro Asn Gln
980 985 990
Pro Lys Thr Tyr Val Gln His Val Met Glu Gln Asp Gly Lys Lys Leu
995 1000 1005
Ile Glu Leu Leu Asp Gln Gly Ala His Phe Tyr Ile Cys Gly Asp Gly
1010 1015 1020
Ser Gln Met Ala Pro Ala Val Glu Ala Thr Leu Met Lys Ser Tyr Ala
1025 1030 1035 1040
Asp Val His Gln Val Ser Glu Ala Asp Ala Arg Leu Trp Leu Gln Gln
1045 1050 1055
Leu Glu Glu Lys Gly Arg Tyr Ala Lys Asp Val Trp Ala Gly
1060 1065 1070
<210> 9
<211> 351
<212> PRT
<213> BsADHC257L of Bacillus Stearothermophilus
<400> 9
Met Ala Ser Trp Ser His Pro Gln Phe Glu Lys Gly Ala Lys Ala Ala
1 5 10 15
Val Val Glu Gln Phe Lys Glu Pro Leu Lys Ile Lys Glu Val Glu Lys
20 25 30
Pro Thr Ile Ser Tyr Gly Glu Val Leu Val Arg Ile Lys Ala Cys Gly
35 40 45
Val Cys His Thr Asp Leu His Ala Ala His Gly Asp Trp Pro Val Lys
50 55 60
Pro Lys Leu Pro Leu Ile Pro Gly His Glu Gly Val Gly Ile Val Glu
65 70 75 80
Glu Val Gly Pro Gly Val Thr His Leu Lys Val Gly Asp Arg Val Gly
85 90 95
Ile Pro Trp Leu Tyr Ser Ala Cys Gly His Cys Asp Tyr Cys Leu Ser
100 105 110
Gly Gln Glu Thr Leu Cys Glu His Gln Lys Asn Ala Gly Tyr Ser Val
115 120 125
Asp Gly Gly Tyr Ala Glu Tyr Cys Arg Ala Ala Ala Asp Tyr Val Val
130 135 140
Lys Ile Pro Asp Asn Leu Ser Phe Glu Glu Ala Ala Pro Ile Phe Cys
145 150 155 160
Ala Gly Val Thr Thr Tyr Lys Ala Leu Lys Val Thr Gly Ala Lys Pro
165 170 175
Gly Glu Trp Val Ala Ile Tyr Gly Ile Gly Gly Leu Gly His Val Ala
180 185 190
Val Gln Tyr Ala Lys Ala Met Gly Leu Asn Val Val Ala Val Asp Ile
195 200 205
Gly Asp Glu Lys Leu Glu Leu Ala Lys Glu Leu Gly Ala Asp Leu Val
210 215 220
Val Asn Pro Leu Lys Glu Asp Ala Ala Lys Phe Met Lys Glu Lys Val
225 230 235 240
Gly Gly Val His Ala Ala Val Val Thr Ala Val Ser Lys Pro Ala Phe
245 250 255
Gln Ser Ala Tyr Asn Ser Ile Arg Arg Gly Gly Ala Leu Val Leu Val
260 265 270
Gly Leu Pro Pro Glu Glu Met Pro Ile Pro Ile Phe Asp Thr Val Leu
275 280 285
Asn Gly Ile Lys Ile Ile Gly Ser Ile Val Gly Thr Arg Lys Asp Leu
290 295 300
Gln Glu Ala Leu Gln Phe Ala Ala Glu Gly Lys Val Lys Thr Ile Ile
305 310 315 320
Glu Val Gln Pro Leu Glu Lys Ile Asn Glu Val Phe Asp Arg Met Leu
325 330 335
Lys Gly Gln Ile Asn Gly Arg Val Val Leu Thr Leu Glu Asp Lys
340 345 350
<210> 10
<211> 459
<212> PRT
<213> Cv-2025 of Chromobacterium violaceum
<400> 10
Met Gln Lys Gln Arg Thr Thr Ser Gln Trp Arg Glu Leu Asp Ala Ala
1 5 10 15
His His Leu His Pro Phe Thr Asp Thr Ala Ser Leu Asn Gln Ala Gly
20 25 30
Ala Arg Val Met Thr Arg Gly Glu Gly Val Tyr Leu Trp Asp Ser Glu
35 40 45
Gly Asn Lys Ile Ile Asp Gly Met Ala Gly Leu Trp Cys Val Asn Val
50 55 60
Gly Tyr Gly Arg Lys Asp Phe Ala Glu Ala Ala Arg Arg Gln Met Glu
65 70 75 80
Glu Leu Pro Phe Tyr Asn Thr Phe Phe Lys Thr Thr His Pro Ala Val
85 90 95
Val Glu Leu Ser Ser Leu Leu Ala Glu Val Thr Pro Ala Gly Phe Asp
100 105 110
Arg Val Phe Tyr Thr Asn Ser Gly Ser Glu Ser Val Asp Thr Met Ile
115 120 125
Arg Met Val Arg Arg Tyr Trp Asp Val Gln Gly Lys Pro Glu Lys Lys
130 135 140
Thr Leu Ile Gly Arg Trp Asn Gly Tyr His Gly Ser Thr Ile Gly Gly
145 150 155 160
Ala Ser Leu Gly Gly Met Lys Tyr Met His Glu Gln Gly Asp Leu Pro
165 170 175
Ile Pro Gly Met Ala His Ile Glu Gln Pro Trp Trp Tyr Lys His Gly
180 185 190
Lys Asp Met Thr Pro Asp Glu Phe Gly Val Val Ala Ala Arg Trp Leu
195 200 205
Glu Glu Lys Ile Leu Glu Ile Gly Ala Asp Lys Val Ala Ala Phe Val
210 215 220
Gly Glu Pro Ile Gln Gly Ala Gly Gly Val Ile Val Pro Pro Ala Thr
225 230 235 240
Tyr Trp Pro Glu Ile Glu Arg Ile Cys Arg Lys Tyr Asp Val Leu Leu
245 250 255
Val Ala Asp Glu Val Ile Cys Gly Phe Gly Arg Thr Gly Glu Trp Phe
260 265 270
Gly His Gln His Phe Gly Phe Gln Pro Asp Leu Phe Thr Ala Ala Lys
275 280 285
Gly Leu Ser Ser Gly Tyr Leu Pro Ile Gly Ala Val Phe Val Gly Lys
290 295 300
Arg Val Ala Glu Gly Leu Ile Ala Gly Gly Asp Phe Asn His Gly Phe
305 310 315 320
Thr Tyr Ser Gly His Pro Val Cys Ala Ala Val Ala His Ala Asn Val
325 330 335
Ala Ala Leu Arg Asp Glu Gly Ile Val Gln Arg Val Lys Asp Asp Ile
340 345 350
Gly Pro Tyr Met Gln Lys Arg Trp Arg Glu Thr Phe Ser Arg Phe Glu
355 360 365
His Val Asp Asp Val Arg Gly Val Gly Met Val Gln Ala Phe Thr Leu
370 375 380
Val Lys Asn Lys Ala Lys Arg Glu Leu Phe Pro Asp Phe Gly Glu Ile
385 390 395 400
Gly Thr Leu Cys Arg Asp Ile Phe Phe Arg Asn Asn Leu Ile Met Arg
405 410 415
Ala Cys Gly Asp His Ile Val Ser Ala Pro Pro Leu Val Met Thr Arg
420 425 430
Ala Glu Val Asp Glu Met Leu Ala Val Ala Glu Arg Cys Leu Glu Glu
435 440 445
Phe Glu Gln Thr Leu Lys Ala Arg Gly Leu Ala
450 455
<210> 11
<211> 378
<212> PRT
<213> Bacillus Subtilisin
<400> 11
Met Ile Ile Gly Val Pro Lys Glu Ile Lys Asn Asn Glu Asn Arg Val
1 5 10 15
Ala Leu Thr Pro Gly Gly Val Ser Gln Leu Ile Ser Asn Gly His Arg
20 25 30
Val Leu Val Glu Thr Gly Ala Gly Leu Gly Ser Gly Phe Glu Asn Glu
35 40 45
Ala Tyr Glu Ser Ala Gly Ala Glu Ile Ile Ala Asp Pro Lys Gln Val
50 55 60
Trp Asp Ala Glu Met Val Met Lys Val Lys Glu Pro Leu Pro Glu Glu
65 70 75 80
Tyr Val Tyr Phe Arg Lys Gly Leu Val Leu Phe Thr Tyr Leu His Leu
85 90 95
Ala Ala Glu Pro Glu Leu Ala Gln Ala Leu Lys Asp Lys Gly Val Thr
100 105 110
Ala Ile Ala Tyr Glu Thr Val Ser Glu Gly Arg Thr Leu Pro Leu Leu
115 120 125
Thr Pro Met Ser Glu Val Ala Gly Arg Met Ala Ala Gln Ile Gly Ala
130 135 140
Gln Phe Leu Glu Lys Pro Lys Gly Gly Lys Gly Ile Leu Leu Ala Gly
145 150 155 160
Val Pro Gly Val Ser Arg Gly Lys Val Thr Ile Ile Gly Gly Gly Val
165 170 175
Val Gly Thr Asn Ala Ala Lys Met Ala Val Gly Leu Gly Ala Asp Val
180 185 190
Thr Ile Ile Asp Leu Asn Ala Asp Arg Leu Arg Gln Leu Asp Asp Ile
195 200 205
Phe Gly His Gln Ile Lys Thr Leu Ile Ser Asn Pro Val Asn Ile Ala
210 215 220
Asp Ala Val Ala Glu Ala Asp Leu Leu Ile Cys Ala Val Leu Ile Pro
225 230 235 240
Gly Ala Lys Ala Pro Thr Leu Val Thr Glu Glu Met Val Lys Gln Met
245 250 255
Lys Pro Gly Ser Val Ile Val Asp Val Ala Ile Asp Gln Gly Gly Ile
260 265 270
Val Glu Thr Val Asp His Ile Thr Thr His Asp Gln Pro Thr Tyr Glu
275 280 285
Lys His Gly Val Val His Tyr Ala Val Ala Asn Met Pro Gly Ala Val
290 295 300
Pro Arg Thr Ser Thr Ile Ala Leu Thr Asn Val Thr Val Pro Tyr Ala
305 310 315 320
Leu Gln Ile Ala Asn Lys Gly Ala Val Lys Ala Leu Ala Asp Asn Thr
325 330 335
Ala Leu Arg Ala Gly Leu Asn Thr Ala Asn Gly His Val Thr Tyr Glu
340 345 350
Ala Val Ala Arg Asp Leu Gly Tyr Glu Tyr Val Pro Ala Glu Lys Ala
355 360 365
Leu Gln Asp Glu Ser Ser Val Ala Gly Ala
370 375
<210> 12
<211> 230
<212> PRT
<213> Pseudomonas Putida GPO1
<400> 12
Met Ser Phe Ser Asn Tyr Lys Val Ile Ala Met Pro Val Leu Val Ala
1 5 10 15
Asn Phe Val Leu Gly Ala Ala Thr Ala Trp Ala Asn Glu Asn Tyr Pro
20 25 30
Ala Lys Ser Ala Gly Tyr Asn Gln Gly Asp Trp Val Ala Ser Phe Asn
35 40 45
Phe Ser Lys Val Tyr Val Gly Glu Glu Leu Gly Asp Leu Asn Val Gly
50 55 60
Gly Gly Ala Leu Pro Asn Ala Asp Val Ser Ile Gly Asn Asp Thr Thr
65 70 75 80
Leu Thr Phe Asp Ile Ala Tyr Phe Val Ser Ser Asn Ile Ala Val Asp
85 90 95
Phe Phe Val Gly Val Pro Ala Arg Ala Lys Phe Gln Gly Glu Lys Ser
100 105 110
Ile Ser Ser Leu Gly Arg Val Ser Glu Val Asp Tyr Gly Pro Ala Ile
115 120 125
Leu Ser Leu Gln Tyr His Tyr Asp Ser Phe Glu Arg Leu Tyr Pro Tyr
130 135 140
Val Gly Val Gly Val Gly Arg Val Leu Phe Phe Asp Lys Thr Asp Gly
145 150 155 160
Ala Leu Ser Ser Phe Asp Ile Lys Asp Lys Trp Ala Pro Ala Phe Gln
165 170 175
Val Gly Leu Arg Tyr Asp Leu Gly Asn Ser Trp Met Leu Asn Ser Asp
180 185 190
Val Arg Tyr Ile Pro Phe Lys Thr Asp Val Thr Gly Thr Leu Gly Pro
195 200 205
Val Pro Val Ser Thr Lys Ile Glu Val Asp Pro Phe Ile Leu Ser Leu
210 215 220
Gly Ala Ser Tyr Val Phe
225 230
<210> 13
<211> 262
<212> PRT
<213> Bacillus cereus
<400> 13
Met Gly Tyr Ser Asp Leu Glu Gly Lys Val Val Val Ile Thr Gly Ser
1 5 10 15
Ala Thr Gly Leu Gly Arg Ala Met Gly Val Arg Phe Ala Lys Glu Lys
20 25 30
Ala Lys Val Val Ile Asn Tyr Arg Ser Arg Asp Ser Glu Ala Asn Asp
35 40 45
Val Leu Glu Glu Ile Lys Lys Val Gly Gly Glu Ala Ile Ala Val Lys
50 55 60
Gly Asp Val Thr Val Glu Ala Asp Val Met Asn Leu Ile Gln Ser Ala
65 70 75 80
Val Lys Glu Phe Gly Thr Leu Asp Val Met Ile Asn Asn Ala Gly Ile
85 90 95
Glu Asn Ala Val Pro Ser His Glu Met Pro Leu Glu Asp Trp Asn Lys
100 105 110
Val Ile Asn Thr Asn Leu Thr Gly Ala Phe Leu Gly Ser Arg Glu Ala
115 120 125
Ile Lys Tyr Phe Val Glu His Asp Ile Lys Gly Ser Val Ile Asn Met
130 135 140
Ser Ser Val His Glu Lys Ile Pro Trp Pro Leu Phe Val His Tyr Ala
145 150 155 160
Ala Ser Lys Gly Gly Ile Lys Leu Met Thr Glu Thr Leu Ala Leu Glu
165 170 175
Tyr Ala Pro Lys Gly Ile Arg Val Asn Asn Ile Gly Pro Gly Ala Ile
180 185 190
Asn Thr Pro Ile Asn Ala Glu Lys Phe Ala Asp Pro Lys Gln Arg Ala
195 200 205
Asp Val Glu Ser Met Ile Pro Met Gly Tyr Ile Gly Lys Pro Glu Glu
210 215 220
Ile Ala Ala Val Ala Thr Trp Leu Ala Ser Ser Glu Ala Ser Tyr Val
225 230 235 240
Thr Gly Ile Thr Leu Phe Ala Asp Gly Gly Met Thr Leu Tyr Pro Ser
245 250 255
Phe Gln Ala Gly Arg Gly
260
<210> 14
<211> 294
<212> PRT
<213> yaaD of Bacillus subtilis
<400> 14
Met Ala Gln Thr Gly Thr Glu Arg Val Lys Arg Gly Met Ala Glu Met
1 5 10 15
Gln Lys Gly Gly Val Ile Met Asp Val Ile Asn Ala Glu Gln Ala Lys
20 25 30
Ile Ala Glu Glu Ala Gly Ala Val Ala Val Met Ala Leu Glu Arg Val
35 40 45
Pro Ala Asp Ile Arg Ala Ala Gly Gly Val Ala Arg Met Ala Asp Pro
50 55 60
Thr Ile Val Glu Glu Val Met Asn Ala Val Ser Ile Pro Val Met Ala
65 70 75 80
Lys Ala Arg Ile Gly His Ile Val Glu Ala Arg Val Leu Glu Ala Met
85 90 95
Gly Val Asp Tyr Ile Asp Glu Ser Glu Val Leu Thr Pro Ala Asp Glu
100 105 110
Glu Phe His Leu Asn Lys Asn Glu Tyr Thr Val Pro Phe Val Cys Gly
115 120 125
Cys Arg Asp Leu Gly Glu Ala Thr Arg Arg Ile Ala Glu Gly Ala Ser
130 135 140
Met Leu Arg Thr Lys Gly Glu Pro Gly Thr Gly Asn Ile Val Glu Ala
145 150 155 160
Val Arg His Met Arg Lys Val Asn Ala Gln Val Arg Lys Val Val Ala
165 170 175
Met Ser Glu Asp Glu Leu Met Thr Glu Ala Lys Asn Leu Gly Ala Pro
180 185 190
Tyr Glu Leu Leu Leu Gln Ile Lys Lys Asp Gly Lys Leu Pro Val Val
195 200 205
Asn Phe Ala Ala Gly Gly Val Ala Thr Pro Ala Asp Ala Ala Leu Met
210 215 220
Met Gln Leu Gly Ala Asp Gly Val Phe Val Gly Ser Gly Ile Phe Lys
225 230 235 240
Ser Asp Asn Pro Ala Lys Phe Ala Lys Ala Ile Val Glu Ala Thr Thr
245 250 255
His Phe Thr Asp Tyr Lys Leu Ile Ala Glu Leu Ser Lys Glu Leu Gly
260 265 270
Thr Ala Met Lys Gly Ile Glu Ile Ser Asn Leu Leu Pro Glu Gln Arg
275 280 285
Met Gln Glu Arg Gly Trp
290
<210> 15
<211> 196
<212> PRT
<213> yaaE of Bacillus subtilis
<400> 15
Met Leu Thr Ile Gly Val Leu Gly Leu Gln Gly Ala Val Arg Glu His
1 5 10 15
Ile His Ala Ile Glu Ala Cys Gly Ala Ala Gly Leu Val Val Lys Arg
20 25 30
Pro Glu Gln Leu Asn Glu Val Asp Gly Leu Ile Leu Pro Gly Gly Glu
35 40 45
Ser Thr Thr Met Arg Arg Leu Ile Asp Thr Tyr Gln Phe Met Glu Pro
50 55 60
Leu Arg Glu Phe Ala Ala Gln Gly Lys Pro Met Phe Gly Thr Cys Ala
65 70 75 80
Gly Leu Ile Ile Leu Ala Lys Glu Ile Ala Gly Ser Asp Asn Pro His
85 90 95
Leu Gly Leu Leu Asn Val Val Val Glu Arg Asn Ser Phe Gly Arg Gln
100 105 110
Val Asp Ser Phe Glu Ala Asp Leu Thr Ile Lys Gly Leu Asp Glu Pro
115 120 125
Phe Thr Gly Val Phe Ile Arg Ala Pro His Ile Leu Glu Ala Gly Glu
130 135 140
Asn Val Glu Val Leu Ser Glu His Asn Gly Arg Ile Val Ala Ala Lys
145 150 155 160
Gln Gly Gln Phe Leu Gly Cys Ser Phe His Pro Glu Leu Thr Glu Asp
165 170 175
His Arg Val Thr Gln Leu Phe Val Glu Met Val Glu Glu Tyr Lys Gln
180 185 190
Lys Ala Leu Val
195
<210> 16
<211> 62
<212> DNA
<213> Artificial Sequence
<400> 16
cctctagaaa taattttgtt taactttaac aggaggaacg gcatgccgac tttaccgcgt 60
ac 62
<210> 17
<211> 49
<212> DNA
<213> Artificial Sequence
<400> 17
gctgccgccg ctgccgccgc tgccgccgct attcggggtc agtttcacc 49
<210> 18
<211> 62
<212> DNA
<213> Artificial Sequence
<400> 18
cctctagaaa taattttgtt taactttaac aggaggaacg gcatgccgac tttaccgcgt 60
ac 62
<210> 19
<211> 43
<212> DNA
<213> Artificial Sequence
<400> 19
tatatatctc cttagaattc ttacccagcc cacacgtctt ttg 43
<210> 20
<211> 43
<212> DNA
<213> Artificial Sequence
<400> 20
gaattctaag gagatatata atgggttaca gcgatctgga agg 43
<210> 21
<211> 32
<212> DNA
<213> Artificial Sequence
<400> 21
actgctcgag ttaaccacga ccggcctgga ag 32
<210> 22
<211> 31
<212> DNA
<213> Artificial Sequence
<400> 22
cgtcggtacc atggcaagct ggagccatcc g 31
<210> 23
<211> 31
<212> DNA
<213> Artificial Sequence
<400> 23
cagactcgag ttatttatct tccagggtca g 31
<210> 24
<211> 34
<212> DNA
<213> Artificial Sequence
<400> 24
gccaggatcc gatgcaaaaa caacgcacca cctc 34
<210> 25
<211> 29
<212> DNA
<213> Artificial Sequence
<400> 25
gatcgaattc ttacgccagg ccacgagct 29
<210> 26
<211> 34
<212> DNA
<213> Artificial Sequence
<400> 26
gccaggatcc gatgcaaaaa caacgcacca cctc 34
<210> 27
<211> 41
<212> DNA
<213> Artificial Sequence
<400> 27
aagcattatg cggccgctta agcacccgcc acagatgatt c 41

Claims (2)

1. A genetically engineered bacterium, characterized by the name: escherichia coli BL21(DE 3): P1-1-CGCAB with the preservation number of CCTCC NO: m2019571.
2. An application of a genetically engineered bacterium in producing nylon 12 monomer 12-aminolauric acid is characterized in that the name is as follows: escherichia coli BL21(DE 3): P1-1-CGCAB with the preservation number of CCTCC NO: m2019571;
the process for producing 12-aminolauric acid by converting lauric acid through the recombinant strain P1-1-CGCAB is as follows:
inoculating the recombinant strain P1-1-CGCAB to a TB culture medium at 22-26 ℃, inducing by using an inducer, adding an accelerant and a nutritional additive during induction, and harvesting after inducing for 11-14 hours; preparing bacterial mud by using a reaction buffer solution with the pH value of 7.0-8.5, adding lauric acid, reacting at 25-35 ℃, adding acetonitrile after 8 hours of reaction, centrifuging and taking supernatant to obtain 12-aminolauric acid.
CN201910749344.5A 2019-08-14 2019-08-14 Genetically engineered bacterium, construction method thereof and application thereof in production of nylon 12 monomer 12-aminolauric acid Active CN110643555B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910749344.5A CN110643555B (en) 2019-08-14 2019-08-14 Genetically engineered bacterium, construction method thereof and application thereof in production of nylon 12 monomer 12-aminolauric acid

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910749344.5A CN110643555B (en) 2019-08-14 2019-08-14 Genetically engineered bacterium, construction method thereof and application thereof in production of nylon 12 monomer 12-aminolauric acid

Publications (2)

Publication Number Publication Date
CN110643555A CN110643555A (en) 2020-01-03
CN110643555B true CN110643555B (en) 2021-07-23

Family

ID=69009515

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910749344.5A Active CN110643555B (en) 2019-08-14 2019-08-14 Genetically engineered bacterium, construction method thereof and application thereof in production of nylon 12 monomer 12-aminolauric acid

Country Status (1)

Country Link
CN (1) CN110643555B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114891707B (en) * 2022-05-20 2024-04-05 中国科学院微生物研究所 Recombinant strain and method for producing bilirubin by whole cell catalysis thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108531494A (en) * 2018-03-09 2018-09-14 南京工业大学 A method of preparing -54 precursor of biology base nylon using genetic engineering bacterium common fermentation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108531494A (en) * 2018-03-09 2018-09-14 南京工业大学 A method of preparing -54 precursor of biology base nylon using genetic engineering bacterium common fermentation

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Biosynthesis of the nylon 12 monomer,ω-aminododecanoic acid with novel CYP153A,ALKJ,andω-TA enzymes;Md Murshidul Ahsan et al.;《Biotechnol J》;20180430;第13卷(第4期);摘要 *
Metabolic engineering toward sustainable production of nylon-6;Stefan C H J Turk et al.;《ACS Synth Biol》;20160115;第5卷(第1期);第65-73页 *
尼龙6/抗菌蛭石复合材料的制备及性能研究;何素芹等;《高分子学报》;20110331;第287-293页 *

Also Published As

Publication number Publication date
CN110643555A (en) 2020-01-03

Similar Documents

Publication Publication Date Title
CN107586752B (en) Engineering bacterium and application thereof
Nguyen et al. Metabolic engineering of type II methanotroph, Methylosinus trichosporium OB3b, for production of 3-hydroxypropionic acid from methane via a malonyl-CoA reductase-dependent pathway
Zhang et al. Bioconversion of methanol into value-added chemicals in native and synthetic methylotrophs
CN107686850B (en) Method for producing alpha-ketoglutaric acid by converting co-expression recombinant strain
US8637283B2 (en) Production of hydrocarbons in microorganisms
CN111647616B (en) Construction method and application of escherichia coli engineering bacteria for producing protocatechuic acid
Bäumchen et al. D‐mannitol production by resting state whole cell biotransformation of D‐fructose by heterologous mannitol and formate dehydrogenase gene expression in Bacillus megaterium
Rohles et al. Systems metabolic engineering of Corynebacterium glutamicum eliminates all by-products for selective and high-yield production of the platform chemical 5-aminovalerate
CN110643555B (en) Genetically engineered bacterium, construction method thereof and application thereof in production of nylon 12 monomer 12-aminolauric acid
Pham et al. Outlook on engineering methylotrophs for one-carbon-based industrial biotechnology
CN112831488B (en) Glutamic acid decarboxylase and gamma-aminobutyric acid high-yield strain
CN112442518B (en) Method for producing spermidine by using cheap substrate and engineering bacteria
Zheng et al. Efficient acetoin production from pyruvate by engineered Halomonas bluephagenesis whole-cell biocatalysis
CN114107356B (en) Method for transforming pseudomonas putida to assimilate D-galactose
CN113025544A (en) Method for synthesizing L-phenyllactic acid by utilizing recombinant microorganism whole cell catalysis
KR101028039B1 (en) Microorganism Enhanced Resistance of Succinic Acid and Method for Preparing Succinic Acid Using the Same
KR102616750B1 (en) Genetically modified bacteria and their application in sweet potato production
CN111996220B (en) Method for synthesizing spermidine by biological method
CN112111536A (en) Method for producing spermidine by taking amino acid as substrate and engineering bacteria
CN110684811B (en) Method for improving methionine yield
CN114958703B (en) Recombinant bacterium for synthesizing succinic acid by utilizing grease, construction method and application thereof
CN113025546B (en) Method for producing tyrosol by converting L-tyrosine through multienzyme cascade
CN113493760B (en) Corynebacterium glutamicum for biosynthesis of 2-phenethyl alcohol, construction method and application
CN108949646B (en) Engineering bacterium capable of co-producing tanshinol and alanine and application thereof
CN117778481A (en) Method for producing beta-hydroxy-beta-methylbutyric acid by whole cell catalysis

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant