CN110607280A

CN110607280A - Application of EMC3 gene and site-directed knockout method thereof

Info

Publication number: CN110607280A
Application number: CN201910806212.1A
Authority: CN
Inventors: 谢胜松; 赵书红; 李新云; 刘海龙; 王子畅; 赵长志; 肖天贺; 聂雄伟; 张金福; 阮进学; 韩晓松
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2019-08-28
Filing date: 2019-08-28
Publication date: 2019-12-24

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of an EMC3 gene and a site-specific knockout method thereof, wherein an EMC3 gene is modified in a targeted manner through a gene editing technology, and a base of a coding region is changed to cause a frameshift mutation, so that an EMC3 gene knockout cell strain is obtained. Experiments prove that EMC3 protein is lack in expression by changing the nucleotide sequence of EMC3 gene in a swine kidney cell (PK-15), and the proliferation of epidemic encephalitis B virus (JEV) can be obviously interfered, so that host cells can be effectively protected from being infected and invaded by the JEV to induce death. Multiple sequence alignment analysis shows that the EMC3 gene sequence is highly conserved in pigs, human and mice. Therefore, the EMC3 gene can be used as a gene editing target for resisting Japanese encephalitis or used for developing a medicament for resisting the Japanese encephalitis.

Description

Application of EMC3 gene and site-directed knockout method thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of an EMC3 gene and a site-specific knockout method thereof.

Background

Infectious diseases caused by pathogenic microorganisms have been a major obstacle affecting the efficient development of the global pig industry. Economic loss of pig raising caused by infectious diseases is estimated to be as high as 400 billion yuan every year in China, and particularly since 2018, African swine fever is introduced into China, so that the domestic pig raising industry is seriously injured. China is the biggest pig breeding and pork consuming country in the world, and epidemic situations not only affect the pig industry, but also affect related international trade. How to effectively prevent and control the occurrence of diseases is always the focus of animal husbandry attention. Although vaccination plays an important role, it has not always been possible to completely control and eliminate the epidemic of infectious diseases. In the long run, the resistance of the pig to the pathogen can be essentially improved by adopting a genetic strategy, so that the effect of permanent cure is achieved by developing disease-resistant breeding research. With the increasing maturity of molecular biology technology, a series of advances are made in the research of breeding for disease resistance, such as the sequential discovery of interferon gene, MX1, defensin, NRAMP1 and MHC candidate gene for breeding for disease resistance. Particularly, CRISPR/Cas9 technology is started, combined with nucleus transplantation technology or fertilized egg microinjection technology, pig CD163 and ANPEP genes are respectively and successfully changed, and the disease-resistant pig capable of effectively resisting infection and replication of Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) or transmissible gastroenteritis virus (TGEV) is prepared, so that important reference is provided for developing genome editing and disease-resistant breeding. Although some disease-resistant genes of pathogenic microorganisms have been identified, the types of bacteria or viruses that can infect pigs are very many, and thus, the research intensity is still required to be enhanced, and continuous disease-resistant breeding research is carried out.

Epidemic encephalitis B (JE) is a zoonosis with insect mosquito as a transmission medium caused by encephalitis B virus (JEV). JEV is transmitted mainly in the pig-mosquito-human cycle, where pigs are important amplification storage hosts for JEV, poisonous mosquitoes transmit JEV to humans by biting, and humans are the final hosts. Most patients with JEV infection present with occult infection, and even after healing, irreversible brain inflammation and severe nervous system injury remain. JEV infected pigs are usually sporadic and recessive, can cause abortion of pregnant sows, acute orchitis or infertility of boars and the like, and bring great economic loss to the pig industry. JEV invading cells are the prerequisite for inducing encephalitis B, and the elucidation of the invading mechanism provides more ways for preventing and treating encephalitis B. Therefore, controlling the Japanese encephalitis epidemic can not only reduce the loss of the pig industry, but also has important significance on the health of human beings.

In recent years, the mechanism of JEV infection of cells has been studied intensively. It has now been found that JEV can infect many types of cells of porcine, mouse and human origin, such as PK-15 cells, U251 cells, MDSCs cells, Vero cells, Neuro2a cells, HEK293 cells and the like, and the process is mainly divided into three steps, i.e., recognition and binding of the virus to a host cell surface receptor, entry into the host cell via an endocytic pathway, and release of nucleic acid by peeling, but the pathway of JEV infection into the host cell has not been clarified so far. Therefore, the development of the interaction research of the JEV and the host is helpful for further understanding the infection mechanism of the JEV and is helpful for developing new antiviral drugs or developing gene editing anti-virus breeding work.

At present, various technologies can be used for researching the interaction mechanism of viruses and hosts, and a newly developed genome-wide CRISPR/Cas9 library-based knockout strategy is one of powerful approaches for screening disease-resistant genes. The CRISPR/Cas9 technology is a powerful helper for gene function research by virtue of the advantages of low cost, convenient operation, high efficiency and the like, and is a third-generation genome fixed-point editing technology which appears after a zinc finger endonuclease (ZFN) and a transcription activator effector nuclease (TALEN). Compared with the prior two-generation technology, the CRISPR/Cas9 technology has the greatest breakthrough that not only a single gene can be edited, but also a plurality of genes can be simultaneously edited, thereby providing an effective method for whole genome screening. Designing and constructing a sgRNA library targeting the whole genome of the species, infecting a Cas9 stable expression cell strain after packaging lentiviruses, enriching a positive mutant cell library by using flow cytometry, then infecting a wild type cell library and a mutant cell library respectively by using the viruses, enriching the surviving cells, performing high-throughput sequencing to identify the screened sgRNA, and mapping corresponding host factors.

According to the invention, EMC3 gene is taken as a research object, an EMC3 gene editing cell strain is constructed by a CRISPR/Cas9 technology, and a series of molecular and virology experiments are combined to prove that EMC3 gene is knocked out in pig-derived kidney cells (PK-15), and the deletion of EMC3 protein expression can obviously interfere with JEV replication. Through research and development, no research report about the participation of EMC3 gene in mediating JEV replication is found at present. Therefore, the invention provides a new material for developing JEV infection resistant medicines and developing the research on pig disease resistance breeding.

Disclosure of Invention

The invention aims to provide a novel application of EMC3 gene, wherein EMC3 protein is deleted and expressed, so that the replication capacity of JEV in host cells can be obviously reduced, and the gene can be used as a gene editing target point for resisting Japanese encephalitis or used for developing a medicament for resisting the Japanese encephalitis.

The invention also aims to provide a method for site-directed knockout of EMC3 gene, which utilizes CRISPR/Cas9 lentivirus and flow sorting technology to perform frame shift mutation on the protein coding sequence of EMC3 gene to cause EMC3 protein expression deletion, thereby preparing EMC3 gene knockout cell strain.

In order to achieve the purpose, the invention adopts the following technical measures:

the EMC3 gene is applied, specifically, EMC3 protein is deleted and expressed by adopting a genetic engineering technology (such as ZFN, TALEN, CRISPR/Cas9 technology and the like), so that JEV is inhibited from being replicated in host cells.

Preferably, the EMC3 gene is knocked out by using a CRISPR/Cas9 system, and the sgRNA targeting sequence used is the first exon of EMC3 gene.

EMC3 gene is used as a target point, and is applied to the preparation of drugs for preventing and treating animal infection with Japanese encephalitis virus.

EMC3 gene is used as a target point and is applied to the preparation of gene editing cells or animal models with resistance to epidemic encephalitis B.

An EMC3 gene knockout cell strain is constructed by using a CRISPR/Cas9 technology, and the construction method comprises the following steps:

(1) designing a specific sgRNA targeting an EMC3 gene protein coding region by using software, cloning a sgRNA fragment onto a vector, and constructing a target sgRNA expression vector with a GFP screening marker;

(2) introducing a target sgRNA expression plasmid into a cell stably expressing Cas9 protein by a lentivirus packaging and infection method, sorting GFP positive cells by a flow cytometer, detecting a DNA sequence by TA cloning and detecting the expression condition of EMC3 protein by a WesternBlot technology, and selecting an EMC3 protein-deleted gene knockout cell strain.

Preferably, the nucleotide sequence of the sgRNA is 5'-CGATTGGCAGGACCACCCAGAGG-3', and the PAM sequence contained therein is AGG.

Through multiple sequence alignment of nucleotide and amino acid sequences of EMC3 genes of pigs, people and mice, the EMC3 gene sequences from different species are found to be highly conserved, so that JEV replication can be inhibited after the EMC3 genes from different species are edited by the genes.

Compared with the prior art, the invention has the following advantages:

(1) the invention comprehensively adopts a plurality of methods to evaluate the influence of targeted editing of EMC3 gene on the replication of JEV in host cells, and adopts the following main technical means: detecting the influence of EMC3 gene knockout cell strains on the copy number of the JEV encoding C gene and the virus titer at different time points by using absolute quantification and a plaque experiment; detecting the expression influence of the EMC3 gene knockout on the JEV-encoded NS3 gene by using an immunofluorescence technology; resistance of EMC3 knockout cells to JEV-induced cell death was assessed using RTCA real-time label-free cell analysis techniques. The influence of knocking EMC3 gene on the reproduction of JEV in PK-15 cells is respectively verified by a plurality of layers by a plurality of different experimental techniques, so that the accuracy of the result is improved.

(2) Epidemic encephalitis B is a zoonosis caused by JEV. Infection of pigs is manifested by high fever, abortion, stillbirth and orchitis. Although the Japanese encephalitis vaccine is an effective measure for preventing epidemic Japanese encephalitis, no effective therapeutic drug exists at present because the JEV infection mechanism is not clear, and an effective molecular target is mainly lacked. According to the invention, through molecular and virology experimental researches, the highly conserved EMC3 gene of human, mouse and pig is knocked out at fixed points by using a gene editing technology, so that EMC3 protein is deleted, JEV replication can be obviously inhibited, and the EMC3 gene is proved to be a key host factor participating in the JEV replication. Therefore, the invention provides a new target for developing anti-JEV medicaments, gene editing cells and preparing animal models.

(3) The invention also provides a method for efficiently constructing an EMC3 gene knockout cell model, preferably a CRISPR/Cas9 technology, provides a specific efficient sgRNA sequence which is designed and screened by software, and can be used for efficiently preparing an EMC3 protein deletion cell strain. The method also provides technical reference and carrier materials for constructing the EMC3 gene knockout animal model.

Drawings

FIG. 1, EMC3 gene knockout cell strain constructed by CRISPR/Cas9 technology

A. Schematic diagram of sgRNA targeting EMC3 gene first exon using software design; B. the genotype of the 2 strain EMC3 gene editing cell line was examined by TA clone sequencing. bp represents base pair, KO represents knock-out, -represents the number of bases deleted, + represents the number of bases inserted, (n/m) represents the number of times this genotype appeared in the TA clone sequencing. PAM represents a pro-spacer sequence adjacent motif (protospacer adjacent motif). FIG. 2, Western Blot technology is used for detecting the expression of EMC3 protein, namely Tubulin, in a gene knockout cell strain, and the beta-Tubulin is used as a positive internal reference, and WT represents a control group of cells which are not edited by CRISPR/Cas 9.

FIG. 3 evaluation of the Effect of EMC3 Gene of knockout host cell on JEV replication Using plaque assay

WT represents control cells without CRISPR/Cas9 editing, MOCK represents WT cells without JEV treatment, hpi represents time after viral infection.

FIG. 4 evaluation of the Effect of EMC3 Gene of knockdown host cell on copy number of JEV-encoding C Gene Using fluorescent quantitative PCR assay

WT represents control cells without CRISPR/Cas9 editing.

FIG. 5 shows that the effect of knocking out host cell EMC3 gene on expression of JEV encoding gene NS3 is detected by immunofluorescence assay

WT represents control cells without CRISPR/Cas9 editing, DAPI represents staining of the nucleus, NS3 represents JEV-encoded gene, and Merge represents DAPI and NS 3.

FIG. 6 comparison of the number of EMC3 knock-out cells with wild-type cells 72h after JEV infection using cell growth experiments

WT represents control cells without CRISPR/Cas9 editing, MOI represents viral multiplicity of infection, hpi represents time after viral infection, EMC3-ko (sorted) represents flow sort enriched GFP positive cells after lentiviral infection.

FIG. 7 evaluation of EMC3 knock-out cell line resistance to JEV-induced cell death by RTCA real-time label-free cell assay

WT represents control cells that were not subjected to CRISPR/Cas9 editing, and JEV added represents the addition of JEV-RP9 to cells at this time point.

FIG. 8 shows the multi-species conservation analysis of pig EMC3 gene sequence

Detailed Description

The technical scheme of the invention is a routine scheme in the field if not specifically stated, and the reagent or the biological material is disclosed if not specifically stated.

Example 1: construction of EMC3 Gene knockout cell line by Gene editing technology

First, the exon sequence of pig EMC3 gene (accession number: ENSSSCG00000011562.3) and the whole genome sequence of pig (version number: Sus _ scrofa. sscrofa11.1) were downloaded from the ensemble database (www.ensembl.org), respectively, and then sgrnas targeting pig EMC3 gene (table 1) were designed using sgRNAcas9 software (www.biootools.com), and the best sgrnas were selected according to the results of specificity evaluation, with sgRNA ID EMC3_ a _47 and target sequence "CGATTGGCAGGACCACCCAGAGG", and the whole genome miss evaluation revealed that it had no miss-target sites with 1 and 2 base mismatches (fig. 1A).

Table 1 design and evaluation of sgRNA targeting porcine EMC3 gene using software

Further, sgRNA primers were designed and synthesized based on the lenti-sgRNA-EGFP lentiviral vector as a backbone, as follows EMC 3-sgRNA-F: 5'-caccgCGATTGGCAGGACCACCCAG-3', EMC 3-sgRNA-R: 5'-aaacCTGGGTGGTCCTGCCAATCGc-3', annealing the primer, and connecting the annealed primer with the enzyme-digested linearized lenti-sgRNA-EGFP vector to construct the target plasmid. The specific reaction system and conditions are as follows:

vortex and mix 5 μ l of EMC3-sgRNA-F (10 μm) and EMC3-sgRNA-R (10 μm) uniformly, and the mixture is heated to 95 ℃ for 10min on a PCR instrument; and (3) denaturing and annealing at 65 ℃ for 1h, uniformly mixing with a linear lenti-sgRNA-EGFP vector which is subjected to enzyme digestion and purification recovery by BbsI (NEB), and standing and connecting for 30min at 16 ℃.

The ligation products are transformed into competent Escherichia coli DH5a by a heat shock method, then the competent Escherichia coli DH5a is spread in an AMP + resistant LB solid culture dish and is placed in an incubator at 37 ℃ for overnight culture, and monoclonal colonies are selected for amplification culture and then sent to a company for sequencing, wherein sequencing primers are U6-F: 5'-ACTATCATATGCTTACCGTAAC-3' are provided. And (3) carrying out amplification culture on the bacterial liquid which is successfully sequenced and identified, and extracting plasmids by using an OMEGA endotoxin-removing plasmid extraction kit, wherein the extracted plasmids are named as lenti-sgRNA-EMC 3. Then packaging lenti-sgRNA-EMC3 lentivirus, infecting PK-15 cells to construct an EMC3 gene knockout cell strain, wherein the specific experimental flow is as follows:

the previous day, HEK 293T cells were seeded at 10cm²And (4) packaging the lentivirus in a culture dish when the concentration is 70% -90%. First, a total of 24. mu.g of a substance (psPAX2: PMD2.G: lenti-sgRNA-EMC 3: 1:2:3) was added to 500. mu.L of Jetprime Buffer, vortexed and mixed, 40. mu.L of Jetprime transfection reagent was added, vortexed and mixed, and allowed to stand for 10 min. Then, the above solution was added to 10cm of a 2% FBS medium in an amount of 5ml in advance²In the culture dish, 5% CO is put back at 37 DEG C₂Culturing in an incubator. Changing the culture solution for 6h to 10mL of 2% FBS culture medium, supplementing 10mL of the same culture medium for 24h, continuously culturing until 60h, collecting the supernatant, centrifuging at 4 ℃ of 30000rpm/min for 3h, pouring out the supernatant, taking 200 mu L of precooled PBS for resuspending lentivirus precipitation, dispersing overnight at 4 ℃ and freezing at-80 ℃.

And infecting a PK-15 cell strain which stably expresses Cas9 with sgRNA lentivirus targeting EMC3 gene, culturing for 48h, sorting GFP positive cells by using a flow cytometer, and simultaneously sorting single cells to a 96-well culture plate to select a monoclonal cell strain. A pig EMC3 gene sequence is downloaded from an ensemble database, and PCR primers for detecting a sgRNA target region, EMC3-PCR-F: 5'-CCACTTACCCGCCAAGAAGT-3' and EMC3-PCR-R: 5'-GATGAGAAACCCCGGCAAAC-3', are designed. The monoclonal cell DNA extracted by the TIANGEN blood/tissue/cell DNA extraction kit is used as a template for PCR amplification, and the specific PCR reaction system and conditions are as follows:

and (3) PCR reaction system:

and (3) PCR reaction conditions:

after PCR amplification is finished, connecting a purified PCR product with a PMD19-T vector, carrying out transformation plating culture, picking 5 monoclonal colonies each time, carrying out amplification culture, and sending the amplified colonies to a company for sequencing and genotyping. Comparing the gene sequences of the wild cell strains, the EMC3-KO #1 and EMC3-KO #16 two cell strains EMC3 genes are found to have frameshift mutation. As shown in FIG. 1, EMC3-KO #1 has 2 types of base sequence changes, namely, deletion of 1 base, simultaneous deletion of 1 base and insertion of 2 bases; EMC3-KO #16 had only one form of base change, being a deletion of 1 base.

Furthermore, the expression of EMC3 protein of the 2 cell strains is detected by Western Blot technology, and the specific experimental flow is as follows:

inoculating monoclonal cells into a six-well culture plate, setting PK-15 wild type cells for stably expressing Cas9 as a control group, adding 1mM PMSF and 100 mu l RIPA lysate into each well until the convergence reaches about 90%, cracking the cells in ice bath for 30min, centrifuging at 13000rpm at 4 ℃ for 20min, collecting supernatant, and determining the concentration by using a BCA protein quantitative kit. Taking 40 mu g of denatured protein sample, carrying out polyacrylamide gel electrophoresis, cutting a target band according to the molecular weight of EMC3 protein, simultaneously cutting a beta-tubulin protein electrophoresis band as a positive reference, respectively and simultaneously transferring two groups of proteins to a PVDF membrane by using a wet transfer membrane method, sealing the PVDF membrane by using skimmed milk powder, incubating overnight at the primary antibody at 4 ℃, and developing after incubating secondary antibodies. As shown in FIG. 2, the 3-strain cell beta-tubulin protein is well expressed, the EMC3 protein is not expressed at all in the EMC3-KO #1 and EMC3-KO #16 cells, and the EMC3 protein is well expressed in the wild-type cell, so that the EMC3 gene knockout cell strain is successfully constructed.

Example 2: absolute quantification and plaque experiments show that EMC3 gene knockout can obviously inhibit the replication capacity of JEV in host cells

In order to detect whether the knockout of the EMC3 gene can inhibit the replication of JEV in PK-15 cells, the influence of two monoclonal cell strains, namely EMC3-KO #1 and EMC3-KO #16, on the replication of the JEV is detected by using absolute quantification and a plaque experiment, and the specific experimental flow is as follows:

first, multiple groups of EMC3-KO #1 and EMC3-KO #16 cells were simultaneously inoculated, and PK-15 wild-type cells stably expressing Cas9 were set as a control group. And (3) adding JEV-RP9 wild-type viruses with corresponding volumes into each hole according to the MOI of 1 when the concentration reaches about 50%, shaking uniformly, putting the mixture back into a cell culture box for culture, changing the culture medium to 2% FBS for continuous culture in the 2h, collecting culture plates at different time points of 2h, 12h, 24h, 36h, 48h and the like, repeatedly freezing and thawing for 2 times at-80 ℃, and taking a culture solution containing the viruses for absolute quantification and a plaque experiment.

One day before the plaque experiment, BHK cells are inoculated to a twelve-hole culture plate, and virus inoculation is carried out when the concentration reaches about 40%. Firstly, diluting a virus culture solution by using DMEM according to a multiple dilution method to obtain virus suspensions with different dilutions; then, 500. mu.l each of the infected BHK cells was taken, and three replicates were set for each dilution. And (3) inoculating the virus change solution for the 2h to 1mL of DMEM (2 x) culture medium containing 2% FBS, 1% double antibody and 50% low-melting-point agarose, standing at room temperature, after the culture medium is completely solidified, putting the culture medium back to an incubator to continue culturing until obvious plaques are generated, performing 10% neutral formaldehyde fixation and crystal violet staining, and calculating the virus titer (PFU/mL) according to a formula of the virus titer being the number of the plaques/the volume of the virus suspension/the dilution degree. As shown in fig. 3, the number of plaques produced by each group at 2h was substantially similar compared to the wild-type control group at the same dilution, indicating that EMC3 gene had no significant effect on JEV invasion; 12h, 24h and 36h, the EMC3-KO #1 and EMC3-KO #16 cells generate obviously reduced plaques, the virus titer is obviously reduced, statistical tests show that the EMC3-KO #1 and EMC3-KO #16 groups have obvious difference from the control group, and the 12h difference is most obvious.

For each treatment group, 200. mu.l of virus-containing culture medium was used for absolute quantification and the copy number of JEV was determined. Firstly, extracting virus RNA by using a Takara kit, and then carrying out reverse transcription to obtain cDNA, wherein the reverse transcription method comprises the following specific steps:

1. reactions for removing genomic DNA

The reaction conditions are as follows: 42 ℃ for 2 min; 4 ℃ for 2 min.

2. Reverse transcription reaction (SYBR Green qPCR method)

The reaction conditions are as follows: 15min at 37 ℃; 5s at 85 ℃; 4 ℃ for 2 min.

And carrying out fluorescent quantitative PCR amplification by using the cDNA as a template according to a SYRB Green qPCR method. First, specific quantitative PCR primers were designed and synthesized for the JEV-encoded C gene as follows: JEV-C-F: 5'-GAGCTTGTTGGACGGCAGAG-3' and JEV-C-R: 5'-CACGGCGTCGATGAGTGTTC-3'; then, carrying out fluorescent quantitative PCR amplification by taking the plasmid which is diluted by multiple times and encodes the JEV-C gene as a template to obtain the correlation between the Ct value and the copy number and draw a standard curve; the experimental samples were then amplified, with three replicates per group. The specific reaction system and conditions of the fluorescent quantitative PCR are as follows:

reaction system:

the reaction conditions are as follows:

and (3) calculating the corresponding virus copy number according to the standard curve aiming at the Ct value obtained by the fluorescent quantitative PCR. As shown in fig. 4, at the same dilution, the virus copy number of each group at 2h was substantially similar compared to the wild-type control group, indicating that EMC3 gene had no significant effect on JEV invasion; the virus copy numbers of 12h, 24h, 36h and 48h, EMC3-KO #1 and EMC3-KO #16 are obviously reduced, and the EMC3-KO #1 and EMC3-KO #16 groups are significantly different from the control group by statistical tests, and the difference at 12h is most significant.

Example 3: by using immunofluorescence experiments, the EMC3 gene knockout can obviously inhibit the expression of JEV encoding protein in host cells

Further, the expression of the JEV encoding gene NS3 at 12h when the JEV infects EMC3-KO #1 and EMC3-KO #16 cells was detected by immunofluorescence assay. The specific experimental procedures are as follows:

inoculating EMC3-KO #1 and EMC3-KO #16 cells, setting PK-15 wild type cells stably expressing Cas9 as a control, adding JEV-RP9 wild type viruses with corresponding volumes according to MOI (equal to 1) into each well when the concentration reaches about 90%, shaking uniformly, putting back to a cell culture box for culture, and continuously culturing for 12h by changing 2h to 2% FBS culture medium. Fixing the cells in the 12h with paraformaldehyde PFA, treating with 0.3% Tritonx-100, adding a blocking solution, carrying out warm blocking for 1h, carrying out primary antibody NS3(JEV) incubation at 4 ℃ overnight, and carrying out DAPI staining after secondary antibody incubation for 2h at room temperature in a dark place, thus carrying out fluorescence imaging. As a result, as shown in FIG. 5, NS3 protein was not expressed in the JEV-uninoculated wild-type cells, NS3 protein was expressed in large amounts in the JEV-uninoculated wild-type cells, and NS3 protein was not expressed at all in the JEV-inoculated EMC3-KO #1 and EMC3-KO #16 cells. In conclusion, immunofluorescence experiments demonstrated that knocking out EMC3 gene significantly affected expression of JEV-encoding gene NS3 in PK-15 cells.

Example 4: observation of cytopathic effect of JEV-infected EMC3 gene knockout cell strain

In order to directly observe the pathological effect and the cell survival state caused by the JEV infection of the cells after the EMC3 gene is knocked out, RTCA (real Time Cellular analysis) and an inverted microscope cell imaging technology are used for simultaneous detection.

The effect of JEV seeded at different MOIs on cell growth was monitored using inverted microscope cell imaging techniques. Firstly, inoculating a GFP positive cell group which is flow-sorted, namely EMC3-KO (sorted) cells, setting PK-15 wild type cells which stably express Cas9 as a control, adding JEV-RP9 wild type viruses with corresponding volumes according to different MOIs when the aggregation degree reaches about 40%, shaking up, putting the cells back to a cell culture box for culture, changing the cells to 2% FBS culture medium for culture for the second hour, and observing the survival state of the cells, wherein the MOIs are set to be two gradients of 0.03 and 1. As shown in FIG. 6, the survival rate of cells was very low or almost non-viable in the wild-type treated group when infected at different MOIs, whereas the cells survived in large amounts and almost non-dead in the EMC3-KO (sorted) group.

The survival status of cells after JEV infection was monitored in real time using RTCA (roche RTCA dp). Approximately the same number of EMC3-KO #1 and EMC3-KO #16 cells were seeded, PK-15 wild type cells stably expressing Cas9 were set as a control, corresponding volumes of JEV were seeded at MOI ═ 1, the number of viable cells was read every 15min on RTCA instrument until 60h to derive cell growth curves. WT represents PK-15 wild type cells stably expressing Cas9, MOCK represents no vaccination with JEV. As shown in FIG. 7, the number of cells in the WT-JEV group was extremely decreased at about 20h after JEV inoculation, whereas the growth of cells in the other treatment groups except the WT-JEV group was good. Two sets of experimental results show that the knockout of the EMC3 gene does not affect normal cell growth and can resist cell death caused by JEV replication.

Example 5: analysis of species conservation of EMC3 Gene sequences Using bioinformatics strategy

From the NCBI nucleic acid database (https:// www.ncbi.nlm.nih.gov /), mRNA sequences of EMC3 genes from pig (accession number: XM-003358517.4), mouse (accession number: NM-175101.3) and human (accession number: NM-018447.3) were downloaded, respectively. The CDS sequence of mRNA sequence is inputted into ORF on-line software (https:// www.ncbi.nlm.nih.gov/orffinder /) of NCBI, and can be extracted, and then compared by using multi-sequence comparison program CLUSTALW (https:// www.genome.jp/tools-bin/CLUSTALW), and as a result, as can be seen from FIG. 8, CDS sequence comparison similarity score of pig and human EMC gene is 94.2748, pig and mouse is 91.2214, and human and mouse is 90.8397. Indicating that the EMC gene similarity of pig and human is relatively high. The CDS sequence is translated into a protein coding amino acid sequence by using ORF software, and the CLUSTALW program is also used for carrying out multi-sequence alignment analysis, so that the length of the protein coding amino acid sequence of the EMC3 gene is 261 amino acids, the alignment similarity of the pig and human EMC protein sequences is 99.6169, the pig and mouse are 99.2337, and the mouse and human are 99.6169, which shows that the protein coding amino acid sequence of the EMC3 gene is very conservative and has only one amino acid difference. It is presumed that the EMC3 gene functions highly consistently in pigs, humans, and mice. Based on this, we predict that EMC3 gene targeting human, mouse and pig by using gene editing technology can be knocked out at fixed points, and all the genes can have significant inhibition effect on the replication of JEV in host cells of different species.

Claims

The application of EMC3 gene, which is characterized in that the protein coded by EMC3 gene is deleted and expressed, thereby inhibiting the replication of epidemic encephalitis B virus in host cells.
2. The use according to claim 1, wherein EMC3 gene is knocked out based on CRISPR/Cas9 system.
3. The use according to claim 2, characterized in that the sgRNA targeting sequence employed by CRISPR/Cas9 system is the first exon of EMC3 gene.
4, the EMC3 gene is used as a target point to prepare a medicament for preventing and treating animal infection with epidemic encephalitis B virus.
Application of EMC3 gene as target in preparation of gene editing cell or animal model with resistance to epidemic encephalitis B.
6. The method for site-specific knockout of EMC3 gene is characterized by comprising the following steps:

(1) designing a specific sgRNA targeting an EMC3 gene coding region by using software, cloning a sgRNA fragment onto a vector, and constructing a target sgRNA expression vector with a GFP screening marker;

(2) introducing a target sgRNA expression vector into a cell stably expressing Cas9 protein by a lentivirus packaging and infection method, sorting GFP positive cells by a flow cytometer, detecting a DNA sequence by TA cloning and detecting the expression condition of EMC3 protein by a Western Blot technology, and selecting an EMC3 protein-deleted gene knockout cell strain.
7. The method for site-directed knockout of EMC3 gene according to claim 6, wherein the sgRNA used has a nucleotide sequence of 5'-CGATTGGCAGGACCACCCAGAGG-3'.
8. The EMC3 gene knockout cell line produced by the method of claim 6.