CN110615845B - Bifunctional protein with IgG (immunoglobulin G) binding activity and biotin binding activity and immune PCR (polymerase chain reaction) kit thereof - Google Patents

Abstract

The invention provides a bifunctional protein with IgG (immunoglobulin G) binding activity and biotin binding activity and an immune PCR (polymerase chain reaction) kit thereof, which are characterized in that: has the nucleotide sequence shown as SEQ ID NO. 5. The recombinant protein, fusion protein G-SA disclosed by the invention can efficiently capture target molecules at high density, achieve rapid and high-sensitivity detection, can be widely combined with human and various animal total IgG and IgG of different subclasses, and has higher binding force than the existing immunoglobulin binding molecule compared with the existing immunoglobulin binding molecule in the prior art.

Description

Bifunctional protein with IgG (immunoglobulin G) binding activity and biotin binding activity and immune PCR (polymerase chain reaction) kit thereof

Technical Field

The invention relates to the field of immunodetection, in particular to a bifunctional protein G-SA with IgG (immunoglobulin G) binding activity and biotin binding activity and an immune PCR (polymerase chain reaction) kit thereof.

Background

Streptococcal protein G is a protein capable of combining with IgG and Human Serum Albumin (HSA) of various mammals, and SPG has strong affinity with IgG and wide combination spectrum. Studies have shown that three homologous amino acid sequences C1, C2, and C3 regions of SPG are associated with the binding of the IgG fc end of the antibody, and that the binding capacity of the C3 region to IgG is equivalent to 7-fold that of the C1 region (Kobatake, 1990). The A, B region of SPG has binding activity to the Fab fragment of antibodies and binding activity to serum albumin, and is thought to interfere with the action of antibodies and antigens and to cause nonspecific reactions.

Streptavidin (SA) is a tetrameric protein secreted by streptomyces avidinii and has similar biological properties to Avidin (AV). SA binds with high specificity to biotin, and one streptavidin molecule can bind with four biotin molecules, forming a biotin-streptavidin system. This system is considered one of the most stable non-covalent interactions and has a wide range of applications in the biotechnology field, such as molecular labeling, molecular localization and targeted drug delivery.

Schistosomiasis japonica is a zoonosis which is widely distributed and seriously harmful in China, the infection problem of schistosomiasis japonica is generally concerned by all countries in the world, and schistosomiasis japonica diagnosis plays an important role in schistosomiasis japonica prevention and treatment. At present, the definite diagnosis of schistosomiasis is still based on the excrement to detect eggs or miracidia, but the method is lack of sensitivity, the egg count is different from person to person, the diagnosis effect on slightly infected schistosomiasis patients, late schistosomiasis and infected people in epidemic areas which are effectively prevented and treated is not ideal, and missed diagnosis often occurs. At present, the application of immunological methods to diagnose patients is becoming more and more extensive, but the immunological detection systems established so far have higher sensitivity and specificity, but have no ideal effective method for early diagnosis and curative effect assessment of patients. Therefore, a rapid, sensitive and specific detection means is established, and the method is particularly important for diagnosing the schistosoma japonicum katsurada infection.

It has been shown that IBPs are widely used as immunochemical reagents for the identification and purification of antibodies, as a booster reagent in immunoassays and ELISA systems, as a fusion partner to facilitate the immobilization and purification of recombinant proteins, and as a clinically used in vitro immunoadsorption, and have become very valuable tools for diagnosis, treatment and preparation. However, the broad spectrum and the binding force of the existing IBPs are still not high, and the production cost is high. Further, the method of using an enzyme labeled with an enzyme such as alkaline phosphatase for labeling the G protein has a problem of low detection sensitivity. In addition, there are also some species that have poor thermal stability and are sometimes deactivated during processing. The conventional enzyme-labeled proteins, such as alkaline phosphatase and horseradish peroxidase, are subjected to a complicated set of operations, such as coupling reaction with chemical reagents, purification, and dialysis. The products obtained by the method have various problems of protein inactivation, uneven labeling and the like.

Disclosure of Invention

The invention mainly solves the technical problem of providing a quick and high-sensitivity immunoassay product and method, and realizing efficient and high-density immunoassay.

The invention reconstructs the G protein which is combined with multi-species IgG and streptavidin to form a novel dual molecule which has the activity of combining with the IgG and the biotin, so that the obtained recombinant protein has high purity and stable quality, is matched with the existing commercial biotin-labeled enzyme, not only realizes the combination with an antibody, but also combines the biotin-labeled enzyme, and realizes the antibody labeling. Because the DNA marked by biotin is introduced, the signal can be further amplified through PCR, the sensitivity is higher than that of a single marked G protein marking enzyme, and the application field is wider due to the characteristics of G protein and streptavidin.

In order to realize the technical scheme, the invention provides a fusion protein, which is based on the characteristics of an SPG C3 region and SA, and the two genes are connected to reconstruct the bifunctional protein G-SA which has IgG binding activity and biotin binding activity.

The invention also provides a cross-linking agent which is the bifunctional protein G-SA and can link biotin-labeled D N A and antibody IgG through G-SA recombinant protein. Therefore, the recombinant protein can be used as a cross-linking agent for immunological diagnosis.

The invention also provides a cross-linking agent in the immune PCR system, wherein the cross-linking agent is the bifunctional protein G-SA.

The invention also provides an immune PCR method, which is similar to the basic principle of ELISA technology, and is characterized in that ELISA takes enzyme as a marker, the content of the antigen to be detected is reacted according to the color development degree of an enzyme catalysis substrate, and immune PCR takes a section of DNA molecule as the marker, and the detection result is indicated according to the product quantity of a PCR amplified DNA reporter molecule.

In order to realize the purpose of the invention, the invention adopts the following technical scheme:

a bifunctional protein G-SA having both IgG binding activity and biotin binding activity, comprising a Streptococcal Protein G (SPG) fragment and an SA protein, wherein the Streptococcal Protein G (SPG) fragment is a sequence containing a C3 segment of SPG;

the invention also provides a codon optimized sequence, which is used for carrying out codon optimization on the SPG and SA sequences, so that the protein expression amount is improved and the solubility is increased after splicing.

Wherein the connection sequence between the Streptococcal Protein G (SPG) fragment and the SA protein is shown as SEQ ID NO. 8;

the nucleotide sequence of the Streptococcal Protein G (SPG) fragment is shown as SEQ ID NO. 6;

the nucleotide sequence of the SA protein is shown as SEQ ID NO. 7;

the nucleotide sequence of the bifunctional protein G-SA is shown as SEQ ID NO. 5;

the invention also provides a construction method of the bifunctional protein G-SA, which comprises the following steps:

(1) PCR amplifying a C3 sequence from a bacterial solution containing a C3 fragment according to the gene sequence of the C3 fragment of the G protein;

(2) amplifying an SA sequence from a bacterial liquid containing the SA sequence by PCR;

(3) firstly, connecting the amplified SA sequence to an expression vector after double enzyme digestion, and connecting the C3 fragment after double enzyme digestion after identification to construct a prokaryotic expression plasmid of the recombinant protein;

(4) transferring the expression vector into an expression host for culture, and adding induced epialbumin after the expression vector is activated to a logarithmic growth phase;

(5) crushing and purifying to obtain the fusion protein G-SA

Wherein, the primer pair used in the step (1) is shown as SEQ ID NO.1 and SEQ ID NO. 2;

the primer pair used in the step (2) is shown as SEQ ID NO.3 and SEQ ID NO. 4;

in the above method, the expression and purification of the fusion protein gene can be performed by methods conventionally used in the art for protein expression and purification, for example, cloning the fusion protein gene into an expression vector, transferring the expression vector and/or a co-expression vector into an expression host for culture, adding the induced surface albumin after activation to a logarithmic growth phase, and obtaining the fusion protein after crushing and purification. The invention does not limit the types and categories of the expression vector, the co-expression vector and the expression host, and can select the vector and the host which are used for genetic modification in the field, concretely, the expression vector can be pET-28, pET-32, pET-15 or pET-11, etc., and the co-expression vector can be pCDFDuet-1, etc.; the expression host may be selected from E.coli, B.subtilis, B.megaterium, Corynebacterium, Saccharomyces cerevisiae, Pichia pastoris or mammalian cells.

In the present invention, cloning can be performed by, for example, chain enzyme Polymerization (PCR).

Further, the present invention provides an immuno-PCR method, wherein the method:

1. preparing a biotin labeled DNA reporter molecule;

2. detecting by an immune PCR method;

3. and (6) judging a result.

Wherein, the step 1 specifically comprises the following steps: amplifying biotinylated DNA as a reporter molecule of immune PCR by using an upstream primer I marked by biotin and a downstream primer II without the biotin through PCR;

the step 2 specifically comprises the following steps:

(1) coating:

(2) sealing;

(3) adding a primary antibody;

(4) G-SA is added;

(5) adding biotin-labeled DNA;

(6) pre-denaturation;

(7) PCR amplification;

(8) and (4) electrophoresis.

In the present invention, the above-described immuno-PCR method can be used for various types of immunoassays, such as antibody detection, antibody screening, antigen detection, pathogen detection, protein interaction screening, high-throughput target protein detection, protein-nucleic acid interaction analysis, drug screening, and the like.

Advantageous effects

(1) The invention reconstructs the IgG binding fragment of the SPG gene, only retains the C3 area which can be specifically bound with the Fc end of the antibody IgG by the protein G, and is connected with SA, and the prepared recombinant protein has the double functions of IgG binding activity and biotin binding activity.

(2) The fusion protein G-SA can efficiently and high-density capture target molecules, and achieves rapid and high-sensitivity detection.

(3) The fusion protein G-SA of the invention has simple and easy preparation process, can be suitable for different immunodetection modes, such as indirect ELISA, sandwich ELISA, immune PCR and the like, only replaces one reagent in the original detection method, does not change the original operation steps, and does not need additional equipment and instruments.

Drawings

Fig. 1 shows a schematic structure of SPG.

FIG. 2 shows PCR identification of recombinant protein prokaryotic expression plasmid, wherein M: a nucleic acid marker; 1: a G-SA fragment; 2: a C3 fragment; SA fragment.

FIG. 3 double restriction enzyme identification of recombinant plasmid, wherein M: nucleic acid marker 1: PET-28a empty vector; 2: a G-SA fragment.

FIG. 4 SDS-PAGE analysis of pET-28a (+) -C3-SA expression, wherein M: a protein marker; 0: no IPTG induction; 1.2, 4, 6, 8: IPTG induction was carried out for 1h, 2h, 4h, 6h and 8 h.

FIG. 5 SDS-PAGE analysis of pET-28a (+) -C3-SA supernatant protein purification

M: a protein marker; 1: ultrasonically crushing the supernatant; 2: after sample loading; 3: ultrasonically crushing the precipitate; 4: after the Binding Buffer is purified; 5: after Washing Buffer purification; 6: after purification of the Strip Buffer.

FIG. 6 Western blotting to detect the binding activity of G-SA protein with IgG, biotin and His antibodies of different species

FIG. A: 1: protein marker; 2: mouse-rabbit resistant; and (B) in the figure: 1: protein maker; 2: the donkey can resist sheep;

and (C) figure: 1: protein maker; 2: goat anti-mouse; and (D): 1: protein maker; 2: rabbit anti-goat;

FIG. E: 1: protein maker; 2: HRP-bio; FIG. F is a drawing: 1: protein maker; 2: his antibody.

FIG. 7G-SA affinity constant curves for different species of antibody, biotin

FIG. 8 electrophoresis results in biotin-labeled DNA reporter gels

M: marker; 1: a PCR negative control; 2: biotin-labeled DNA

FIG. 9 is a control experimental diagram of the positive and negative of immuno-PCR

M: marker; 1-5: rabbit positive sera 1:1000, 1:2000, 1: 4000. 1:8000, 1:16000 dilution

6: rabbit negative serum is diluted 1: 100; 7: rabbit positive serum was diluted 1: 100.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

EXAMPLE 1 construction of recombinant proteins

1.1 biological Material

Escherichia coli BL21 was purchased from Nanjing Novozam Biotech, Inc.; SA (calumniate Standby, Zhang Yuanjuan, in case of expression and purification of core streptavidin in Pichia pastoris [ J ]. J.J. J. J.Biometrics, 2018,31(05): 485) 488), SPG (Series, Zhao Dengyun, Hongsuan, Luke, Lihao, Lin rectification, Von gold waves, Xuyumei, and Zhu Fang Streptococcus protein G domain reconstruction, expression and identification [ J ]. Chinese animal science of infectious diseases [ 2015,23(05): 46-52), plasmid pET-28a (+) were stored in the laboratory.

1.2 construction and Synthesis of recombinant protein G-SA

Primers were designed based on the C fragment of spG and the streptavidin gene sequence using Primer5 software, and enzyme cleavage sites were added to the upstream and downstream primers, respectively, with the Primer sequences shown in Table 1.

TABLE 1 amplification primers

And transferred to BL 21.

1.3 recombinant plasmid identification

Performing PCR reaction on the reconstructed G-SA sequence, wherein the reaction system is as follows:

after the components are mixed uniformly, the mixture is placed in a PCR instrument for reaction through short-time centrifugation, and the reaction parameters are as follows:

the annealing temperatures are as follows:

and (3) performing electrophoresis identification (figure 2) and double enzyme digestion identification (figure 3) on the PCR product, wherein the sequencing identification result shows that the sequence is consistent with the designed sequence. The size of the whole target gene fragment is about 680 bp. The size of the C3 fragment is about 170bp, and the size of the SA fragment is about 480 bp.

(C3 upstream and downstream primers for fragment PCR: SEQ ID NO.1, 2; upstream and downstream primers for SA PCR: SEQ ID NO.3, 4; upstream and downstream primers for full-fragment PCR: SEQ ID NO.1, 4)

EXAMPLE 2 expression and purification of recombinant proteins

2.1 expression of the recombinant plasmid

Time phase:

(1) selecting appropriate amount of BL21 puncturing bacteria containing target fragment, inoculating to 5ml Kan-containing bacteria ⁺ The LB liquid medium of (1) was placed in a shaking incubator at 37 ℃ and shaking-cultured at 250 rpm.

(2) When the growth reached the logarithmic phase (OD 600 was about 0.6), IPTG was added to a final concentration of 0.1mmol/L for induction of expression. 0.5ml of bacterial liquid is respectively taken before induction expression and 1h, 2h, 4h, 6h and 8h after induction expression, and SDS-PAGE electrophoresis is applied to analyze the optimal induction time.

SDS-PAGE analysis shows (figure 4), the recombinant plasmid pET-28a (+) -C3-SA is successfully expressed in Escherichia coli BL21 (DE 3), the expression level of 1-8h after 1mmol/L IPTG induction is not obviously changed along with the increase of time, and the expression level reaches the highest and tends to be stable after 2h of induction. When the induction time exceeds 4h, the expression quantity of the hybrid protein is increased continuously, so that the target protein

Since the expression level of (2) is reduced, the induction time is preferably 2 hours.

And (3) large-scale expression:

(1) selecting appropriate amount of BL21 puncture bacteria containing target fragment, inoculating to 150ml Kan-containing bacteria ⁺ The LB liquid medium of (1) was placed in a shaking incubator at 37 ℃ and subjected to shaking culture at 250 rpm.

(2) When the strain grows to a logarithmic phase (OD 600 is about 0.6), adding IPTG (isopropyl thiogalactoside) with the final concentration of 0.1mmol/L for induction expression, centrifuging the induced strain liquid at 5000rpm for 15min, discarding supernatant, resuspending the precipitate with 10ml Binding buffer, repeatedly freezing and thawing for three times, carrying out ice-bath ultrasonication for 25min (2 s over 9 s), centrifuging at 5000rpm for 15min, and collecting the precipitate and supernatant.

(3) The centrifuged precipitate was resuspended in 5ml of 8mol urea, dissolved on ice for 2h, the centrifugation step was repeated and the supernatant was collected.

(4) Adding the supernatant after ultrasonic treatment and the supernatant after the sediment is resuspended into equal volume of protein electrophoresis buffer solution respectively, and analyzing the solubility of the expression product by SDS-PAGE electrophoresis.

2.2 purification of recombinant proteins

The recombinant protein was purified using Ni-NTA Hisbind Resin (SEQ ID NO: 70666-3) according to the kit instructions, and the simple procedures were as follows:

(1) adding 5ml of resin into a new empty column, standing and balancing, and when the liquid level falls to the surface of the resin, sequentially carrying out the following steps;

(2) with 2CV ddH ₂ O*2，charge buffer *3，binding buffer*2;

(3) 50ul of sample is left before sample loading;

(4) 3CV Binding Buffer 3 (just plus need to leave 50ul of supernatant);

(5) 3CV Wash Buffer 2, with 50ul;

(6) 2CV Elution Buffer 2, with 50ul remained;

(7) a small amount of Strip Buffer (3ml) was repeatedly loaded and left, and 50ul of the sample was taken.

(8) The collected solutions were subjected to SDS-PAGE to analyze protein purification.

SDS-PAGE analysis shows (figure 5), the protein expressed by the recombinant plasmid pET-28a (+) -G-SA exists in ultrasonic supernatant and sediment, and the protein content in the sediment is higher than that in the supernatant, which indicates that the protein has certain water solubility. The recombinant protein ultrasonic supernatant is purified by Ni-NTAHisdinbdResin and then is purified after being eluted by Strip Buffer.

Example 3 identification of G-SA recombinant protein Activity

3.1 Western blotting detection of the binding Activity of recombinant proteins with IgG

(1) The purified protein was subjected to SDS-PAGE, after which the protein was transferred to NC membrane at 130mA for 75 min.

(2) The NC membrane was soaked in 5% skimmed milk powder diluted in PBST and sealed for 2h at room temperature.

(3) The blocked NC membranes were washed three times with PBST for 5min each.

(4) The NC membrane was incubated with goat anti-mouse IgG, rabbit anti-goat IgG, mouse anti-rabbit IgG, donkey anti-goat IgG, biotin (diluted with PBST 1: 2000) as an antibody for 1h at room temperature.

(5) Incubated NC membranes were washed three times with PBST for 10min each.

(6) And developing the NC membrane by using a DAB two-component developing solution kit, washing with running water after developing, and terminating the reaction.

The results show that the recombinant protein G-SA has the binding capacity with rabbit IgG, donkey IgG, mouse IgG, sheep IgG, biotin and the like. (FIG. 6)

3.3 determination of the affinity constant of recombinant proteins to IgG of different species by ELISA

(1) The concentration of the recombinant protein was determined by the BCA method, and commercial Standard Protein G (SPG) was used as a control.

(2) Proteins were diluted in coating solution in multiples of 10. mu.g/ml for a total of 8 dilutions, coated in 100. mu.l per well in 96-well plates, 3 replicates per concentration setting, and coated overnight at 4 ℃.

(3) The 96-well plate was washed three times with PBST, 200. mu.l per well, 5min each time.

(4) A solution of 5% skimmed milk powder diluted with PBST was added, 150. mu.l per well, and blocked at 37 ℃ for 2 h.

(5) The 96-well plate was washed three times with PBST, 200. mu.l per well, 5min each time.

(6) HRP-labeled goat anti-mouse IgG, rabbit anti-goat IgG, mouse anti-rabbit IgG, donkey anti-goat IgG and biotin were diluted with PBST at a ratio of 1:500, 1:1000, 1:2000 and 1:4000, and incubated at 37 ℃ for 2h in 100. mu.l each well.

(7) The 96-well plate was washed three times with PBST, 200. mu.l per well, 5min each time.

(8) TMB was added thereto for color development, and 100. mu.l of each well was reacted at room temperature for 15 min.

(9) 2mol/L H was added ₂ SO ₄ The reaction was stopped and 30. mu.l/well was read for OD 450.

And (3) performing curve fitting by taking the OD450 value as a vertical coordinate and the logarithm value of the antigen concentration as a horizontal coordinate, substituting the affinity curve into a corresponding formula according to the fitted curve as shown in FIG. 7, respectively calculating affinity constants Ka, and taking the average of the obtained Ka values to obtain the affinity constant value of the recombinant protein, wherein the result is shown in Table 2.

TABLE 2 affinity constants of G-SA with different species of antibody, biotin

Antibodies	Affinity constant
		Goat	4.12*10^4
Donkey meat	1.26*10^5
		Rabbit	5.12*10^4
Mouse	1.03*10^5
		HRP-bio	7.73*10^4

The result shows that the recombinant protein has the capacity of combining SPG with IgG of different species and the function of combining SA with biotin, and is a novel bifunctional recombinant protein. The affinity constants of the recombinant protein were determined by western and ELISA, and the recombinant protein was shown to have the ability to bind IgG and biotin.

Example 4 ImmunoPCR detection of Schistosoma japonicum antibodies in serum

4.1 preparation of Biotin-labeled DNA reporter

Red Fluorescent Protein (RFP) DNA is used as a template (PET-28 a (+) -RFP stored in Shanghai veterinary research institute), and 340bp of biotinylated DNA is amplified by PCR by using an upstream primer I marked by biotin and a downstream primer II not marked by biotin and is used as a reporter molecule of the immune PCR.

An upstream primer: 5 ' ATGGCCTCCTCCGAGAACGTCATCAC 3 ' (biotin-labeled at the 5 ' end) (SEQ ID NO.9)

A downstream primer: 5 'AGACTACTATCTTGGGTAACCGTGG 3' (SEQ ID NO.10)

The reaction system is as follows:

components	Required amount (mu l)
		TaKaRaTaq™ Hot Start Version	25
Gene sequences	2
		Upstream primer (10. mu.M)	2
Downstream primer (10. mu.M)	2
		ddH 2 O	19
Total	50

After the components are mixed uniformly, the mixture is placed in a PCR instrument for reaction through short-time centrifugation, and the reaction parameters are as follows:

temperature of	Reaction time
		94℃	3min
94℃	30s
		60.0℃	30s 20cycles
72℃	1min
		72℃	10min
4℃	infinite

The PCR product of the RFP template was identified by 1.5% agarose gel electrophoresis and set to ddH ₂ As a negative control, PCR was performed using O as a template.

The result of the observation by the ultraviolet gel imaging system is shown in fig. 8, and the result shows that the PCR performed by using the PET-28a (+) -RFP as the template can amplify a target band, the size of the band is 430bp, no band is amplified by the negative control, the verification is correct, the design of the primer is correct, and no false positive is generated.

4.2 detection of antibody against Schistosoma japonicum by immuno-PCR

(1) Coating: the coating solution diluted soluble antigen (SEA) of Schistosoma japonicum eggs to 0.5ug/ml, 100 ul/well, and 4 ℃ overnight.

(2) And (3) sealing: 5% skimmed milk powder 200 ul/well, 37 ℃ blocking 1h, PBST washing three times.

(3) Adding a primary antibody: using a confining liquid 1: 1000. the rabbit Schistosoma japonicum positive serum is diluted at the ratio of 1:2000, 1:4000, 1:8000 and 1:16000, and the 1:100 rabbit Schistosoma japonicum negative serum and the 1:100 rabbit Schistosoma japonicum positive serum are respectively diluted by sealing liquid and washed for three times by PBST at the temperature of 37 ℃ and the concentration of 80 ul/hole.

(4) Adding G-SA: G-SA was diluted to 100ng/ml with PBS, 70 ul/well, washed three times with PBST at 37 ℃ for 2 h.

(5) Add 4.1 the biotin-labeled DNA prepared: the DNA-bio was diluted to 1ng/ml with PBS, 50 ul/well, 37 ℃ for 2h, washed three times with PBST and three times with sterile water, after which 50ul of heated sterile water was added to each well.

(6) Pre-denaturation: quickly placing on ice at 96 deg.C for 10-15min, and taking small amount (2-5 ul) of supernatant as PCR template.

(7) And (3) PCR amplification: the PCR was performed under the same conditions as in 4.1 using conventional primers.

(8) Electrophoresis: and (3) carrying out electrophoresis on the PCR product in 1.5% agarose gel, observing the result by an ultraviolet gel imaging system and storing pictures, wherein the experimental result is shown in figure 9, and the result shows that the negative serum hole diluted by 1:100 does not amplify a target strip, and the positive serum diluted by 1:100 has an amplified target fragment, so that the serum detection performed by the method is feasible and has no false positive. The detection carried out by the method after the rabbit positive serum is diluted in a gradient way, and weak positive is still detected when the rabbit positive serum is diluted to 1:16000, which shows that the method has extremely high sensitivity.

The embodiments described above are described to facilitate an understanding and use of the invention by those skilled in the art. It will be readily apparent to those skilled in the art that various modifications to these embodiments may be made, and the generic principles described herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the above embodiments, and those skilled in the art should make improvements and modifications within the scope of the present invention based on the disclosure of the present invention.

<110> Shanghai animal doctor institute of Chinese academy of agricultural sciences (Shanghai center of Chinese centers of animal health and epidemiology)

<120> bifunctional protein having IgG binding activity and biotin binding activity and immuno-PCR kit thereof

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> DNA

<213> C region upstream primer

<400> CCG GGA TCC ACT TAC AAA C

<210>2

<211> 19

<212> DNA

<213> C region downstream primer

<400> GCT ACCACC ACC ACC ACT G

<210>3

<211> 25

<212> DNA

<213> SA region upstream primer

<400> GAT CCG AGC AAA GAT AGC AAA GCC C

<210>4

<211> 23

<212> DNA

<213> SA region downstream primer

<400> GGC CTC GAG TTA TTG CTG AAC AG

<210>5

<211>675

<212> DNA

<213> nucleotide sequence of recombinant protein G-SA

<400>ACTTACAAACTTGTTATTAATGGTAAAACGCTGAAGGGTGAAACCACCACCAAAGCGGTGGATGCCGAAACCGCGCAGAAGGCCTTTAAGCAGTACGCCAACGACAATGGCGTGGATGGTGTTTGGACCTACGACGACGCGACCAAAACCTTTCGTGTTACCGAAGGCGGTGGTGGCAGTGGTGGTGGTGGTAGCGATCCGAGCAAAGATAGCAAAGCCCAAGTGAGTGCCGCGGAAGCCGGCATTACGGGTACGTGGTACAACCAGCTGGGCAGCACCTTCATTGTTACGGCGGGTGCCGATGGTGCCCTCACCGGTACGTACGAAAGCGCGGTTGGCAATGCCGAAAGCCGTTACGTGCTGACCGGTCGTTATGATAGTGCGCCAGCGACCGATGGTAGTGGTACCGCGCTGGGTTGGACCGTTGCGTGGAAGAACAACTACCGCAATGCCCATAGCGCCACGACGTGGAGCGGTCAGTACGTTGGCGGTGCCGAAGCCCGTATCAATACGCAGTGGCTGCTGACCAGCGGTACGACCGAAGCGAATGCGTGGAAAAGTACGCTGGTGGGCCACGATACGTTCACCAAGGTGAAGCCAAGCGCCGCGAGCATCGATGCGGCCAAAAAAGCCGGCGTGAATAATGGCAACCCTCTAGACGCTGTTCAGCAATAA

<210>6

<211>165

<212>DNA

<213> nucleotide sequence of recombinant protein SPG fragment

<400>ACTTACAAACTTGTTATTAATGGTAAAACGCTGAAGGGTGAAACCACCACCAAAGCGGTGGATGCCGAAACCGCGCAGAAGGCCTTTAAGCAGTACGCCAACGACAATGGCGTGGATGGTGTTTGGACCTACGACGACGCGACCAAAACCTTTCGTGTTACCGAA

<210>7

<211>480

<212> DNA

<213> nucleotide sequence of recombinant protein SA fragment

<400>GATCCGAGCAAAGATAGCAAAGCCCAAGTGAGTGCCGCGGAAGCCGGCATTACGGGTACGTGGTACAACCAGCTGGGCAGCACCTTCATTGTTACGGCGGGTGCCGATGGTGCCCTCACCGGTACGTACGAAAGCGCGGTTGGCAATGCCGAAAGCCGTTACGTGCTGACCGGTCGTTATGATAGTGCGCCAGCGACCGATGGTAGTGGTACCGCGCTGGGTTGGACCGTTGCGTGGAAGAACAACTACCGCAATGCCCATAGCGCCACGACGTGGAGCGGTCAGTACGTTGGCGGTGCCGAAGCCCGTATCAATACGCAGTGGCTGCTGACCAGCGGTACGACCGAAGCGAATGCGTGGAAAAGTACGCTGGTGGGCCACGATACGTTCACCAAGGTGAAGCCAAGCGCCGCGAGCATCGATGCGGCCAAAAAAGCCGGCGTGAATAATGGCAACCCTCTAGACGCTGTTCAGCAATAA

<210>8

<211>30

<212> DNA

<213> nucleotide sequence of linker sequence

<400>GGCGGTGGTGGCAGTGGTGGTGGTGGTAGC

<210>9

<211>26

<212> DNA

<213> upstream primer

<400> ATGGCCTCCTCCGAGAACGTCATCAC

<210>10

<211>25

<212> DNA

<213> downstream primer

<400> AGACTACTATCTTGGGTAACCGTGG

Claims (1)

1. A method of immunopcr of non-diagnostic interest, wherein said method:

1) preparing a biotin labeled DNA reporter molecule;

2) detecting by an immune PCR method;

3) judging a result;

wherein, the step 1) is specifically as follows: amplifying biotinylated DNA as a reporter molecule of immune PCR by using an upstream primer I marked by biotin and a downstream primer II without the biotin through PCR;

the step 2) is specifically as follows:

(1) coating:

(2) sealing;

(3) adding a primary antibody;

(4) G-SA is added;

(5) adding biotin-labeled DNA;

(6) pre-denaturation;

(7) PCR amplification;

(8) electrophoresis;

the G-SA is a bifunctional protein G-SA and comprises a streptococcal protein G fragment and an SA protein, wherein the streptococcal protein G fragment is a sequence containing a C3 segment of SPG, and the nucleotide sequence of the G-SA is shown in SEQ ID NO. 5.

Images