CN110616216B

CN110616216B - Monoclonal cell strain for stably expressing serine protease, preparation method thereof, kit containing cell strain and application

Info

Publication number: CN110616216B
Application number: CN201910256904.3A
Authority: CN
Inventors: 周佳彬; 郑杰; 米梦柔; 候野; 张凌云; 陈晓娟
Original assignee: Zhuhai Dingan Biological Products Co ltd; Beijing Dingchi Biotechnology Co ltd
Current assignee: Zhuhai Dingan Biological Products Co ltd; Beijing Dingchi Biotechnology Co ltd
Priority date: 2019-04-01
Filing date: 2019-04-01
Publication date: 2021-03-30
Anticipated expiration: 2039-04-01
Also published as: CN110616216A

Abstract

The invention discloses a monoclonal cell strain for stably expressing serine protease genes, a preparation method thereof, a kit containing the cell strain and application. Culturing the monoclonal cell strain stably expressing the serine protease gene in a culture plate, and removing a cell culture solution; diluting the hog cholera virus stock solution in a multiple ratio, and adding the diluted virus solution into a culture plate without a cell culture solution; the CSFV TCID50 is judged by the phenomenon of CPE in the continuous culture, and the calculation method of TCID50 is calculated according to the Reed-Muench two-handed method. The kit is used for visual detection of the classical swine fever virus, the TCID50 of the classical swine fever virus is detected by using the detection kit, a fluorescence microscope and a classical swine fever detection antibody are not needed, and the advantages of simple result judgment, good experimental repeatability and the like of the classical swine fever virus TCID50 are achieved.

Description

Monoclonal cell strain for stably expressing serine protease, preparation method thereof, kit containing cell strain and application

Technical Field

The invention belongs to the technical field of virus detection, and particularly relates to a monoclonal cell strain for stably expressing serine protease, a preparation method thereof and a kit containing the cell strain.

Background

Classical Swine Fever (CSF) is a highly contagious disease caused by Classical Swine Fever Virus (CSFV), and wild pigs and domestic pigs are the only natural hosts of CSFV, have wide prevalence and high morbidity and mortality, and are important diseases threatening the swine industry. Therefore, the prevention and control situation of the swine fever is severe, and the research and development of related researches on the swine fever virus and the vaccine thereof are still very urgent, so that the development of the detection kit capable of simply, conveniently and economically detecting the titer of the swine fever virus has important significance for the prevention and control of the swine fever diseases.

Classical swine fever virus belongs to members of flaviviridae and pestivirus, and has a slightly round virus particle with an envelope and a fiber structure on the surface. CSFV is a single-stranded positive-strand linear RNA virus with envelope, has a full length of about 12.3kb, has a simple gene structure, and comprises a non-coding region 5'UTR and 3' UTR at both ends and a continuous large Open Reading Frame (ORF) in the middle. The ORF encodes an independent polyprotein of 3898 amino acids, which, upon hydrolysis by viral and host proteases, forms 12 protein end products, including 4 structural proteins (C, Erns, E1 and E2) and 8 non-structural proteins (N pro, P7, NS2, NS3, NS4A, NS4B, NS5A and NS 5B). One of the characteristics of classical swine fever viruses is that they do not cause cytopathic effects during in vitro culture and therefore their interaction with cells is of increasing interest, whereas NS3, a non-structural protein, has combined serine protease (1/3NS3), nucleoside triphosphate and RNA helicase (2/3NS3) activities. The experimental result shows that the expression of the NS3 protein has close relation with cytopathogenesis, so the research on the NS3 gene is helpful to find out the cause of the cytopathogenesis of the classical swine fever virus.

After the swine fever virus infects swine testicle cells, no obvious CPE phenomenon can be caused, so that the TCID50 value of the swine fever virus can be detected only by an immunofluorescence detection mode. However, the experimental method of immunofluorescence for detecting titer of hog cholera virus has the disadvantages of expensive detection price, poor repeatability, and the need of a fluorescence microscope, so a simple and effective detection method is urgently needed.

Disclosure of Invention

The invention aims to provide a monoclonal cell strain for stably expressing a serine protease gene, a preparation method thereof and a kit containing the cell strain.

In order to achieve the purpose, the invention adopts the following technical scheme:

a monoclonal cell strain E-ST-50# for stably expressing serine protease gene with preservation number CGMCC No.17415 is a pig testis cell.

A method for preparing a monoclonal cell strain stably expressing a serine protease gene, comprising the steps of:

1) construction of serine protease overexpression plasmids

Amplifying a serine protease gene fragment, using CSFV-DNS3 as a template, using primers CSFV-1/3NS 3-NheI-F and CSFV-1/3NS3-Bstbi-R to amplify a target fragment CSFV-1/3NS3 with NheI and Bstbi enzyme cutting sites, using NheI and Bstbi to simultaneously enzyme cut the target fragment CSFV-1/3NS3 and plasmid PLJM1 RagB 99L to obtain a target fragment with a sticky end and a vector, inserting the serine protease gene fragment into the enzyme cut PLJM1 RagB 99L plasmid, and constructing a PLJM1-CSFV-1/3NS3 plasmid;

2) ST cell culture

ST cells were cultured in MEM ALPH medium containing 5% -10% NBS at 3 x 10⁵carrying out cell passage on the cell density of the cell/ml, and carrying out cell passage when the cell density reaches over 90% to obtain E-ST cells;

3) construction of serine protease overexpression cell line

Transferring the constructed PLJM1-CSFV-1/3NS3 plasmid into E-ST cells by an electrotransfer method, adding an MEM ALPH culture medium containing 5-10% NBS, after electrotransfer, adding puromycin to screen the cells after electrotransfer to obtain a polyclonal cell strain with stable serine protease expression; and screening the polyclonal cell strain with stably expressed serine protease from the polyclonal cell strain with stably expressed serine protease by using an infinite dilution method.

A kit for detecting half infection amount of classical swine fever virus, which comprises the monoclonal cell strain stably expressing serine protease.

A method for detecting half the infection amount of classical swine fever virus, comprising the steps of:

culturing the monoclonal cell strain stably expressing the serine protease in a culture plate, and removing a cell culture solution; diluting the hog cholera virus stock solution in a multiple ratio, and adding the diluted virus solution into a culture plate without a cell culture solution;

the CSFV TCID50 is judged by the phenomenon of CPE in the continuous culture, and the calculation method of TCID50 is calculated according to the Reed-Muench two-handed method.

The invention also provides application of the monoclonal cell strain for stably expressing the serine protease in detecting half infection amount of the classical swine fever virus.

The monoclonal cell strain for stably expressing the serine protease gene is delivered to Beijing city, Chaoyang district, West Lu No.1 institute 3, China academy of sciences and microbiology general microbiological culture Collection center for China, and the monoclonal cell strain is preserved in 2019, 28 months and 3 days, has the preservation number of CGMCC No.17415 and is named as a pig testicular cell by classification.

NS3 plays an extremely important role in viral replication and its interaction with cells. When the NS3 protein is highly expressed in swine testis cells (ST), ST cells which are not infected after the swine fever virus is infected can have obvious cytopathic effect. The cell strain which stably expresses the serine protease gene (1/3NS3) constructed in the invention can generate obvious CPE after being infected by the classical swine fever virus, so that the titer of the classical swine fever virus can be judged by directly using CPE lesion generated by the cell strain which stably expresses the serine protease, and an antibody and a fluorescence microscope of the classical swine fever virus E2 protein are not needed any more. Therefore, the invention constructs an ST cell strain which can generate obvious CPE after being infected by the classical swine fever virus, establishes a TCID50 detection method of classical swine fever virus titer based on the ST cell strain, and evaluates the accuracy of the detection kit.

The detection kit is used for detecting the TCID50 of the classical swine fever virus, a fluorescence microscope and a classical swine fever detection antibody are not needed, and the advantages of simple result judgment, good experimental repeatability and the like of the classical swine fever virus TCID50 are achieved.

Drawings

FIG. 1 is a plasmid map of PLJM1-CSFV-1/3NS3 of the present invention.

Detailed Description

Any feature disclosed in this specification may be replaced by alternative features serving equivalent or similar purposes, unless expressly stated otherwise. Unless expressly stated otherwise, each feature is only an example of a generic series of equivalent or similar features. The description is only for the purpose of facilitating understanding of the present invention and should not be construed as specifically limiting the present invention.

The invention is described in further detail below with reference to the figures and the detailed description.

Example 1

1. Material

ST cells were purchased from ATCC cell preservation center, MEM Alph medium and 0.25% trypsin from Gibco, Newborn Bovine Serum (NBS) from Wuhan Sanli, Puromycin (Puromycin) from Solebao, 96-well cell culture plate from Corning, hog cholera E2 antibody from MEDLAN, goat anti-mouse marker FITC secondary antibody from Invitrogen, plasmids PLJM1 RagB 99L and CSFV-DNS3 were distributed from the manining laboratory of Shenyang pharmaceutical university, and the primer synthesis and sequencing services were completed by Thermo. (ii) a Easypfu DNA polymerase, dNTP and nucleic acid electrophoresis Marker from the all-gold biotechnology company, competent cell DH 5A from Bomader biotechnology limited; a plasmid small-extraction kit, a plasmid large-extraction kit, an agarose gel DNA recovery kit and red blood cell lysate are purchased from Tiangen biochemistry company; t4 DNA ligase and various restriction enzymes were purchased from NEB; trizol reagent is purchased from Solebao Biotechnology Ltd, oligo (dT), Ribonuclase Inhibitor, M-MLV reverse transcriptase from TaKaRa.

2. Instrument for measuring the position of a moving object

CO₂Cell incubators, biosafety cabinets, optical microscopes, and fluorescence microscopes were purchased from Shanghai Lianshi scientific instruments, Inc., Shanghai Caikang optical instruments, and Olympus, respectively.

3. Construction of serine protease Gene overexpression plasmids

Amplifying 1/3NS3 gene segment, using CSFV-DNS3 as a template, amplifying a target segment CSFV-1/3NS3 with NheI and BstBI by using primers CSFV-1/3NS 3-NheI-F and CSFV-1/3NS3-BstBI-R, inserting the target segment CSFV-1/3NS3 into a PLJM1 RagB 99L plasmid, and constructing to obtain a PLJM1-CSFV-1/3NS3 plasmid; the plasmid with the selection marker of the antibiotic Puromycin can be used for screening cell strains for stably expressing serine protease genes, and the plasmid map is shown in figure 1.

TABLE 1 amplification of fragments of interest and List of primers used for detection

The sequence of CSFV-1/3NS3(678bp) is shown as SEQ ID NO.5 (678 bp);

SEQ ID NO.5：

gccaccatggggcctgccgtttgcaagaaggttaccgaacatgagaaatgcaccacatccataatggacaaattgactgct tt

tttcggtgttatgccaaggggcaccacacctagagcccctgtgagattccccacctctctcttaaagataagaagggggtta gaaa

ctggctgggcgtatacacaccaaggtggtattagttcagtggaccatgtcacttgcgggaaagacttactggtatgtgacac tatg

ggccggacaagggtcgtttgccaatcaaataataagatgacagacgagtccgagtatggagttaaaactgactccggatg cccg

gaaggagctaggtgttatgtgttcaacccagaggcagtcaacatatcagggactaaaggagccatggtccacttacaaaa aactg

gaggagaattcacctgtgtgacagcatcaggaaccccggccttctttgacctcaagaacctcaaaggctggtcagggcta ccgata

tttgaggcatcaagtggaagggtagtcggcagggtcaaggtcgggaagaatgaggactctaaaccaaccaagcttatga gtgga

atacaaacagtctccaaaagtaccacagacttgacagaaatggtaaagaagataacgactatgaacaggggagaattcag ataa。

4. ST cell culture

ST adherent cells purchased from ATCC, cultured in MEM ALPH medium containing 10% NBS at 3X 10⁵And (4) carrying out cell passage at the cell density of cell/ml, and carrying out cell passage when the cell density reaches over 90% after culturing for 48 hours.

5. Construction of serine protease overexpression cell line

Transferring the constructed PLJM1-CSFV-1/3NS3 plasmid into ST cells by an electrotransfer method, adding MEM Alph culture medium containing 10% NBS, carrying out electrotransfer for 24h, adding puromycin to screen the electrotransfer cells, and obtaining the polyclonal cell strain with stable serine protease gene expression. Monoclonal cell lines 4 with high serine protease expression levels, which were selected from polyclonal cell lines stably expressing serine protease by the infinite dilution method, were 10#, 27#, 50#, 79# cells, respectively, and swine fever TCID50 was detected and evaluated using these 4 lines.

6. Detection of hog cholera by serine protease gene stable expression cell strain TCID50 and result evaluation

The ST cell line stably expressing serine protease No. 10, No. 27, No. 50, No. 79 was added to a 96-well cell culture plate in 100. mu.l/well in MEM Alph medium containing 10% NBS to prepare a 3E5cell/ml cell suspension, and the plate was placed in a CO-containing 96-well cell culture plate₂37 ℃ CO of 5% in the cell box₂After 12h of culture, the classical swine fever virus stock solution was diluted 10-fold in 4% NBS MEM Alph medium. After removing the cell culture medium from the 96-well plate, 100ul of diluted virus solution was added to each well, making a total of 9-10 gradients, and 5 replicates for each gradient. Putting the 96-well plate added with the virus liquid into a cell incubator, and continuously culturing for 3 days to treat the classical swine fever virus through the phenomenon of CPE (CPE)The TCID50 is judged, the calculation method of the TCID50 is calculated according to the Reed-Muench two-law method, and the accuracy of the detection method is evaluated by comparing with the TCID50 of the immunofluorescence detection of the sample, and if the error is within 5 percent, the accuracy is considered to be acceptable. Since the cell line over-expressing serine protease is a monoclonal cell line screened by antibiotics, the stability and accuracy of the P5-P25 cell lines for detecting the titer of the classical swine fever virus are continuously evaluated by the invention in order to determine whether the stability of the cell line shifts with passage.

7. PCR detection of serine protease gene expression in different cell lines

7.1 extraction of Total RNA from monoclonal cell lines

<1> the ST cells to be lysed were added to a 1.5ml centrifuge tube, centrifuged at 3000rpm for 5min, the supernatant was removed, the cell pellet was homogenized, then washed with 1ml PBS, centrifuged at 3000rpm for 5min, and the supernatant was removed.

<2>According to 5X 10⁵Adding 0.5ml of Trizol into each cell, adding precooled Trizol, and after uniformly blowing by a gun, freezing and storing cell lysis samples at-80 ℃ or directly extracting; if extracted directly, the cell sample needs to be left at room temperature for 5 minutes for sufficient lysis.

<3> adding 0.1ml chloroform, shaking at high speed for 1min with a shaker, mixing the cell sample to pink, standing at room temperature for 10min, and centrifuging at 13000rpm at 4 ℃ for 15 min.

<4> carefully pipette the upper clear colorless liquid into a new 1.5ml centrifuge tube (taking care not to suck the middle white floc), add equal amount of isopropanol, mix well by inversion, stand at room temperature for 10 minutes, centrifuge at 12000rpm at 4 ℃ for 15min, remove the supernatant, add 1ml 70% ethanol solution (prepared with DEPC water) to wash the precipitate, centrifuge at 10000rpm at 4 ℃ for 10min, and repeat washing RNA precipitation once.

<5> carefully discard the supernatant and reverse-buckle the centrifuge tube onto clean absorbent paper, after completely blotting the residual liquid, dry at room temperature for 15 minutes, add 20ul DEPC water and incubate at 56 ℃ for 10 minutes, fully dissolve RNA, RNA samples can be stored at-80 ℃ or direct RT.

Note that: RNA extracted in the experimental process is easily degraded by RNase which widely exists in the nature, and consumable materials and reagents used in the RNA extraction are ensured to be free of RNAase so as to avoid the RNA from being degraded in the extraction process.

7.2 reverse transcription PCR

<1> Microtube the following template RNA/primer mixture was prepared in a total amount of 6ul, and the names of reagents and amounts used are shown in Table 2.

TABLE 2 reagent names and amounts used

Name of reagent	Amount of the composition used
		Template RNA	500ng
Random primers(25um)	1ul
		RNase free H₂O	Up to 6ul

And 2, uniformly mixing the mixture, preserving the temperature at 70 ℃ for 10 minutes, and rapidly cooling on ice for more than 2 minutes.

<3> the following reverse transcription reaction solutions were prepared in the Microtube described above, and the names of reagents and the amounts used are shown in table 3.

TABLE 3 reagent names and amounts used

Name of reagent	Amount of the composition used
		The above-mentioned RNA/primer denaturing solution	6ul
5X M-MLV Buffer	2ul
		dNTP mix (10 mM each)	0.5ul
RNase Inhibitor(40U/ul)	0.25ul
		RTase M-MLV(RNase H-)(200U/ul)	0.25ul
RNase free H₂O	up to 10ul

Reacting at 30 deg.C for 10min, and keeping at 42 deg.C for 1 hr to obtain cDNA stock solution, which can be frozen at-20 deg.C for storage.

Note that: the reverse transcriptase 5 × Buffer was thawed on ice and shaken well before use. In addition, since RNA is very easily degraded and the RNA sample can be used repeatedly, it is necessary to place the RNA sample on ice at the time of formulating the system and store it at-80 ℃ after use.

6.3 PCR detection of serine protease Gene expression

PCR amplification and gene cloning:

and (3) PCR system: when the monoclonal cell line was selected for PCR, 20ul of the system was used. The number of PCR cycles is about 25-38.

Identifying a PCR reaction system by using the monoclonal cell strain:

template: 50ng of genomic DNA

Primer: upstream and downstream primers 1ul each (10 im)

dNTP：2ul

10x easypfu buffer：2ul

EasyPfu Taq enzyme: 0.5ul

ddH₂O: make up to 20ul

The PCR reaction program for identifying the monoclonal cell strain comprises the following steps:

1/3NS3 gene expression detection primers are: 1/3NS3-F:1/3NS3-R, the sequence information is detailed in SEQ ID NO.3 and SEQ ID NO.4 of Table 1.

Results of the experiment

1. Screening results of cell lines stably expressing serine protease

Adherent cultured E-ST cells were harvested, the supernatant removed and washed twice with PBS, digested with 0.25% trypsin, resuspended in 5ml MEM ALPH medium, centrifuged at 800rmp for 5min, the supernatant removed, resuspended in 200ul electrotransfer medium, 50ug PLJM1-CSFV-1/3NS3 plasmid (as shown in FIG. 1) was added, electroporation was performed with BIO-RAD electrotransfer, the electroporated cells were resuspended in 10ml MEM ALPH cell medium containing 10% NBS, the resuspended cells were plated at 3000 cells/well in 96 well plates for a total of 8 well plates, and E-ST cells were cultured for 24h in 96 well plates under puromycin antibiotic selection pressure for 14 days to obtain a single clone cell line overexpressing serine protease.

The cell growth in a 96-well plate is good, the abundance reaches more than 90 percent, the monoclonal cell strain which over-expresses the serine protease is transferred to a 24-well plate, puromycin is used for culturing 20 monoclonal cell strains which over-express the serine protease in the culture process, the stability of the serine protease expression of the 20 cell strains is respectively evaluated, the detection method is to detect the mRNA level of the serine protease gene in different cell strains and the sensitivity of the cell strains to the CPE of the hog cholera virus by RT-PCR, and the stability of the serine protease gene expression of different generation cells after continuous passage and the stability of CPE after the hog cholera virus infection, and finally selecting 4 ST cell strains which stably express the serine protease, wherein the ST cell strains are No. 10, No. 27, No. 50 and No. 79, these 4 monoclonal cell lines stably expressed the serine protease gene during passage from P5 to P25 during cell passage.

A stock solution of classical swine fever virus with TCID50 of 7.0 was detected by immunofluorescence using different monoclonal cell lines. The evaluation of the monoclonal cell strain is repeated for 2 times, and the main purpose is to obtain a cell strain which can be used for detecting the swine fever TCID50 by replacing an immunofluorescence method through primary screening. As shown in Table 4, the results of detecting CSFV TCID50 with different monoclonal cell strains are shown, each of the different monoclonal cell strains detects CSFV, and the cell strain with error of + -5% of the result of detecting CSFV TCID50 is 50# by comparing the stability of CPE of the cell strain after infection with CSFV, so the cell strain used by the detection kit is 50# ST-1/3NS3 cell strain.

TABLE 4 results of detecting CSFV TCID50 by different monoclonal cell strains

Monoclonal number	TCID50	Monoclonal number	TCID50	Monoclonal number	TCID50
						1#	6.5	30#	6.5	50#	7.0
2#	6.25	32#	6.25	62#	7.5
						10#	6.0	33#	7.5	63#	9.0
15#	7.5	35#	6	77#	6.5
						22#	6.5	38#	6	78#	6.0
23#	7.5	40#	6.25	79#	7.5
						27#	8.0	42#	6.5	55#	6

2. Swine fever virus titer detection by using 50# ST-1/3NS3 monoclonal cell strain

The kit is innovative in that the TCID50 of the CSFV is calculated by CPE of cells by using ST cell strain over-expressing serine protease, the TCID50 value of the CSFV is calculated and compared with the titer of the CSFV detected by immunofluorescence, and the accuracy of the titer of the CSFV TCID50 detected by ST-1/3NS3 monoclonal cell strain is deduced by comparing the parallelism of the two methods.

The virus liquid for detecting the titer of the classical swine fever virus is 3 samples of which the TCID50 value is determined by an immunofluorescence method, the classical swine fever virus liquid samples are detected by the two methods for 3 times, the classical swine fever virus samples are detected by ST-1/3NS3 monoclonal cell strains, corresponding results are recorded, and the detection results of the two detection methods are shown in Table 5. The calculation is carried out by a Reed-Muench two-handed method, 5 swine fever virus samples are used for measuring a TCID50 value by an immunofluorescence method and a CPE method, and the error range is +/-5 percent, which indicates that the CPE method can be carried out by replacing the immunofluorescence methodThe swine fever virus TCID50 is detected, and the parallelism of the experimental result of the CPE method is better than that of the immunofluorescence method. The specific steps of the immunofluorescence method for detecting the CSFV TCID50 are that the logarithmic phase growth ATCC-ST cells are taken, digested and resuspended, then spread on a 96-well plate, cultured by MEM Alph culture medium containing 10% FBS, and placed in CO₂37 ℃ CO of 5% in the cell box₂Culturing, and testing when the cell abundance reaches more than 90% on the next day; discarding the culture medium in a 96-well plate, washing with sterile PBS for 5 times, adding 100ul of 80% acetone into each well, and fixing at 4 ℃ for 30 min; discarding acetone, and washing with sterile PBS for 5 times; the hog cholera E2 antibody is diluted at a ratio of 1:400, 100ul is added into each well, and the mixture is incubated at 37 ℃ for 1 hour; discarding the hog cholera E2 antibody, washing with sterile PBS for 5 times, adding goat anti-mouse FITC secondary antibody, adding 100ul per well, and incubating at 37 deg.C for 1 hr; the liquid was discarded, washed 5 times with sterile PBS, and finally 100ul of sterile PBS was added to each well and observed under a fluorescence microscope, and the results were recorded.

TABLE 5 comparison of stability of CPE assay and immunofluorescence assay

Detection method	①TCID50	②TCID50	③TCID50
				ST-1/3NS3 monoclonal cell line assay	7.0	7.0	7.0
Immunofluorescence detection	6.75	7.0	7.25

3. Swine fever virus titer detection by using cells of different generations of 50# ST-1/3NS3 monoclonal cell strain

Since the ST-1/3NS3 monoclonal cell line may have the condition that the cell character is deviated along with the cell passage, in order to avoid the detection result deviation caused by the cell character deviation, the detection of the classical swine fever virus TCID50 is respectively carried out on the cells of 50# ST-1/3NS3 monoclonal cell strains, P5, P10, P15, P20 and P25, the TCID50 value of the detected samples detected by immunofluorescence is 7.0, the classical swine fever sample TCID50 is evaluated by 50# ST-1/3NS3 monoclonal cell strains of different generations, the experimental result is shown in Table 6, the result of the classical swine fever sample evaluated by the CPE method is detected and calculated to be within the value range, the result is in an acceptable range, therefore, the TCID50 values obtained by detecting the cells of different generations are accurate and reliable, so that the ST cells of the P5-P20 generations can be used for detecting the TCID50 of the classical swine fever virus.

TABLE 6 results of detecting CSFV virus TCID50 with 50# ST-1/3NS3 monoclonal cell strain of different generations

Generation of cell	①TCID50	②TCID50	③TCID50
				P5	7.0	7.0	7.0
P10	7.0	7.0	7.0
				P15	7.0	7.0	7.0
P20	7.25	7.0	6.75
				P25	6.5	6.75	6.5

Conclusion

The kit for detecting the CSFV TCID50 instead of immunofluorescence is developed, the repeatability and the accuracy of the test result of detecting the CSFV TCID50 by using the kit are good, and the test verifies that the ST-1/3NS3 cells of P5-P20 generation can be used for detecting the CSFV TCID 50.

The technical solutions not described in detail in the present invention can all adopt the known techniques or methods in the field.

Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and are not limited. Although the present invention has been described in detail with reference to the embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> Beijing Dingshou Biotechnology Co., Ltd

Zhuhai Dingan Biological Products Co.,Ltd.

<120> monoclonal cell strain for stably expressing serine protease, preparation method thereof, kit containing cell strain and application

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aaaaagctag cgccaccatg gggcctgccg tttgcaag 38

<210> 2

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aaaaaattcg aattatctga attctcccct gttcatagtc g 41

<210> 3

<211> 18

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Cys Thr Gly Cys Cys Gly Thr Thr Thr Gly Cys Ala Ala Gly Ala Ala

1 5 10 15

Gly Gly

<210> 4

<211> 19

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Thr Cys Thr Cys Cys Cys Cys Thr Gly Thr Thr Cys Ala Thr Ala Gly

1 5 10 15

Thr Cys Gly

<210> 5

<211> 678

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gccaccatgg ggcctgccgt ttgcaagaag gttaccgaac atgagaaatg caccacatcc 60

ataatggaca aattgactgc ttttttcggt gttatgccaa ggggcaccac acctagagcc 120

cctgtgagat tccccacctc tctcttaaag ataagaaggg ggttagaaac tggctgggcg 180

tatacacacc aaggtggtat tagttcagtg gaccatgtca cttgcgggaa agacttactg 240

gtatgtgaca ctatgggccg gacaagggtc gtttgccaat caaataataa gatgacagac 300

gagtccgagt atggagttaa aactgactcc ggatgcccgg aaggagctag gtgttatgtg 360

ttcaacccag aggcagtcaa catatcaggg actaaaggag ccatggtcca cttacaaaaa 420

actggaggag aattcacctg tgtgacagca tcaggaaccc cggccttctt tgacctcaag 480

aacctcaaag gctggtcagg gctaccgata tttgaggcat caagtggaag ggtagtcggc 540

agggtcaagg tcgggaagaa tgaggactct aaaccaacca agcttatgag tggaatacaa 600

acagtctcca aaagtaccac agacttgaca gaaatggtaa agaagataac gactatgaac 660

aggggagaat tcagataa 678

Claims

1. A monoclonal cell strain for stably expressing serine protease gene has the preservation number of CGMCC No. 17415.

2. A kit for detecting the amount of a half infection of a classical swine fever virus, comprising the monoclonal cell line stably expressing a serine protease gene according to claim 1.