CN110627911A - Envelope protein trimer immunogen capable of inducing HIV-1 broad-spectrum neutralizing antibody and application thereof - Google Patents

Abstract

The invention relates to the field of biomedicine, and relates to envelope protein trimer immunogen capable of inducing HIV-1 broad-spectrum neutralizing antibody and application thereof. In particular to an envelope protein Env common gene sequence designed based on HIV-1 Chinese epidemic strain and a stable envelope protein gp120 tripolymer immunogen obtained based on the sequence. The invention further relates to application of the HIV-1 envelope protein gp120 trimer immunogen in preparation of AIDS vaccines.

Description

Envelope protein trimer immunogen capable of inducing HIV-1 broad-spectrum neutralizing antibody and application thereof

Technical Field

The invention relates to the field of biomedicine, and relates to envelope protein gp120 trimer immunogen capable of inducing and generating broad-spectrum neutralizing antibody aiming at HIV-1 epidemic strains in the world. In particular to an envelope protein Env common gene sequence designed based on HIV-1 Chinese epidemic strain and a stable envelope protein gp120 tripolymer immunogen obtained based on the sequence. The invention further relates to application of the HIV-1 envelope protein gp120 trimer immunogen in preparation of AIDS vaccines.

Background

Acquired immunodeficiency syndrome (AIDS), a major infectious disease caused by the transmission of Human Immunodeficiency Virus (HIV), is one of the 2019 major global health threats published by the world health organization [1 ]. The situation of AIDS in China is also severe, and the number of infected people is continuously increased. By 2018, HIV virus carriers and AIDS patients with confirmed diagnosis in China are about 125 thousands, the epidemic situation distribution area is gradually enlarged, and sexual transmission instead of blood transfusion and intravenous virus inhalation is the main transmission mode [2 ].

At present, high-efficiency anti-retroviral therapy (HAART) is generally adopted clinically, namely cocktail therapy is adopted to treat AIDS, certain side effects are inevitable while the viral load in a patient is controlled, and meanwhile, the existence of drug resistance also brings great challenges to the prevention and treatment of HIV, so that the development of a vaccine capable of effectively preventing HIV is in force [3 ]. However, since HIV was first identified as a causative agent of AIDS in 1981, researchers have been constantly searching for over 30 years and have not yet designed effective vaccines.

The major challenges in the development of HIV vaccines are firstly that HIV has high variability and complexity in its genetic material compared to other viruses, and during viral replication, its genome generates a large number of mutations, and gene recombination occurs under the action of reverse transcriptase, resulting in a large number of variant strains, and these mutations and recombination result in altered antigenicity of HIV virus or enhanced virulence of virus, which in turn makes the developed vaccine difficult to defend against all mutant strains [4 ]. Secondly, the envelope protein (Env) of HIV is a structurally complex glycoprotein, with a large number of sugar groups on the surface that block Env neutralizing epitopes, making efficient viral clearance difficult for antibodies [5 ]. In the vaccine design process, these conformational neutralizing epitopes are important targets for vaccine development, in order to induce the generation of neutralizing antibodies with virus neutralizing capacity, especially broad-spectrum neutralizing antibodies against most HIV type 1 (HIV-1) strains [6 ]. At present, a plurality of bnAbs with higher neutralization breadth against the Env conserved epitope of the envelope protein of HIV-1 have been isolated from infected subjects. For example, Wu et al [7] utilized the HIV recombinant gp120 antigen RSC3 to screen CD4 binding site (CD4-binding site, CD4bs) monoclonal antibody VRC01 against gp120 from HIV-1 infected subjects by single B cell sorting technique, with a broad spectrum neutralization capacity of up to 91%. Some other bnAbs of greater interest also include: CH103, PG9, PGT135, 8ANC195, 10E, etc. [8 ]. However, due to the diversity of Env sequences of the viral envelope proteins, the low degree of bnAb epitope exposure, and the unique genetic requirement to reduce the frequency of encoded bnAb precursors, no vaccine exists that can induce the organism to produce such bnAb against multiple HIV-1tier-2 strains.

In order to induce broadly neutralizing antibodies, researchers have tried various approaches to obtain suitable immunogens. Studies of the mechanism of bnAb production in HIV-1 infected individuals have found that bnAb is produced and matured by co-evolution with the virus in vivo [9 ]. This indicates that designing immunogens with only a single viral sequence is very difficult to induce bnAb, and designing multiple immunogens is a relatively feasible vaccine design strategy, according to a certain route of bnAb evolution. However, due to the complexity of the bnAb evolutionary mechanism, this strategy is still lacking in a mature protocol and sufficient experimental evidence. Yet another strategy is to arrange HIV-1 gene sequences of different subtypes together for gene sequence alignment, then select the base that occurs most frequently at each position, and the resulting sequence is called the consensus gene sequence (consensus). The common gene typically differs from all gene sequences being analyzed by about half the degree of genetic variation between different sequences, and is therefore in the middle of the tree with minor differences from all sequences [10 ]. Experimental studies have shown that antigens designed using the consensus gene sequence (CON-S) designed from the group M viral envelope protein genes of HIV-1 induce a broader and similar or stronger immune response against HIV-1 circulating strains of different subtypes than any single subtype wild-type Env antigen [11,12 ].

On the other hand, the generation of HIV-1 broad-spectrum neutralizing antibodies has a direct link to the structure of antigenic proteins. It is presently believed that Env trimers with their native conformation are more advantageous in inducing broadly neutralizing antibodies. Therefore, researchers have designed a series of more stable Env trimers by modifying and optimizing the structure of the antigen protein. The most representative of this group of studies is the design of SOSIP.664 gp140 [13 ]. This design linked gp120 and gp41 together with a disulfide bond and mutated isoleucine at position 559 to proline, resulting in a stable Env trimer in the prefusion state. In contrast, another strategy is to link gp120 and gp41 together via a long linker (linker) to give the Env trimer [14 ]. Based on SOSIP.664 gp120, the Scripps institute designed BG505UFO trimer, and the trimer protein had better stability [15 ]. The neutralizing antibody epitopes on the surface of these trimers are better presented, while the immunodominant, non-neutralizing epitopes are mostly blocked, making it possible for these near-native conformation trimers as antigens to induce broad-spectrum neutralizing antibodies.

Combining the above analysis, we designed a highly conserved Env common gene sequence 718B. Env. con based on about 500 virus sequences of the four subtypes CRF07_ BC (35.5%), CRF01_ AE (27.6%), CRF08_ BC (20.1%) and Subtype B (9.6%) which are most prevalent in china through virus evolution analysis and gene alignment on the basis of earlier research on the mechanism of HIV-1 bnAb generation in human body. Then, a novel gp120 tripolymer (PCM) immunogen with a more stable structure is obtained by utilizing the fusion expression of a trimerization module MTQ and a stable sequence Protan with a gp120 sequence in 718B. The immunogen is mixed with AS03 adjuvant and then the guinea pig is immunized, and the result shows that: the immune guinea pig serum has very broad-spectrum neutralization activity against HIV-1, can neutralize a plurality of HIV-1tier-2 pseudoviruses (global standard virus strains), and is remarkably superior to all HIV-1 envelope protein vaccine immunogens reported at present.

Disclosure of Invention

The invention provides a novel gp120 tripolymer immunogen which is characterized by being capable of inducing and generating broad-spectrum neutralizing antibodies aiming at different HIV-1 epidemic strains in an animal body. The invention is realized based on the design of HIV-1 envelope protein Env common gene sequence and the stable gp120 tripolymer protein obtained on the basis. The invention provides a novel HIV-1 vaccine immunogen which is designed according to main dominant strains of HIV-1 widely prevalent in China and through a common gene sequence. Compared with other immunogens aiming at inducing HIV-1 broad-spectrum neutralizing antibodies internationally, the immunogen provided by the invention has the advantages of both sequence and structure, has the capability of singly immunizing and inducing organisms to generate broad-spectrum neutralizing activity, and obtains better immune results in guinea pigs.

Another purpose of the invention is to provide a consensus gene sequence of the HIV-1 envelope protein Env. The invention selects a large number of virus strain gene sequences from 4 HIV-1 Chinese main epidemic subtypes (CRF07_ BC, CRF01_ AE, CRF08_ BC and subtype B), utilizes computer technology to analyze and compare, and designs to obtain envelope glycoprotein Env common gene sequence 718 B.env.con. The sequence is in the middle of the HIV-1 evolutionary tree and has high conservation and homology with other sequences. The nucleic acid sequence of the Env consensus gene sequence 718B.env.con is SEQ ID NO. 1, and the amino acid sequence is SEQ ID NO. 2. To achieve high-level expression, 718b.env.con was codon optimized based on codons for high-level expression of human genes, and the optimized 718b.env.con nucleic acid sequence was SEQ ID No. 3.

The invention provides a more stable gp120 trimer protein obtained based on the consensus gene sequence 718 B.env.con. The invention selects an optimized gp120 region of 718B.env.con gene sequence, and the N end and the C end of the optimized gp120 region are respectively fused with Protan and MTQ trimerization module sequences to design a novel gp120 trimerization protein Protan-gp120con-MTQ (PCM). The protein is dominant in a trimer form (> 95%) after expression in a 293-6E eukaryotic expression system. Compared with the trimer proteins such as BG505UFO and the like reported in the current literature, the trimer proportion after PCM expression has obvious advantages, and the PCM is a more stable gp120 trimer. The nucleic acid sequence of the trimeric protein PCM is SEQ ID NO. 4, and the amino acid sequence is SEQ ID NO. 5.

The invention also provides the application of the gp120 tripolymer immunogen in preparing AIDS vaccine. The invention uses PCM tripolymer AS antigen and AS03 AS adjuvant, and immune experiment is carried out on guinea pig model. The results show that PCM trimer is able to induce broad-spectrum neutralizing antibodies against HIV-1Tier-2 pseudovirus in guinea pigs and that its broad-spectrum is significantly better than the control trimer proteins (PAM, CM) and the currently considered optimal immunogen BG505 UFO.

Drawings

FIG. 1 shows the design principle of four subtype common gene sequences. The Chinese main epidemic subtypes (CRF07_ BC, CRF01_ AE, CRF08_ BC, subtype B) total the Env gene sequences of 488 virus strains, each sequence is from one HIV-1 infected person. The common gene sequence of each subtype is determined as the percentage threshold of different bases at each position.

Figure 2.718b. env. con gene sequence aligned with each subtype consensus gene sequence. On the basis of four subtype common gene sequences, an Env common gene sequence 718B.env.con is further determined by gene sequence alignment. The black mark is the position where the leading nucleotide cannot be directly determined, and the final nucleotide is corrected for the nucleotide at this position by CRF07_ BC.

Figure 3.718b. env. con amino acid sequence alignment with respective subtype consensus gene sequences. The black mark indicates the position where the leading amino acid cannot be directly identified, and the final amino acid is corrected for the amino acid that occurs the most frequently at this position or at this position by CRF07_ BC.

FIG. 4 shows a schematic diagram of the design of a trimer of stable envelope proteins. Selecting a gp120 part of 718B.con Env gene sequence, fusing a trimerization model MTQ sequence at the C terminal of the gp120 part, fusing a protein Protan (Protan-gp120 con-MTQ; PCM) at the N terminal of the gp120 part to further increase the stability of the trimer and the proportion in a final product, and replacing the inherent signal peptide sequence of the Env gene with a secretory signal peptide tPA to increase the expression quantity of the gp120 trimer protein. As a control, the Env gene of a CRF01_ AE subtype founder virus strain (BJOX015) is selected to construct gp120 trimer Protan-gp120AE-MTQ (PAM) and gp120con-MTQ (CM) of which the N terminal is not fused with Protan.

FIG. 5 PCM protein expression and purification. After the envelope protein trimer is purified by lentil lectin, BG505UFO, CM, PAM and PCM trimer proteins with high purity are obtained by separation through superdex 200 size exclusion chromatography, and the size and the structure of the trimer proteins are identified through non-denaturing electrophoresis.

Figure 6 guinea pig immunization strategy and grouping scheme. Bound and neutralizing antibody titers were detected by four immunizations by subcutaneous injection at weeks 0, 4, 8, and 12, respectively, and by taking blood before the first immunization and two weeks after each immunization.

FIG. 7 detection of serum IgG levels in guinea pigs.

Figure 8 guinea pig serum neutralizing antibody detection. Neutralizing activity of guinea pig sera tested after the fourth immunization against 10 HIV-1tier-2 pseudoviruses, and MLV (Murine Leukemia Virus, rat Leukemia Virus) envelope pseudovirus as a negative control. The intensity of the neutralizing activity is represented by ID50 value.

Detailed Description

Example 1 Env consensus Gene sequence design

1. Obtaining aligned sequences (each from an infected person) from the HIV sequence database (HIV sequence database)

2. Deletion of identical sequences

3. Deletion of sequences having more than 10 ambiguous bases

4. Preparation of optimized sequence alignments Using Seaview software Manual adjustments

5. The dominant nucleotide (> 50%) for each site was determined using an online tool with a 50% threshold. If some sites are not able to determine the dominant nucleotide (both 50% or the highest dominant nucleotide < 50%), the percentage of the threshold is decreased to obtain a clear dominant nucleotide (http:// www.hiv.lanl.gov/content/sequence/CONSENSUS/AdvCon. html).

6. The final consensus gene sequence was obtained by manual adjustment according to the following rules:

a. the main rules are as follows: most of the nucleotides in the four CRF/subtypes were selected as common gene sequences. CRF07_ BC (35.5%), CRF01_ AE (27.6%), CRF08_ BC (20.1%) and Subtype B (9.6%). (reference: He X, Xing H, Ruan Y, et al. A comprehensive mapping of HIV-1genotypes in the variant groups and regions across China base on a national molecular biology yield. PLoS One, 2012,7(10): e47289)

b. Amino acid priority rules: if a site occurs half to half as a percentage, the amino acid at that site is selected to occur the most frequently or the amino acid at that site for CRF07_ BC.

Example 2 antigenic protein expression vector construction

The expression vector used in this scheme is pTT5 plasmid. Gp120con was amplified by PCR using the 718B.con Env gene sequence as a template. Meanwhile, fragments of gp120AE, tPA, Protan and MTQ are amplified by respectively taking a laboratory preservation plasmid as a template, and homologous recombination and connection are carried out by utilizing a homologous recombination kit to obtain antigen protein expression vectors such as pTT5-tPA-Protan-gp120con-MTQ, pTT5-tPA-Protan-gp120AE-MTQ, pTT5-tPA-gp120con-MTQ and the like.

(1) Designing a primer:

tPA-F:CTGGCTAGCGTTTAAACTTAAGCTTGCCACCATGGATGCAATGAAGAGA

tPA-R:GCGGGTTTAAACGGGCCCTCTAGACTCGAGGGTACCGCTGGGCGAAACGAAGAC

Protan-F：CACTGGGCATCGCCCCAACTGGATCCGGTGGTGGT

Protan-R：GTTTAAACGGGCCCTCTAGACTCGAGTTATTTAATACGCA

gp120-F:AGTTTAAACGGATCTCTAGCGAATTCGCCACCATGGATGCAATGAAGAG

gp120-R:AGCCAGAGGTCGAGGTCGGGCTCGAGTTAAGTTGGGGCGATGCCCA

MTQ-F:TCGTTTCGCCCAGCGGTACC TCCAACAATCTGTGGGTCA

MTQ-R:GAACCACCACCACCGGATCC GCAACAACCCCCAGCAAT

(2) PCR (polymerase chain reaction)

Accurately adding the following components into a50 mu L Eppendorf PCR tube and uniformly mixing

Reaction conditions are as follows: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 60 deg.C for 30s, extension at 72 deg.C for 1min, three steps of denaturation, annealing and extension for 30 cycles, re-extension at 72 deg.C for 10min, and storage at 4 deg.C. And identifying the PCR result by agarose gel electrophoresis.

(3) Recombination ligation

Using a homologous recombination kit, and operating according to the following system;

DNA fragment and linearized vector 0.5. mu.L

2×SeamLess Master Mix 5μL

ddH₂O 4.5μL

The molar ratio of the DNA fragment to the vector is 1:5

Reacting at 50 deg.C for 15min, standing at 4 deg.C, and storing at-20 deg.C if it is not used.

(4) Plasmid transformation and amplification

1. mu.L of the homologous recombination ligation product was added to freshly thawed DH10B competent cells, mixed well and ice-cooled.

2. Heating in 42 deg.C water bath for 90s, and standing in ice bath for 2min

3. 500. mu.L of LB liquid medium containing no antibiotics was added to a 1.5ml LEP tube and cultured in a shaker at 37 ℃ and 180rpm/min for 45-60 min.

4. After recovery, centrifugal resuspension is carried out, 200 mu L of bacterial liquid is sucked and coated on an LB solid medium plate containing ampicillin resistance, the bacterial liquid is uniformly coated until the bacterial liquid is coated with obstruction, and the bacterial liquid is inversely cultured in a constant-temperature incubator at 37 ℃.

5. Single colonies were picked to a cuvette containing 5mL of LB liquid medium containing ampicillin, and the plasmid library was subsequently characterized after overnight incubation at 37 ℃ and 220rpm/min in a shaker.

6. Plasmid extraction was performed according to the rapid plasmid miniprep kit.

(5) Plasmid major grape

And (4) carrying out plasmid extraction according to the operation guide of the plasmid macroextraction kit. Taking 1 mul plasmid to be used for agarose gel electrophoresis detection directly, and carrying out restriction enzyme digestion or sequencing identification at the same time.

Example 3 antigenic protein expression purification

The plasmid was transiently transfected into 293-6E suspension cells and cell culture supernatants were harvested 72 hours later. Affinity chromatography is carried out by lentil lectin, volume exclusion chromatography is carried out by superdex 200 to obtain BG505UFO, CM, PAM and PCM tripolymer protein, and then the property identification is carried out by protein electrophoresis. The method comprises the following specific steps:

(1) transient transfection of 293-6E

1. After cell recovery, the cell is transferred to more than three generations, and the cell state is good, so that transfection can be carried out.

2. Cells were counted prior to transfection to ensure cell density at 1.5xl0⁶ cells/mL。

3. Preparing a DNA/PEI complex, wherein the DNA: PEI 1:3, final DNA concentration 1.25. mu.g/1X 10⁶cells were added to the new medium, DNA and PEI (1. mu.g/. mu.L) were added to 2mL of the medium, and after 5 minutes of incubation, the medium containing PEI was added to the medium containing DNA in a final volume of 4mL and allowed to stand at room temperature for 15 minutes.

4. The transfection system was slowly added dropwise to the cells while shaking.

5. From 1 day of culture, samples were taken daily to check for cell viability, with a survival rate of > 95% being guaranteed.

Cell culture supernatants were harvested after 6.72 hours for protein purification.

(2) Affinity chromatography purification of hyacinth bean agglutinin

1. The harvested cell supernatant was centrifuged at 1000g for 2 hours to remove the cells. The supernatant was harvested and centrifuged at 8000g for a further 10 minutes to remove cell debris. The supernatant was harvested and filtered through a 0.45 μm filter.

2.1 XPBS was prepared and filtered through a 0.45 μm filter.

3. The column was washed with purified water and then PBS, the lentil lectin column was connected to the machine, the remaining 20% ethanol was washed, and 4 column volumes of 1 x PBS equilibration column were added.

4. After equilibration, 0.5mL/min of sample was added (adjusted for total solution volume and time.)

5. After the loading is finished, 4 column volumes of PBS are added to wash the impure proteins, and the flow rate can be properly accelerated.

6. The protein of interest was eluted with 40mL of 10% mannose PBS at a flow rate of 1 mL/min.

7. Mannose was removed with 40mL of PBS containing 0.1% Triton (prepared in advance, dissolved in a50 ℃ water bath), and the column was regenerated with an appropriate flow rate increase of 5 mL/min.

8. Finally, the column is sealed by 20 percent ethanol, and the filled chromatographic column is stored at 4 ℃.

(3) Protein concentration

1. Using a 100kD ultrafilter tube, a tabletop centrifuge at 12000rpm was used until the protein solution volume reached about 1mL, and after each centrifugation, the Nano was measured to ensure that the protein concentration was below 5mg/mL to prevent protein precipitation.

2. PBS filtered through a 0.22 μm filter was added and rinsed 3-4 times at 12000rpm for 5 min.

3. Finally, the protein solution is ultrafiltered and concentrated to about 1mL, and is added into a 1.5mL centrifuge tube for preservation at the temperature of minus 80 ℃.

(4) Molecular sieve purification

1. Superdex 200 molecular sieves were attached to the machine correctly and the column was washed of ethanol using PBS filtered through a 0.22 μm filter at a flow rate of 0.5 mL/min.

2. The column was equilibrated for 3 hours with PBS filtered through a 0.22 μm filter at a flow rate of 0.5 mL/min.

3. The needle of the sample loading needle is filled with PBS, and then 500 mu L of sample is sucked for loading.

4. The samples were collected using an automated collection device.

5. The column was washed with NaOH using a 0.22 μm filter for 3 hours at 0.3 mL/min. PBS filtered through 0.22 μm filter was washed for 5 column volumes and the column was blocked with ethanol filtered through 0.22 μm filter.

6. The instrument was turned off.

(5) Non-denaturing electrophoresis

1. Sample preparation: 3 μ L of protein sample and 2.5 μ L of Native PAGE sample buffer were pipetted into a 1.5ml EP tube, 1 μ L of 5% G-250 was added, and the volume of deionized water was adjusted to 10 μ L.

2. Preparing an electrophoresis buffer solution: a. anode buffer solution: 50ml Native PAGE TM running buffer was added to 950ml deionized water to 1L.b. cathode buffer: 50ml Native PAGE TM running buffer and 50ml Native PAGE TM cathode additive were added to 900ml deionized water to make 1L volume.

3. Gel preparation: a. pulling off the comb, washing the glue hole 3 times by using cathode buffer solution, b, taking off white glue at the bottom of the glue plate, c, putting the glue into an electrophoresis tank, d, filling the glue hole with the cathode buffer solution.

4. Loading: and adding a sample to be detected and a standard Marker to the sample loading hole.

5. Adding a buffer solution: 200ml of cathode buffer was added to the cathode buffer chamber and 500ml of anode buffer was added to the cathode buffer chamber.

6. Electrophoresis: and connecting a power supply, adjusting the voltage to 150V, and carrying out electrophoresis for 120 minutes.

Example 4 SPF grade guinea pig immunization experiments

(1) Immunization and detection procedures

1. 20 guinea pigs were randomly divided into 5 groups of 4, each immunized against the trimeric antigen. The immunization dose was 30. mu.g of antigenic protein per guinea pig. All animals were immunized subcutaneously.

2. Immunization was performed a total of 4 times, 4 weeks apart. Blood was collected 14 days after each immunization.

3. The blood collection adopts a mode of heart blood collection, and each guinea pig collects 1mL of blood each time.

4. Serum treatment: the gel is firstly kept at 37 ℃ for accelerating coagulation for 1 hour, and then is kept at 4 ℃ for 1 hour, thus being beneficial to the precipitation of serum. Centrifuge at 3000rpm for 30 minutes and carefully aspirate the supernatant serum into a new EP tube, avoiding aspiration of blood cells. After serum labeling, subpackaging and storing at-80 ℃.

ELISA to detect serum binding antibody titers as well as serum sample IgG titers.

6. Neutralization test detects the intensity and broad spectrum of the serum neutralizing antibody.

(2) ELISA step:

1. coating: the PCM was diluted to a concentration of 1 ng/. mu.L with coating solution, 100. mu.L per well, and coated overnight at 4 ℃.

2. Washing: add 200. mu.L PBST per well and wash 5 times for 3 minutes each.

3. And (3) sealing: add 200. mu.L of blocking solution to each well and block overnight at 4 ℃.

4. Adding serum: after 5 washes, 100. mu.L of serum (5-fold serial dilutions) was added to each well and incubated for 2 hours at 37 ℃.

5. Adding a secondary antibody: after 5 washes, 100. mu.L of HRP-conjugated rabbit anti-guinea pig IgG secondary antibody (1:20000 dilution) was added to each well and incubated at 37 ℃ for 2 hours.

6. Color development: after washing for 5 times, adding 100 mu L of TMB into each hole for developing for 6 minutes, adding 50 mu L of stop solution into each hole to stop the reaction, and reading the absorbance at 450nm by using an enzyme-labeling instrument.

(3) Virus neutralization assay procedure:

1. inactivation of serum: the test serum was inactivated in a 56 ℃ water bath for 60 minutes and centrifuged at 12000rpm for 1 minute.

2. Adding serum: virus control and cell control were set, serum was diluted in a gradient (3-fold serial dilution), and serum was added at 7.5 μ L per well.

3. Adding poison: pseudovirus was diluted to 4000TCID50/mL (diluted by dilution factor as provided) in DMEM complete medium and 50. mu.L was added to each well except for cell controls to make 200TCID50 pseudovirus per well.

4. And (3) incubation: the above 96-well plate was incubated in a cell incubator (37 ℃ C., 5% CO2) for 1 hour.

5. Adding cells: when the incubation time is half an hour, taking out the TZM-bl cells prepared in advance in the incubator, adding 2.5mL of 0.25% pancreatin-EDTA to immerse the cells for digesting for 45s, removing the pancreatin, placing the cells in the cell incubator for standing for 2 minutes, adding 10mLDMEM medium to neutralize the pancreatin after the cells are exfoliated, blowing and uniformly mixing, counting the cells, and diluting the cells to 1 to 10 by using a DMEM complete medium⁵DEAE-dextran (DEAE final concentration in cell suspension 37.5ug/mL) was added. Add 100. mu.L 1. about.10 per well to 96-well plates⁵Cells per mL, 10 cells per well⁴The final DEAE-dextran concentration was 15. mu.g/mL.

6. Culturing: the 96-well plate is gently shaken back and forth, left and right to uniformly disperse the cells in the wells, and the 96-well plate is placed in a cell incubator and cultured for 48 hours at 37 ℃ with 5% CO 2.

After 7.48 hours, the 96-well plate was removed from the cell culture chamber, 200. mu.L of the supernatant was aspirated from each well (195. mu.L of the supernatant was aspirated off the edge) by a multi-channel pipette, and then 40. mu.L of Bright-GloTM luciferase assay reagent was added and reacted for 2 minutes at room temperature in the absence of light.

8. After the reaction, the liquid in the reaction well was repeatedly aspirated 5 times by using a multi-channel pipette to fully lyse the cells, 50. mu.L of the liquid was aspirated from each well, added to a corresponding 96-well chemiluminescence detection plate, and placed in a chemiluminescence detector to read the luminescence value using the BrighGlo program.

Experiment main reagents and consumables:

experimental main solution:

(1) prokaryotic strain culture medium

40% of glycerin: weighing 80mL of glycerol, adding water to a constant volume of 200mL, and autoclaving.

Ampicillin and kanamycin: dissolving 0.5g in deionized water, diluting to 10mL to obtain a solution with a final concentration of 50mg/mL, filtering with a sterile filter membrane of 0.22 μm for sterilization, and packaging at-20 deg.C for dilution at 1: 1000.

(2) Preparation of main reagent

(3) Reagents required for protein expression and purification:

OPM-293 CD05 medium.

PEI solution: dissolving 1g PEI in 1000mL water to prepare a solution with the final concentration of 1mg/mL, filtering and sterilizing by using a sterile filter membrane with the thickness of 0.22 mu m, and subpackaging and storing at-20 ℃.

Mannose eluent (500 mM): 40mg of mannose was dissolved in 40ml of PBS solution, and sterilized by filtration through a 0.45 μm sterile filter.

(4) Reagents for SDS-PAGE gel electrophoresis

4% -15% gradient gels from Bio-Rad

Tris-glycine electrophoresis buffer: weighing 3.03g of Tris, 18.75g of glycine and 1g of SDS powder, preparing with deionized water, and fixing the volume to 1L after dissolving.

10% SDS: 50g of SDS powder and 430mL of deionized water are weighed to prepare the mixture, the pH value is adjusted to 7.2, and the volume is adjusted to 500 mL.

30% acrylamide: weighing 1.6g N, N' -methylene bisacrylamide, 58.4g acrylamide and deionized water, diluting to a constant volume of 200mL, filtering to remove impurities, and storing in dark place.

Tris-HCl (pH6.8): 12.12g Tris powder was weighed, 1M deionized water was prepared, and the pH was adjusted to 6.8 with HCl.

Tris-HCl (pH8.8): 18.8g of Tris powder and deionized water were weighed to 1.5M, and the pH was adjusted to 8.8 with HCl.

10% APS: 1g of ammonium persulfate and 10mL of deionized water are weighed and prepared.

4 × sample buffer: 0.8g SDS, 0.04g bromophenol blue powder, 0.4mL beta-mercaptoethanol, 5mL Tris-HCl (0.5M pH6.8), 4.6mL glycerol, deionized water to 5 mL.

Coomassie brilliant blue destaining solution: 45% methanol, 45% water, 10% glacial acetic acid.

Coomassie brilliant blue staining solution: per 100mL destaining solution 0.25g Coomassie Brilliant blue was added.

(5) Solution required for ELISA

Coating liquid: weighing 1.7g of Na₂CO₃2.9g of NaHCO₃Preparing deionized water, adjusting the pH to 9.6, and fixing the volume to 1L.

Washing liquid: PBS-T, PBS containing 0.05% Tween-20(V/V), adjusted to pH 7.4.

Sealing liquid: washing solution was prepared containing 5% BSA (V/V).

Secondary antibody buffer: 0.38g of sodium phosphate dodecahydrate and 0.46g of sodium chloride were added to 100mL of water, and the mixture was dissolved by mixing and the pH was 7.6.

Stopping liquid: 2MH₂SO₄。

The main apparatus is as follows:

(1) electronic balance (H2F-A500, HZ electronic technology Co., Ltd. of Kangzhou, USA)

(2) Small-sized desk type centrifuge (5415R, Eppendorf)

(3) Ultra-low temperature refrigerator at-80 ℃ (725FORMA, Thermo FORMA)

(4) Magnetic stirrer (GL-3250C, Jiangsu Qinling bell instrument)

(5) Super clean bench (SW-CJ-2F, Sujing' an Tai)

(6) Micro-wave oven (Mei De company)

(7) Nucleic acid electrophoresis apparatus (DYY-6C, six instruments factory Beijing)

(8) Ultraviolet gel imager (GDS8000, UVP)

(9) CO2 incubator (DHP060, Shanghai laboratory instruments Co., Ltd.)

(10) High performance liquid chromatography (P1201, Dalianyilite analytical instruments Co., Ltd.)

(11) High speed refrigerated centrifuge (Avanti J-26XP, Beckman Counter)

(12) Semi-dry transfer tank (170-

(13) Horizontal electrophoresis tank for nucleic acid (Beijing six instrument factory)

(14) Small-sized high-speed Centrifuge (Centrifuge 5424, eppendorf)

(15) Constant temperature incubator (DHP060, Shanghai laboratory instruments Co., Ltd.)

(16) Full-function shaking culture box (M. mu. Ltitron Pro, Yifusen Biotechnology Co., Ltd.)

(17) PCR instrument (Mastercycler prot, Eppendorf)

(18) Decoloration shaking table (TS-8S, Jiangsu Qilin Beier instrument)

(19) Protein purification System (Purifier10, GE USA)

(20) Desk type refrigerated centrifuge (5810R, Eppendorf)

(21) Ultraviolet spectrophotometer (ND2000C, ThermoNanoDrop)

(22) Fluorescence chemiluminescence enzyme-labeling instrument (iMark, U.S. Thermo)

(23) Full-automatic chemiluminescence image analysis system (5200, Tannon)

(24) Enzyme-linked immunosorbent assay (ELX800, American Bio-Tec)

(28) Ultrapure water purifier (AdvantageA10, Millipore USA)

Reference documents:

[1]WHO.Ten threats to global health in 2019[EB/OL].https://www.who.int/zh/emergencies /ten-threats-to-global-health-in-2019.

[2] grandfather, zhangzi ning, korean xu, xujunjie, jiang champion, shang hong, studies on virus biological characteristics, immune response and disease progression of HIV-infected people in china, comprehensive control strategies and application studies under the new epidemic situation of aids in china [ J ]. chinese aids venereal disease, 2019, 25 (7): 665-667.

[3] Gaja xiafang, gurgling, zhanlijun. study progress of side effects of drugs for aids therapy by cocktail [ J ] journal of chinese biological products, 2019, 4 (3): 929-933.

[4]RAMBAUT A,POSADA D,CRANDALL K A,et al.The causes and consequences of HIV evolution[J].Nat Rev Genet,2004,5(1):52-61

[5]WEI X P,DECKER J M,WANG S Y,et al.Antibody neutralization and escape by HIV-1[J]. Nature,2003,422(6929):307-312.

[6]KWONG PETER D.and MASCOLA JOHN R.,Human Antibodies that Neutralize HIV-1: Identification,Structures,and B Cell Ontogenies[J].Immunity,2012,37:412-425.

[7]WU X.L.,YANG Z.Y.,LI Y.X.,et al.,Rational Design of Envelope Identifies Broadly Neutralizing Human Monoclonal Antibodies to HIV-1[J].Science,2010,329:856-861.

[8]BURTON D.R.and HANGARTNER L.,Broadly Neutralizing Antibodies to HIV and Their Role in Vaccine Design[J].Annual Review of Immunology,Vol 34,2016,34:635-659.

[9]LIAO H.-X.,LYNCH R.,ZHOU T.,et al.,Co-evolution of a broadly neutralizing HIV-1 antibody and founder virus[J].Nature,2013,496:469-476.

[10]NICKLE D C,JENSEN M A,GOTTLIEB G S,et al.Consensus and ancestral state HIV vaccines[J].Science,2003,299(5612):1515-1518.

[11]WEAVER E A,LU Z,CAMACHO Z T,et al.Cross-subtype T-cell immune responses induced by a human immunodeficiency virus type 1group m consensusenv immunogen[J].J Virol. 2006,80(14):6745-56.

[12]SANTRA S,KORBER B T,MULDOON M,et al.A centralized gene-based HIV-1vaccine elicits broad cross-clade cellular immune responses in rhesusmonkeys.Proc Natl Acad Sci U S A. 2008,05(30):10489-94

[13]SANDERS R W,VAN GILS M J,DERKING R,et al.HIV-1neutralizing antibodies induced by native-like envelope trimers[J].Science,2015,349(6244):aac4223

[14]SHARMA S K,DE VAL N,BALE S,et al.Cleavage-Independent HIV-1Env Trimers Engineered as Soluble Native Spike Mimetics for Vaccine Design[J].Cell Rep,2015,11(4): 539-50.

[15]KONG L,HE L L,DE VAL N,et al.Uncleaved prefusion-optimized gp140 trimers derived from analysis of HIV-1 envelope metastability[J].Nat Commun,2016,7:12040。

Sequence listing

<110> Jilin university

<120> envelope protein trimer immunogen capable of inducing HIV-1 broad-spectrum neutralizing antibody and application thereof

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2556

<212> DNA

<213> 718B.env.con

<400> 1

atgagagtga cggggatcag gaagaattat cggcatttat ggagatgggg caccatgctc 60

cttgggatgt tgatgatctg tagtgctgta ggaaacttgt gggtcacagt ctattatggg 120

gtacctgtat ggaaagaagc aactaccact ctattttgtg catcagatgc taaagcatat 180

gatacagagg tacataatgt ttgggctaca catgcctgtg tacccacaga ccccaaccca 240

caagaaatag ttttggaaaa tgtaacagaa aattttaaca tgtggaaaaa taacatggta 300

gagcagatgc atgaagatgt aatcagttta tgggatcaaa gcctaaagcc atgtgtaaag 360

ttgaccccac tctgtgtcac tttagaatgt agaaatgtta gcagtaatag taatagtaat 420

accaacaatg agagcaagaa ggaaatgaaa aattgctctt tcaatgcaac cacagtaata 480

agagataaga agcagaaagt gtatgcactt ttttatagac ttgatatagt accacttaat 540

aataactcta gtaggtatta tagattaata aattgtaata cctcagccat aacacaagcc 600

tgtccaaagg tcacttttga tccaattcct atacactatt gcactccagc tggttatgcg 660

attctaaagt gtaatgataa gacattcaat gggacaggac catgccataa tgttagcaca 720

gtacaatgta cacatggaat taagccagtg gtatcaactc aactactgtt aaatggtagc 780

ctagcagaag aagagataat aattagatct gaaaatctga caaacaatgt caaaacaata 840

atagtacatc ttaatcaatc tgtagaaatt gtatgtacaa gacccggcaa taatacaaga 900

aaaagtataa ggataggacc aggacaaaca ttctatgcaa caggagacat aataggagac 960

ataagacaag cacattgtaa cattagtgaa gataaatgga atgaaacttt acaacaggta 1020

agtaaaaaat tagcagaaca cttcccgaat aaaacaataa aatttgcatc atcctcagga 1080

ggggacctag aaattacaac acatagcttt aattgtagag gagaattttt ctattgtaat 1140

acatcaggcc tgtttaatag tacatacatg cctaatggta cagaaagtaa ttcaaactca 1200

accatcacaa tcccatgcag aataaagcaa attataaaca tgtggcagga ggtaggacga 1260

gcaatgtatg cccctcccat tgcaggaaac ataacatgta aatcaaatat cacaggacta 1320

ctattggtac gtgatggagg aaaagagaca aatactacag agacattcag acctggagga 1380

ggagatatga gggacaattg gagaagtgaa ttatataaat ataaagtggt agaaattaag 1440

ccattgggag tagcacccac tgaagcaaaa aggagagtgg tggagagaga aaaaagagca 1500

gtgggaatag gagctgtgtt ccttgggttc ttgggagcag caggaagcac tatgggcgcg 1560

gcgtcaataa cgctgacggt acaggccaga caattgttgt ctggtatagt gcaacagcaa 1620

agcaatttgc tgagggctat agaggcgcaa cagcatctgt tgcaactcac ggtctggggc 1680

attaagcagc tccagacaag agtcctggct atagaaagat acctaaagga tcaacagctc 1740

ctagggattt ggggctgctc tggaaaactc atctgcacta ctgctgtacc ttggaactcc 1800

agttggagta acaaatctca aaaagagatt tgggataaca tgacctggat gcaatgggat 1860

aaagaaatta gtaattacac aaacacaata tacaggttgc ttgaagactc gcaaaaccag 1920

caggaaagga atgaaaaaga tctattagca ttggacagtt ggaaaaatct atggaattgg 1980

tttgacataa caaattggct gtggtatata aaaatattca taatgatagt aggaggcttg 2040

ataggtttaa gaataatttt tgctgtgctt tctatagtga atagagttag gcagggatac 2100

tcacctttgt cgtttcagac ccttaccccg aacccagggg gacccgacag gctcggaaga 2160

atcgaagaag aaggtggaga gcaagacaaa gacagatcca ttcgattagt gaacggattc 2220

ttagcacttg cctgggacga cctgcggaac ctgtgcctct tcagctacca ccgcttgaga 2280

gacttcatat taattacagc gagagtggtg gaacttctgg gacgcagcag tctcagggga 2340

ctacagaggg ggtgggaagc ccttaaatat ctgggaagtc ttgtgcagta ttggggtcag 2400

gagctaaaaa agagtgctat tagtctgctt gataccatag caatagcagt agctgaagga 2460

acagatagga ttatagaagt agtacaagga gcttgtagag ctatcctcaa catacctaga 2520

agaataagac agggctttga agcagctttg caataa 2556

<210> 2

<211> 851

<212> PRT

<213> 718B.env.con

<400> 2

Met Arg Val Thr Gly Ile Arg Lys Asn Tyr Arg His Leu Trp Arg Trp

1 5 10 15

Gly Thr Met Leu Leu Gly Met Leu Met Ile Cys Ser Ala Val Gly Asn

20 25 30

Leu Trp Val Thr Val Tyr Tyr Gly Val Pro Val Trp Lys Glu Ala Thr

35 40 45

Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala Tyr Asp Thr Glu Val

50 55 60

His Asn Val Trp Ala Thr His Ala Cys Val Pro Thr Asp Pro Asn Pro

65 70 75 80

Gln Glu Ile Val Leu Glu Asn Val Thr Glu Asn Phe Asn Met Trp Lys

85 90 95

Asn Asn Met Val Glu Gln Met His Glu Asp Val Ile Ser Leu Trp Asp

100 105 110

Gln Ser Leu Lys Pro Cys Val Lys Leu Thr Pro Leu Cys Val Thr Leu

115 120 125

Glu Cys Arg Asn Val Ser Ser Asn Ser Asn Ser Asn Thr Asn Asn Glu

130 135 140

Ser Lys Lys Glu Met Lys Asn Cys Ser Phe Asn Ala Thr Thr Val Ile

145 150 155 160

Arg Asp Lys Lys Gln Lys Val Tyr Ala Leu Phe Tyr Arg Leu Asp Ile

165 170 175

Val Pro Leu Asn Asn Asn Ser Ser Arg Tyr Tyr Arg Leu Ile Asn Cys

180 185 190

Asn Thr Ser Ala Ile Thr Gln Ala Cys Pro Lys Val Thr Phe Asp Pro

195 200 205

Ile Pro Ile His Tyr Cys Thr Pro Ala Gly Tyr Ala Ile Leu Lys Cys

210 215 220

Asn Asp Lys Thr Phe Asn Gly Thr Gly Pro Cys His Asn Val Ser Thr

225 230 235 240

Val Gln Cys Thr His Gly Ile Lys Pro Val Val Ser Thr Gln Leu Leu

245 250 255

Leu Asn Gly Ser Leu Ala Glu Glu Glu Ile Ile Ile Arg Ser Glu Asn

260 265 270

Leu Thr Asn Asn Val Lys Thr Ile Ile Val His Leu Asn Gln Ser Val

275 280 285

Glu Ile Val Cys Thr Arg Pro Gly Asn Asn Thr Arg Lys Ser Ile Arg

290 295 300

Ile Gly Pro Gly Gln Thr Phe Tyr Ala Thr Gly Asp Ile Ile Gly Asp

305 310 315 320

Ile Arg Gln Ala His Cys Asn Ile Ser Glu Asp Lys Trp Asn Glu Thr

325 330 335

Leu Gln Gln Val Ser Lys Lys Leu Ala Glu His Phe Pro Asn Lys Thr

340 345 350

Ile Lys Phe Ala Ser Ser Ser Gly Gly Asp Leu Glu Ile Thr Thr His

355 360 365

Ser Phe Asn Cys Arg Gly Glu Phe Phe Tyr Cys Asn Thr Ser Gly Leu

370 375 380

Phe Asn Ser Thr Tyr Met Pro Asn Gly Thr Glu Ser Asn Ser Asn Ser

385 390 395 400

Thr Ile Thr Ile Pro Cys Arg Ile Lys Gln Ile Ile Asn Met Trp Gln

405 410 415

Glu Val Gly Arg Ala Met Tyr Ala Pro Pro Ile Ala Gly Asn Ile Thr

420 425 430

Cys Lys Ser Asn Ile Thr Gly Leu Leu Leu Val Arg Asp Gly Gly Lys

435 440 445

Glu Thr Asn Thr Thr Glu Thr Phe Arg Pro Gly Gly Gly Asp Met Arg

450 455 460

Asp Asn Trp Arg Ser Glu Leu Tyr Lys Tyr Lys Val Val Glu Ile Lys

465 470 475 480

Pro Leu Gly Val Ala Pro Thr Glu Ala Lys Arg Arg Val Val Glu Arg

485 490 495

Glu Lys Arg Ala Val Gly Ile Gly Ala Val Phe Leu Gly Phe Leu Gly

500 505 510

Ala Ala Gly Ser Thr Met Gly Ala Ala Ser Ile Thr Leu Thr Val Gln

515 520 525

Ala Arg Gln Leu Leu Ser Gly Ile Val Gln Gln Gln Ser Asn Leu Leu

530 535 540

Arg Ala Ile Glu Ala Gln Gln His Leu Leu Gln Leu Thr Val Trp Gly

545 550 555 560

Ile Lys Gln Leu Gln Thr Arg Val Leu Ala Ile Glu Arg Tyr Leu Lys

565 570 575

Asp Gln Gln Leu Leu Gly Ile Trp Gly Cys Ser Gly Lys Leu Ile Cys

580 585 590

Thr Thr Ala Val Pro Trp Asn Ser Ser Trp Ser Asn Lys Ser Gln Lys

595 600 605

Glu Ile Trp Asp Asn Met Thr Trp Met Gln Trp Asp Lys Glu Ile Ser

610 615 620

Asn Tyr Thr Asn Thr Ile Tyr Arg Leu Leu Glu Asp Ser Gln Asn Gln

625 630 635 640

Gln Glu Arg Asn Glu Lys Asp Leu Leu Ala Leu Asp Ser Trp Lys Asn

645 650 655

Leu Trp Asn Trp Phe Asp Ile Thr Asn Trp Leu Trp Tyr Ile Lys Ile

660 665 670

Phe Ile Met Ile Val Gly Gly Leu Ile Gly Leu Arg Ile Ile Phe Ala

675 680 685

Val Leu Ser Ile Val Asn Arg Val Arg Gln Gly Tyr Ser Pro Leu Ser

690 695 700

Phe Gln Thr Leu Thr Pro Asn Pro Gly Gly Pro Asp Arg Leu Gly Arg

705 710 715 720

Ile Glu Glu Glu Gly Gly Glu Gln Asp Lys Asp Arg Ser Ile Arg Leu

725 730 735

Val Asn Gly Phe Leu Ala Leu Ala Trp Asp Asp Leu Arg Asn Leu Cys

740 745 750

Leu Phe Ser Tyr His Arg Leu Arg Asp Phe Ile Leu Ile Thr Ala Arg

755 760 765

Val Val Glu Leu Leu Gly Arg Ser Ser Leu Arg Gly Leu Gln Arg Gly

770 775 780

Trp Glu Ala Leu Lys Tyr Leu Gly Ser Leu Val Gln Tyr Trp Gly Gln

785 790 795 800

Glu Leu Lys Lys Ser Ala Ile Ser Leu Leu Asp Thr Ile Ala Ile Ala

805 810 815

Val Ala Glu Gly Thr Asp Arg Ile Ile Glu Val Val Gln Gly Ala Cys

820 825 830

Arg Ala Ile Leu Asn Ile Pro Arg Arg Ile Arg Gln Gly Phe Glu Ala

835 840 845

Ala Leu Gln

850

<210> 3

<211> 2556

<212> DNA

<213> 718B.env.con

<400> 3

atgagagtga ccggcatccg gaagaactac cggcacctgt ggcgctgggg caccatgctg 60

ctgggcatgc tgatgatctg cagcgccgtg ggcaacctgt gggtgacagt gtactacggc 120

gtgcccgtgt ggaaagaggc caccaccacc ctgttctgcg ccagcgacgc caaggcctac 180

gacaccgagg tgcacaacgt gtgggccacc cacgcctgcg tgccaaccga ccccaacccc 240

caggaaatcg tcctggaaaa cgtgaccgag aacttcaaca tgtggaagaa caacatggtg 300

gaacagatgc acgaggacgt gatcagcctg tgggaccaga gcctgaagcc ctgcgtgaag 360

ctgacccccc tgtgcgtgac cctggaatgc cggaacgtgt ccagcaacag caactccaac 420

accaacaacg agtccaagaa agagatgaag aactgcagct tcaacgccac caccgtgatc 480

cgggacaaga aacagaaggt gtacgccctg ttctaccggc tggacatcgt gcccctgaac 540

aacaacagca gccggtacta cagactgatc aactgcaaca ccagcgccat cacccaggcc 600

tgccccaaag tgaccttcga ccccatcccc atccactact gcacccctgc cggctacgcc 660

atcctgaagt gcaacgacaa gaccttcaac ggcaccggcc cctgccacaa cgtgtccacc 720

gtgcagtgca cccacggcat caagcccgtg gtgtccaccc agctgctgct gaacggcagc 780

ctggccgagg aagagatcat catcagaagc gagaacctga ccaacaacgt gaaaaccatc 840

attgtgcacc tgaaccagag cgtggaaatc gtgtgcacca gacccggcaa caacaccaga 900

aagagcatcc ggatcggccc tggccagacc ttttacgcca ccggcgacat catcggcgac 960

atccggcagg cccactgcaa catctccgag gacaagtgga acgagacact gcagcaggtc 1020

tccaagaagc tggccgagca cttccccaac aagaccatca agttcgctag cagctctggc 1080

ggcgacctgg aaatcaccac ccacagcttc aactgcagag gcgagttctt ctactgcaat 1140

acctccggcc tgttcaacag cacctacatg cccaatggca ccgagagcaa tagcaacagc 1200

accatcacca tcccttgccg gatcaagcag atcatcaata tgtggcagga agtgggcaga 1260

gctatgtacg cccctcctat cgccggcaac atcacatgca agagcaacat caccggcctg 1320

ctgctggtcc gcgacggcgg caaagagaca aacaccaccg agacattcag acccggcgga 1380

ggcgacatgc gggacaactg gcggagcgag ctgtacaagt acaaggtggt ggaaatcaag 1440

cccctgggcg tggcccccac cgaggccaag agaagagtgg tggaacgcga gaagcgggcc 1500

gtgggcatcg gcgccgtgtt tctgggcttt ctgggagccg ccggaagcac catgggcgct 1560

gccagcatca ccctgaccgt gcaggccaga cagctgctga gcggcatcgt gcagcagcag 1620

agcaacctgc tgcgggccat cgaggctcag cagcatctgc tgcagctgac cgtgtggggc 1680

atcaagcagc tgcagacccg ggtgctggct atcgagagat acctgaagga tcagcagctc 1740

ctgggaatct ggggctgcag cggcaagctg atctgcacca ccgccgtgcc ctggaacagc 1800

agctggtcca acaagagcca gaaagaaatc tgggacaaca tgacctggat gcagtgggac 1860

aaagagatca gcaactacac caacaccatc tacaggctgc tggaagatag ccagaaccag 1920

caggaacgga acgagaagga cctgctggcc ctggacagct ggaagaacct gtggaattgg 1980

ttcgacatca ccaactggct gtggtacatc aagatcttca tcatgatcgt gggcggcctg 2040

atcggcctgc ggatcatctt cgccgtgctg agcatcgtga acagagtgcg gcagggctac 2100

agccccctga gcttccagac cctgaccccc aaccctggag gccctgaccg gctgggcaga 2160

attgaggaag agggcggcga gcaggacaaa gaccggtcca tccggctggt gaacggcttc 2220

ctggccctgg cctgggacga cctgcggaac ctgtgcctgt tcagctacca ccggctgcgg 2280

gacttcatcc tgatcaccgc cagggtggtg gaactgctgg gccggtctag cctgagaggc 2340

ctgcagagag gctgggaggc cctgaagtac ctgggcagcc tggtgcagta ctggggccag 2400

gaactgaaga agtccgccat cagcctgctg gacacaatcg ccattgccgt ggccgagggc 2460

accgaccgga tcatcgaagt ggtgcagggc gcctgccggg ccattctgaa catccccaga 2520

cggatccggc agggattcga ggccgctctg cagtga 2556

<210> 4

<211> 2283

<212> DNA

<213> PCM

<400> 4

atggatgcaa tgaagagagg gctctgctgt gtgctgctgc tgtgtggagc agtcttcgtt 60

tcgcccagcg gtaccgcggg caatacgaac tcgggcggct ccacgacgac catcaccaac 120

aacaactcgg gcaccaactc atccagcacg acctacacgg ttaaaagcgg cgataccctg 180

tggggtattt cacagcgtta tggcatttcg gttgctcaga tccaaagcgc gaacaatctg 240

aaatctacca ttatctacat cggccaaaaa ctggtcctga ccggtagcgc gagctctacg 300

aactcaggcg gttcgaacaa tagcgcttct accacgccga ccacgtcggt gaccccggcc 360

aaaccgacga gccagaccac cgtcaaagtg aaatctggcg ataccctgtg ggccctgagt 420

gttaaatata aaacgtccat tgcacaactg aaatcatgga accatctgag ttccgacacc 480

atttacatcg gtcagaacct gatcgtcagt caatccgcgg ccgcaagcaa tccgtctacc 540

ggctcaggtt cgaccgccac gaacaatagc aattctacgt catcgaacag taatgcatcc 600

attcacaaag tggttaaagg cgacaccctg tggggtctga gtcagaaaag tggttccccg 660

attgcgtcta tcaaagcatg gaaccacctg agcagcgaca cgattctgat tggccagtat 720

ctgcgtatta aaggtggtgg tggttctggt ggtggtggtt ctggtggtgg tggttctgta 780

ggaaacttgt gggtgacagt gtactacggc gtgcccgtgt ggaaagaggc caccaccacc 840

ctgttctgcg ccagcgacgc caaggcctac gacaccgagg tgcacaacgt gtgggccacc 900

cacgcctgcg tgccaaccga ccccaacccc caggaaatcg tcctggaaaa cgtgaccgag 960

aacttcaaca tgtggaagaa caacatggtg gaacagatgc acgaggacgt gatcagcctg 1020

tgggaccaga gcctgaagcc ctgcgtgaag ctgacccccc tgtgcgtgac cctggaatgc 1080

cggaacgtgt ccagcaacag caactccaac accaacaacg agtccaagaa agagatgaag 1140

aactgcagct tcaacgccac caccgtgatc cgggacaaga aacagaaggt gtacgccctg 1200

ttctaccggc tggacatcgt gcccctgaac aacaacagca gccggtacta cagactgatc 1260

aactgcaaca ccagcgccat cacccaggcc tgccccaaag tgaccttcga ccccatcccc 1320

atccactact gcacccctgc cggctacgcc atcctgaagt gcaacgacaa gaccttcaac 1380

ggcaccggcc cctgccacaa cgtgtccacc gtgcagtgca cccacggcat caagcccgtg 1440

gtgtccaccc agctgctgct gaacggcagc ctggccgagg aagagatcat catcagaagc 1500

gagaacctga ccaacaacgt gaaaaccatc attgtgcacc tgaaccagag cgtggaaatc 1560

gtgtgcacca gacccggcaa caacaccaga aagagcatcc ggatcggccc tggccagacc 1620

ttttacgcca ccggcgacat catcggcgac atccggcagg cccactgcaa catctccgag 1680

gacaagtgga acgagacact gcagcaggtc tccaagaagc tggccgagca cttccccaac 1740

aagaccatca agttcgctag cagctctggc ggcgacctgg aaatcaccac ccacagcttc 1800

aactgcagag gcgagttctt ctactgcaat acctccggcc tgttcaacag cacctacatg 1860

cccaatggca ccgagagcaa tagcaacagc accatcacca tcccttgccg gatcaagcag 1920

atcatcaata tgtggcagga agtgggcaga gctatgtacg cccctcctat cgccggcaac 1980

atcacatgca agagcaacat caccggcctg ctgctggtcc gcgacggcgg caaagagaca 2040

aacaccaccg agacattcag acccggcgga ggcgacatgc gggacaactg gcggagcgag 2100

ctgtacaagt acaaggtggt ggaaatcaag cccctgggag tagcacccac tggaggttct 2160

ggaggaatca aggaagagat tgccaaaatt aaggaggaac aagctaaaat aaaagagaag 2220

atagctgaaa tcgagaaaag aattgcagaa atcgaaaaga gaattgctgg gggttgttgc 2280

taa 2283

<210> 5

<211> 760

<212> PRT

<213> PCM

<400> 5

Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly

1 5 10 15

Ala Val Phe Val Ser Pro Ser Gly Thr Ala Gly Asn Thr Asn Ser Gly

20 25 30

Gly Ser Thr Thr Thr Ile Thr Asn Asn Asn Ser Gly Thr Asn Ser Ser

35 40 45

Ser Thr Thr Tyr Thr Val Lys Ser Gly Asp Thr Leu Trp Gly Ile Ser

50 55 60

Gln Arg Tyr Gly Ile Ser Val Ala Gln Ile Gln Ser Ala Asn Asn Leu

65 70 75 80

Lys Ser Thr Ile Ile Tyr Ile Gly Gln Lys Leu Val Leu Thr Gly Ser

85 90 95

Ala Ser Ser Thr Asn Ser Gly Gly Ser Asn Asn Ser Ala Ser Thr Thr

100 105 110

Pro Thr Thr Ser Val Thr Pro Ala Lys Pro Thr Ser Gln Thr Thr Val

115 120 125

Lys Val Lys Ser Gly Asp Thr Leu Trp Ala Leu Ser Val Lys Tyr Lys

130 135 140

Thr Ser Ile Ala Gln Leu Lys Ser Trp Asn His Leu Ser Ser Asp Thr

145 150 155 160

Ile Tyr Ile Gly Gln Asn Leu Ile Val Ser Gln Ser Ala Ala Ala Ser

165 170 175

Asn Pro Ser Thr Gly Ser Gly Ser Thr Ala Thr Asn Asn Ser Asn Ser

180 185 190

Thr Ser Ser Asn Ser Asn Ala Ser Ile His Lys Val Val Lys Gly Asp

195 200 205

Thr Leu Trp Gly Leu Ser Gln Lys Ser Gly Ser Pro Ile Ala Ser Ile

210 215 220

Lys Ala Trp Asn His Leu Ser Ser Asp Thr Ile Leu Ile Gly Gln Tyr

225 230 235 240

Leu Arg Ile Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

245 250 255

Gly Gly Ser Val Gly Asn Leu Trp Val Thr Val Tyr Tyr Gly Val Pro

260 265 270

Val Trp Lys Glu Ala Thr Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys

275 280 285

Ala Tyr Asp Thr Glu Val His Asn Val Trp Ala Thr His Ala Cys Val

290 295 300

Pro Thr Asp Pro Asn Pro Gln Glu Ile Val Leu Glu Asn Val Thr Glu

305 310 315 320

Asn Phe Asn Met Trp Lys Asn Asn Met Val Glu Gln Met His Glu Asp

325 330 335

Val Ile Ser Leu Trp Asp Gln Ser Leu Lys Pro Cys Val Lys Leu Thr

340 345 350

Pro Leu Cys Val Thr Leu Glu Cys Arg Asn Val Ser Ser Asn Ser Asn

355 360 365

Ser Asn Thr Asn Asn Glu Ser Lys Lys Glu Met Lys Asn Cys Ser Phe

370 375 380

Asn Ala Thr Thr Val Ile Arg Asp Lys Lys Gln Lys Val Tyr Ala Leu

385 390 395 400

Phe Tyr Arg Leu Asp Ile Val Pro Leu Asn Asn Asn Ser Ser Arg Tyr

405 410 415

Tyr Arg Leu Ile Asn Cys Asn Thr Ser Ala Ile Thr Gln Ala Cys Pro

420 425 430

Lys Val Thr Phe Asp Pro Ile Pro Ile His Tyr Cys Thr Pro Ala Gly

435 440 445

Tyr Ala Ile Leu Lys Cys Asn Asp Lys Thr Phe Asn Gly Thr Gly Pro

450 455 460

Cys His Asn Val Ser Thr Val Gln Cys Thr His Gly Ile Lys Pro Val

465 470 475 480

Val Ser Thr Gln Leu Leu Leu Asn Gly Ser Leu Ala Glu Glu Glu Ile

485 490 495

Ile Ile Arg Ser Glu Asn Leu Thr Asn Asn Val Lys Thr Ile Ile Val

500 505 510

His Leu Asn Gln Ser Val Glu Ile Val Cys Thr Arg Pro Gly Asn Asn

515 520 525

Thr Arg Lys Ser Ile Arg Ile Gly Pro Gly Gln Thr Phe Tyr Ala Thr

530 535 540

Gly Asp Ile Ile Gly Asp Ile Arg Gln Ala His Cys Asn Ile Ser Glu

545 550 555 560

Asp Lys Trp Asn Glu Thr Leu Gln Gln Val Ser Lys Lys Leu Ala Glu

565 570 575

His Phe Pro Asn Lys Thr Ile Lys Phe Ala Ser Ser Ser Gly Gly Asp

580 585 590

Leu Glu Ile Thr Thr His Ser Phe Asn Cys Arg Gly Glu Phe Phe Tyr

595 600 605

Cys Asn Thr Ser Gly Leu Phe Asn Ser Thr Tyr Met Pro Asn Gly Thr

610 615 620

Glu Ser Asn Ser Asn Ser Thr Ile Thr Ile Pro Cys Arg Ile Lys Gln

625 630 635 640

Ile Ile Asn Met Trp Gln Glu Val Gly Arg Ala Met Tyr Ala Pro Pro

645 650 655

Ile Ala Gly Asn Ile Thr Cys Lys Ser Asn Ile Thr Gly Leu Leu Leu

660 665 670

Val Arg Asp Gly Gly Lys Glu Thr Asn Thr Thr Glu Thr Phe Arg Pro

675 680 685

Gly Gly Gly Asp Met Arg Asp Asn Trp Arg Ser Glu Leu Tyr Lys Tyr

690 695 700

Lys Val Val Glu Ile Lys Pro Leu Gly Val Ala Pro Thr Gly Gly Ser

705 710 715 720

Gly Gly Ile Lys Glu Glu Ile Ala Lys Ile Lys Glu Glu Gln Ala Lys

725 730 735

Ile Lys Glu Lys Ile Ala Glu Ile Glu Lys Arg Ile Ala Glu Ile Glu

740 745 750

Lys Arg Ile Ala Gly Gly Cys Cys

755 760

Claims (7)

1. An envelope protein trimer immunogen capable of inducing HIV-1 broad-spectrum neutralizing antibodies, comprising: the envelope protein Env consensus gene sequence is designed based on HIV-1 Chinese epidemic strains, and the stable envelope protein gp120 tripolymer protein is obtained on the basis of the sequence.

2. The trimeric immunogen of envelope protein of claim 1 which induces broadly neutralizing antibodies against HIV-1, which immunogen is characterized by: the consensus gene sequence was 718b.env.con, derived from the envelope glycoprotein of a different strain of HIV-1.

3. The trimeric immunogen of envelope protein of claim 2 which induces broadly neutralizing antibodies against HIV-1, which immunogen is characterized by: the common gene sequence of the envelope protein is further derived from different virus strains of HIV-1 Chinese epidemic subtypes CRF07_ BC, CRF01_ AE, CRF08_ BC and Subtype B.

4. The trimeric immunogen of envelope protein capable of inducing broadly neutralizing antibodies against HIV-1 as claimed in claim 3, wherein: is a more stable trimeric protein.

5. The trimeric immunogen of envelope protein capable of inducing broadly neutralizing antibodies against HIV-1 according to claim 4, wherein: wherein the stable trimeric protein is fused with Protan at the N terminal and a trimerization module MTQ at the C terminal.

6. The trimeric envelope protein immunogen of any one of claims 1 to 5 which induces broadly neutralizing antibodies to HIV-1, wherein: can induce the generation of broad-spectrum neutralizing antibodies aiming at different HIV-1 epidemic strains in animals.

7. The use of the envelope protein trimer immunogen of claim 6 for the preparation of an HIV-1 broad-spectrum neutralizing antibody vaccine.