CN110590927B - Gecko verrucosa antioxidant peptide and application thereof - Google Patents

Gecko verrucosa antioxidant peptide and application thereof Download PDF

Info

Publication number
CN110590927B
CN110590927B CN201910877775.XA CN201910877775A CN110590927B CN 110590927 B CN110590927 B CN 110590927B CN 201910877775 A CN201910877775 A CN 201910877775A CN 110590927 B CN110590927 B CN 110590927B
Authority
CN
China
Prior art keywords
antioxidant
g3cy
gecko
lys
cath3
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910877775.XA
Other languages
Chinese (zh)
Other versions
CN110590927A (en
Inventor
蔡莎莎
李龙彬
王冠男
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
JINING MEDICAL UNIVERSITY
Original Assignee
JINING MEDICAL UNIVERSITY
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by JINING MEDICAL UNIVERSITY filed Critical JINING MEDICAL UNIVERSITY
Priority to CN201910877775.XA priority Critical patent/CN110590927B/en
Publication of CN110590927A publication Critical patent/CN110590927A/en
Application granted granted Critical
Publication of CN110590927B publication Critical patent/CN110590927B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/142—Amino acids; Derivatives thereof
    • A23K20/147—Polymeric derivatives, e.g. peptides or proteins
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A23L33/18—Peptides; Protein hydrolysates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00—General protective or antinoxious agents
    • A61P39/06—Free radical scavengers or antioxidants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/08—Anti-ageing preparations
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Abstract

The invention relates to gecko verrucosa antioxidant peptide and application thereof, belonging to the technical field of biomedicine. The antioxidant peptide Gj-CATH3 derived from natural sources is obtained by separation, purification and gene cloning methods, contains 42 amino acid residues, has a molecular weight of 5249.28Da, and has an isoelectric point of 9.99. The Gj-CATH3 modified body comprises two types, G3CY-5 and G3CY-10, which are linear chain polypeptides, respectively consist of 5 and 10 amino acid residues, the molecular weight is 655.77Da and 1267.49Da respectively, and the isoelectric points are 8.2 and 8.86 respectively. The three antioxidant peptides have strong antioxidant activity, simple structure, small molecular weight, extremely low hemolysis and simple preparation method, and have good application prospect in the field of preparing antioxidant medicaments, food additives and cosmetics.

Description

Gekko verrucosa antioxidant peptide and application thereof
Technical Field
The invention relates to a natural antioxidant peptide from medicinal gecko verrucosus and preparation methods and application of two modifications thereof, belonging to the technical field of biomedicine.
Background
Modern medicine's theory of free radicals in relation to aging states that aging occurs in humans due to disease and destruction of ' free radicals '. The so-called "free radical" is a highly unstable molecule with an excess of electrons, a by-product of metabolism. Most of these molecules destroy the oxide of cell membrane and DNA, resulting in oxidative damage such as oxidative degeneration of lipid, protein and DNA, and thus causing a series of chronic diseases such as diabetes, arteriosclerosis and cancer. Despite the existence of antioxidant defense systems in the body, they are not completely effective in defending or repairing damage from oxidation. Therefore, it is an important research topic to properly scavenge free radicals and maintain them at a low level in vivo, thereby delaying aging.
In addition, the oxidation reaction of the nutritional ingredients in food can also generate peroxide, thereby affecting the nutritional value of food and even causing diseases, and the search for safe antioxidants to inhibit the generation of peroxide is a research focus of biochemistry and nutrition. Most of the antioxidants widely used at present are chemical compounds such as BHA (butylated hydroxyanisole), BHT (butylated hydroxytoluene), PG (propyl gallate), etc., and although they have good antioxidant effects, they have accumulative carcinogenic effects on the liver, spleen and lung of human body. People are therefore gradually turning their eyes to natural antioxidants.
At present, natural antioxidants developed and researched at home and abroad mainly comprise spice extracts, tea polyphenols, natural flavonoids, vitamins, proteins, enzymes and the like. Among them, some natural antioxidant peptides have been the base materials with great potential for developing novel functional foods and health products because of their effects of scavenging free radicals, quenching singlet oxygen, decomposing peroxides and inhibiting lipid peroxidation, and compared with other antioxidants, they have the characteristics of low toxicity, high efficiency, safety, small molecular weight, easy absorption, etc. Gekko japonicus (Gekko japonicum) has a long medicinal history in China, and in recent years, gecko has been increasingly emphasized due to its wide application in treating various difficult and complicated diseases. However, no research report about gecko antioxidant peptide exists at present.
The invention provides a gecko verrucosa antioxidant peptide Gj-CATH3 of natural source and two modified bodies G3CY-5 and G3CY-10 thereof, wherein the two modified bodies have small molecular weight and simple structure, are linear molecules and are convenient for chemical synthesis and genetic engineering preparation. Compared with other reported antioxidant peptides, the antioxidant activity of G3CY-5 and G3CY-10 is stronger, and the antioxidant peptide can be developed into an excellent template of antioxidant drugs, food additives and active ingredients of cosmetics.
Disclosure of Invention
The invention provides three antioxidant peptides derived from gecko verrucosa and having extremely strong antioxidant capacity, Gj-CATH3 and amino acid sequences of G3CY-5 and G3CY-10 of a modified body thereof. The invention aims to provide preparation methods and applications of the three antioxidant peptides based on the theoretical research and the prior art, and focuses on the applications in antioxidant medicine preparation, food additives and cosmetic active ingredients.
In order to realize the purpose of the invention, the invention provides the following technical scheme:
the technical scheme adopted by the invention is as follows:
a Gekko verrucosus antioxidant peptide has amino acid sequence selected from SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3.
Specifically, the gecko verrucosa antioxidant peptide is selected from gecko verrucosa natural antioxidant peptide Gj-CATH3 and modified bodies thereof G3CY-5 and G3CY-10, wherein: the natural antioxidant peptide Gj-CATH3 of the gecko verrucosus, wherein Gj-CATH3 is linear polypeptide, has the molecular weight of 5249.28Da and the isoelectric point of 9.99, contains 42 amino acid residues, and has the sequence as follows: arginine-glycine-phenylalanine-lysine-proline-tyrosine-glycine-lysine-proline-lysine-valine-alanine-lysine-proline-tyrosine-histidine-cysteine-glycine-tryptophan-lysine-tyrosine-cysteine-glycine-tryptophan-lysine-tyrosine-tryptophan-cysteine-glycine-tryptophan-glycine-tryptophan-lysine-cysteine-glycine-lysine-tyrosine. The primary structure of the complete sequence is: Arg-Arg-Gly-Phe-Phe-Lys-Pro-Tyr-Gly-Lys-Lys-Pro-Lys-Lys-Val-Ala-Lys-Lys-Pro-Tyr-Tyr-His-Cys-Gly-Trp-Lys-Tyr-Cys-Gly-Trp-Lys-Tyr (SEQ ID NO: 1).
The Gj-CATH3 comprises two modifications: g3CY-5 and G3 CY-10:
(1) modified body G3 CY-5: the linear polypeptide has the molecular weight of 655.77Da, the isoelectric point of 8.20, contains 5 amino acid residues, and the sequence is as follows: cysteine-glycine-tryptophan-lysine-tyrosine; the primary structure of the complete sequence is: Cys-Gly-Trp-Lys-Tyr (SEQ ID NO: 2).
(2) Modified body G3 CY-10: the linear polypeptide has the molecular weight of 1267.49Da, the isoelectric point of 8.86, contains 10 amino acid residues, and the sequence is as follows: cysteine-glycine-tryptophan-lysine-histidine-cysteine-glycine-tryptophan-lysine-tyrosine; the primary structure of the complete sequence is: Cys-Gly-Trp-Lys-His-Cys-Gly-Trp-Lys-Tyr (SEQ ID NO: 3).
In another aspect, the present invention provides a nucleotide sequence encoding one or more of the above-mentioned gecko pluripotene antioxidant peptides.
Specifically, the Gj-CATH3 encoding gene: consisting of 126 nucleotides, and having a sequence from 5 'end to 3' end of cggagaggct tctttaaacc atatggcaag aaacccaaga aggttgccaa aaagccgtactatcactgtggctggaagtactgtggctggaagtactgtggctggaagcactgtggctggaagtac (SEQ ID NO: 4).
In another aspect, the present invention provides a recombinant expression vector comprising one or more of the nucleotide sequences described above.
The invention also provides the application of the gecko verrucosa antioxidant peptide, the nucleotide sequence or the recombinant expression vector in preparing antioxidant drugs; and the application of the gecko verrucosa antioxidant peptide, the nucleotide sequence or the recombinant expression vector in preparing antioxidant cosmetics, health products, food and feed additives.
In other embodiments, the invention also provides the application of the gecko verrucosa antioxidant peptide, the nucleotide sequence or the recombinant expression vector in pharmacological activity detection.
The invention has the beneficial effects that: the invention obtains an amino acid sequence and a coding gene of the natural antioxidant peptide Gj-CATH3 of the gecko verrucosus through a gene cloning, separation and purification method. Modified bodies G3CY-5 and G3CY-10 are designed by a molecular modification method according to an amino acid sequence of Gj-CATH3, the two modified bodies show extremely strong antioxidant activity, the clearance rate of DPPH free radicals under the concentration of 20ug/ml can reach 42.96 percent and 43.32 percent respectively, and the clearance rate of ABTS + positive ion free radicals is over 99 percent.
Detailed Description
The following examples are provided to further illustrate the essence of the present invention, but the present invention is not limited thereto.
Example 1 separation and purification of natural antioxidant peptide Gj-CATH3 of Gekko Swinhonis:
Gj-CATH3 is obtained by Sephadex G-50 gel filtration and reversed phase high pressure liquid chromatography (RP-HPLC) separation of crude extract of Gekko verrucosus skin protein.
First, adult gecko (n ═ 20) with good health status was selected, fresh skin tissue was placed in a square dish, washed with a little physiological saline, and homogenized. Dissolving with a small amount of normal saline, and mixing PS solution and n-butanol 1: PS and n-butanol are stirred at room temperature for 60min, 13000r/min and 20min, and the precipitate is then freeze-dried. Subsequently, a first step of Sephadex G-50 gel filtration chromatography: 0.9G of the lyophilized powder was dissolved in 10mL of 0.1M phosphate (Na2HPO4-NaH2PO4, pH 6.0) buffer, centrifuged at 12000rpm for 10min, the supernatant was applied to a well-equilibrated Sephadex G-50 gel exclusion chromatography column (1.6 cm. times.90 cm, Amersham Bioscience), eluted with the same buffer at a flow rate of 3mL/10min, collected in 3 mL/tube using an automatic fraction collector, detected at 220nm and each peak for detection of antibacterial activity, and lyophilized for use.
Second reversed-phase high performance liquid chromatography (RP-HPLC): dissolving the peak of the active component obtained by Sephadex G-50 gel exclusion chromatography in pure water again, centrifuging at 12000rpm for 15min at 4 ℃, taking the supernatant, filtering with a 0.45 mu m filter membrane, collecting the filtrate, loading the filtrate on a C18 reverse phase column (Hypersil BDS C18,30cm x 0.46cm) fully balanced by ultrapure water containing 1 thousandth of trifluoroacetic acid, performing gradient elution by an elution system consisting of acetonitrile (containing 1 thousandth of trifluoroacetic acid), and detecting the polypeptide concentration at 215 nm. The resulting peaks were collected, lyophilized, concentrated, redissolved with sterilized deionized water and tested for antioxidant activity.
The third step is primary structure analysis: molecular weight determination of purified Gj-CATH3 electrospray quadrupole time-of-flight tandem mass spectrometry (ESI-Q-TOF-MS, Biosystems/MDS Sciex Toronto, Canada) was used. Isoelectric point is determined by isoelectric focusing electrophoresis, and amino acid sequence structure is determined by automatic amino acid sequencer.
Example 2 clonal sequencing of the Gj-CATH 3-encoding Gene:
the first step is as follows: extracting total RNA of the gecko verrucosus skin: collecting 300mg Gekko verrucosus skin tissue, placing into mortar, adding liquid nitrogen, grinding into powder, transferring into EP tube, and collecting the powder by RNeasy AxyPrepTMTotal RNA of Gekko verrucosus skin tissue was extracted from the multiple Total RNA Miniprep Kit (Qiagen, union city, CA, USA).
The second step: construction of Gekko verrucosa cDNA library:
the method adopts the In-Fusion SMARTer of CLONTECH companyTM Directional cDNA Library Construction Kit。
(1) First strand cDNA Synthesis (reverse transcription of mRNA):
adding 1 mu l of total skin RNA of the gecko verrucosus, 1 mu l of 3 '-end one-strand synthesis Primer (3' In-Fusion SMARTer CDS Primer) and 2.5 mu l of DEPC (diethyl phthalate) treatment water into a centrifugal tube without RNase to ensure that the total volume reaches 4.5 mu l, mixing uniformly, centrifuging for a short time (2000rpm for 30s), and preserving heat at 72 ℃ for 3 minutes after centrifuging; after incubation, the tubes were incubated at 42 ℃ for 2 minutes.
② adding the following reagents (all In-Fusion SMARTer from CLONTECH)TMPrepared in the directed cDNA Library Construction Kit), 2.0. mu.l of 5 Xfirst strand buffer, 0.25. mu.l of 100mM DTT, 1.0. mu.l of 10mM dNTP Mix, 1.0. mu.l of SMARTer V Oligonucleotide, 0.25. mu.l of RNase Inhibitor and 1.0. mu.l of SMARTScribere Reverse Transcriptase, Mix the reagents in the centrifuge tubes and briefly centrifuge (2000rpm, 30s), incubate at 42 ℃ for 90min, then incubate at 68 ℃ for 10 min. After the incubation treatment, the centrifuge tube was placed on ice to stop the synthesis of the first strand. Mu.l of the first strand of the synthesized cDNA was taken from the centrifuge tube and used.
(2) Amplifying the second strand by long-terminal polymerase chain reaction (LD-PCR) (all reagents are In-Fusion SMARTer from CLONTECH)TMPrepared in the Library Construction Kit of the directive cDNA Library Construction Kit)
Mu.l of cDNA first strand (reverse transcription of mRNA), 80. mu.l of deionized water, 10. mu.l of 10 × Advantage 2PCR buffer, 2. mu.l of 50 × dNTP Mix, 2. mu.l of 5 'PCR primer, 2. mu.l of CDS III/3' PCR primer and 2. mu.l of 50 × Advantage 2Polymerase Mix were mixed in a PCR tube preheated at 95 ℃.
Amplifying in a PCR instrument according to the following procedures: at 95 ℃ for 1 min; 18 cycles: 95 deg.C, 15sec, 65 deg.C, 30sec, 68 deg.C, 6 min. After the circulation was completed, the cDNA double strand synthesized in the centrifuge tube was stored at-80 ℃.
Thirdly, gene clone screening of the gecko verrucosus antioxidant peptide Gj-CATH3
(3) Cloning and screening the gecko verrucosus antioxidant peptide Gj-CATH3 gene:
the forward primer is designed according to the conserved sequence of signal peptide region of cathelicidin of reptile class for PCR amplification, the sequence is 5'-ATCCTGCTGATGCTTGGC-3' (SEQ ID NO:5), and the other amplification primer of PCR is In-Fusion SMARTer of CLONTECHTMThe 3 ' -PCR primer in the direct cDNA Library Construction Kit has the sequence of 5'-CGGGGTACGATGAGACACCAT-3' (SEQ ID NO: 6). The PCR reaction was performed under the following conditions: 94 ℃ for 4min, 94 ℃ for 30sec, 57 ℃ for 30sec and 72 ℃ for 1min, 30 cycles. After the amplification, the target fragment was recovered with a gel recovery kit (Tiangen). The recovered target fragment was ligated to pMD19-T vector (Takara, Dalian) and transformed into CaCl2-MgCl2The method prepares DH5 alpha competent cells. Plating and double screening of ampicillin and blue-white spot, picking single colony and detecting the size of the insert by PCR with M13 primer. Positive colonies were picked, plasmids were extracted by shake culture, and nucleotide sequencing was performed using an Applied Biosystems DNA sequencer, model ABI PRISM 377.
Fourthly, sequencing results:
the coding gene of the Gj-CATH3 precursor peptide consists of 510 nucleotides, and the sequence from the 5 'end to the 3' end is as follows:
Figure BDA0002204912010000071
the sequence table of the cDNA nucleotide for coding the Gj-CATH3 precursor peptide is as follows: the sequence length is 510 bases, and the sequence type is as follows: nucleic acid, number of strands: single strand, topology: linear, sequence type: cDNA, source: gekko Swinhonis skin.
The Gj-CATH3 mature peptide is encoded by a nucleotide sequence from 382 to 507, and the encoded amino acid sequence is as follows:
Arg-Arg-Gly-Phe-Phe-Lys-Pro-Tyr-Gly-Lys-Lys-Pro-Lys-Lys-Val-Ala-Lys-Lys-Pro-Tyr-Tyr-His-Cys-Gly-Trp-Lys-Tyr-Cys-Gly-Trp-Lys-Tyr-Cys-Gly-Trp-Lys-His-Cys-Gly-Trp-Lys-Tyr(SEQ ID NO:1)。
example 3 chemical Synthesis of Gj-CATH3, G3CY-5 and G3 CY-10:
1. the chemical synthesis method of Gj-CATH3, G3CY-5 and G3CY-10 comprises the following steps: based on the amino acid sequence, the full sequence was synthesized by an automatic peptide synthesizer (433A, Applied Biosystems), and desalted by HPLC reverse phase column chromatography.
2. The molecular weight determination was carried out by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF).
3. The purity of the purified Gj-CATH3, G3CY-5 and G3CY-10 is determined by a High Performance Liquid Chromatography (HPLC) method, the molecular weight is determined by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF), isoelectric point is determined by isoelectric focusing electrophoresis, and the amino acid sequence structure is determined by an automatic amino acid sequencer.
The sequencing results were: the natural antioxidant peptides Gj-CATH3, G3CY-5 and G3CY-10 of the gecko verrucosus are linear polypeptides which respectively contain 42, 5 and 10 amino acid residues, the molecular weights are 5249.28Da, 655.77Da and 1267.49Da respectively, and the isoelectric points are 9.99, 8.2 and 8.86 respectively. The complete sequence of the natural antioxidant peptide Gj-CATH3 of the gecko verrucosa is as follows:
Arg-Arg-Gly-Phe-Phe-Lys-Pro-Tyr-Gly-Lys-Lys-Pro-Lys-Lys-Val-Ala-Lys-Lys-Pro-Tyr-Tyr-His-Cys-Gly-Trp-Lys-Tyr-Cys-Gly-Trp-Lys-Tyr-Cys-Gly-Trp-Lys-His-Cys-Gly-Trp-Lys-Tyr(SEQ ID NO:1)。
arginine-glycine-phenylalanine-lysine-proline-tyrosine-glycine-lysine-proline-lysine-valine-alanine-lysine-proline-tyrosine-histidine-cysteine-glycine-tryptophan-lysine-tyrosine-cysteine-glycine-tryptophan-tyrosine-tryptophan-lysine-cysteine-tryptophan-cysteine-glycine-tryptophan-lysine-tryptophan-lysine-cysteine-glycine-tryptophan-lysine-tyrosine
The complete sequence of the modified G3CY-5 is as follows: cysteine-glycine-tryptophan-lysine-tyrosine (SEQ ID NO: 2). The complete sequence of the modified G3CY-10 is as follows: cysteine-glycine-tryptophan-lysine-histidine-cysteine-glycine-tryptophan-lysine-tyrosine (SEQ ID NO: 3).
Example 4 pharmacological experiments with Gj-CATH3, G3CY-5 and G3 CY-10:
1. and (3) determining the antioxidant activity of Gj-CATH3, G3CY-5 and G3 CY-10:
1.1DPPH radical scavenging Activity (DPPH radial scavenging assay)
Weighing a certain amount of DPPH (2, 2-diphenyl-1-piperidinylhydrazide, Sigma, USA), dissolving with methanol to obtain 6 × 10 solution-5M solution is prepared as it is. The DPPH solution and the sample (2mg/ml) were mixed, left standing at room temperature for 30min in the dark and the absorbance at 517nm was measured. The blank control group replaces the sample to be tested with the sample dissolution medium. The experiment was performed in triplicate, and methanol was used for the uv spectrophotometer zero adjustment.
DPPH.Semitation (%) - (AB-AA)/A B X100 (AB: blank absorbance; AA: sample absorbance).
TABLE 1 Activity of three antioxidant peptides on DPPH radical scavenging (%)
Figure BDA0002204912010000091
As shown in Table 1, the two modifications G3CY-5 and G3CY-10 showed strong antioxidant activity, the I% clearance rate to DPPH free radicals was 61.59% and 70.87% respectively at 40 μ G/ml, and the clearance rate reached more than 90% at action concentration of 80 μ G/ml. In contrast, Gj-CATH3 has a poor effect on scavenging DPPH free radicals, and the clearance is only 28.57% at an action concentration of 80. mu.g/ml.
1.2 ABTS·+Radical cation scavenging Activity
ABTS (3-ethylbenzothiazoline-6-sulfonic acid) was prepared as a 2mM ABTS stock solution in PBS buffer (pH 7.4). ABTS stock solution and 70mM potassium persulfate (K)2S2O8) Mixing the water solutions according to the volume ratio of 250:1, and standing for 15-16h at room temperature in a dark place. ABTS was measured before the start of the experiment·+The absorbance released to a wavelength of 734nm was 0.80. + -. 0.03. Mixing the three antioxidant peptides Gj-CATH3, G3CY-5 and G3CY-10 at different concentrations with 96 μ l of the corrected ABTS·+The solutions were mixed and left at room temperature for 10min, and then the absorbance of the reaction solution was measured at a wavelength of 734 nm. Blank control was sterilized deionized water used to dissolve the samples. The experiment was done in triplicate.
ABTS·+Clearance I (%) - (AB-AA)/AB × 100(AB: blank absorbance; AA: sample absorbance).
TABLE 2 antioxidative peptide Gj-CATH3 vs ABTS·+Radical cation scavenging Activity I (%)
Figure BDA0002204912010000101
TABLE 3 antioxidative peptides G3CY-5 and G3CY-10 vs ABTS·+Positive free radicalIon scavenging Activity I (%)
Figure BDA0002204912010000102
As shown in tables 2 and 3, the three antioxidant peptides all show strong antioxidant activity, and the activity of the three antioxidant peptides is gradually enhanced along with the increase of the concentration of the sample, and the three antioxidant peptides have certain concentration dependence. When the concentration of the sample is 20 mug/ml, the clearance rate I% of ABTS + positive ion free radicals of Gj-CATH3, G3CY-5 and G3CY-10 can reach 32.08%, 100% and 99.36% respectively.
2. Determination of hemolytic Activity of Gj-CATH3, G3CY-5 and G3 CY-10:
mixing collected blood of healthy human with Ashi solution for anticoagulation, washing with normal saline for 2 times, and resuspending into 107-108cell/ml suspension. Mixing the diluted erythrocyte suspension with Gj-CATH3, G3CY-5 and G3CY-10 samples dissolved in normal saline respectively, keeping the temperature at 37 ℃ for 30min, centrifuging at 1000rpm for 5min, and measuring the absorption value of the supernatant at 540 nm. The negative control uses physiological saline, the positive control uses TritonX-100, and the percentage of hemolysis is calculated according to the following formula: percent hemolysis H% ═ a sample-a negative control)/a positive control × 100%.
Experimental results show that the hemolysis rates of the three antioxidant peptides Gj-CATH3, G3CY-5 and G3CY-10 are respectively 2.18%, 1.07% and 2.35% when the concentration is as high as 200 mu G/ml. The three antioxidant peptides do not have hemolytic property to human red blood cells, and the characteristic is more beneficial to the development and application of the three antioxidant peptides in the fields of antioxidant drugs, foods or cosmetics.
Sequence listing
<110> Jining medical college
<120> gecko verrucosa antioxidant peptide and application thereof
<130> 2019
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 42
<212> PRT
<213> Gekko Swinhonis with multiple warts
<400> 1
Arg Arg Gly Phe Phe Lys Pro Tyr Gly Lys Lys Pro Lys Lys Val Ala
1 5 10 15
Lys Lys Pro Tyr Tyr His Cys Gly Trp Lys Tyr Cys Gly Trp Lys Tyr
20 25 30
Cys Gly Trp Lys His Cys Gly Trp Lys Tyr
35 40
<210> 2
<211> 5
<212> PRT
<213> Artificial sequence
<220>
<223> modified body G3CY-5
<400> 2
Cys Gly Trp Lys Tyr
1 5
<210> 3
<211> 10
<212> PRT
<213> Artificial sequence
<220>
<223> modified body G3CY-10
<400> 3
Cys Gly Trp Lys His Cys Gly Trp Lys Tyr
1 5 10
<210> 4
<211> 126
<212> DNA
<213> Gekko Swinhonis with multiple warts
<400> 4
cggagaggct tctttaaacc atatggcaag aaacccaaga aggttgccaa aaagccgtac 60
tatcactgtg gctggaagta ctgtggctgg aagtactgtg gctggaagca ctgtggctgg 120
aagtac 126
<210> 5
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223> PCR amplification primers
<400> 5
atcctgctga tgcttggc 18
<210> 6
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> PCR amplification primers
<400> 6
cggggtacga tgagacacca t 21
<210> 7
<211> 510
<212> DNA
<213> Gekko Swinhonis with multiple warts
<400> 7
atggagggcc ggatcctgct gatgcttggc cttgccatgg cagccacagc tctgtttcct 60
gtaccagagg agctcggcta cgaggaagcc gtttccttgg ctatcgacct ctacaaccaa 120
gagccagggg tggcgtgggc cttccgactc ctggaagcca agccccagcc ggagtgggac 180
cccttgatga aagcccttca gccactggaa ttcaccatgc aggagaccac gtgcccgccc 240
tccaagccgc tgaatctgga cgagtgtgac ttcaagaagg atggggtggt gaaggaatgt 300
tccggaacca tctctcctga taaaggggct cctggtgttg acctcgattg tgaaactgta 360
ggccaggggc gcacccgtgt ccggagaggc ttctttaaac catatggcaa gaaacccaag 420
aaggttgcca aaaagccgta ctatcactgt ggctggaagt actgtggctg gaagtactgt 480
ggctggaagc actgtggctg gaagtactga 510

Claims (5)

1. The anti-oxidant peptide of the gecko verrucosus is a linear polypeptide, and the amino acid sequence of the anti-oxidant peptide is selected from SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3.
2. A polynucleotide encoding the gecko doverrucosus antioxidant peptide of claim 1.
3. A recombinant expression vector comprising the polynucleotide of claim 2.
4. Use of the gecko's antioxidant peptide of claim 1, the polynucleotide of claim 2, or the recombinant expression vector of claim 3 for the preparation of an antioxidant medicament.
5. Use of the gecko's antioxidant peptide of claim 1, the polynucleotide of claim 2, or the recombinant expression vector of claim 3 for preparing an additive for antioxidant cosmetics, foods, and feeds.
CN201910877775.XA 2019-09-17 2019-09-17 Gecko verrucosa antioxidant peptide and application thereof Active CN110590927B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910877775.XA CN110590927B (en) 2019-09-17 2019-09-17 Gecko verrucosa antioxidant peptide and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910877775.XA CN110590927B (en) 2019-09-17 2019-09-17 Gecko verrucosa antioxidant peptide and application thereof

Publications (2)

Publication Number Publication Date
CN110590927A CN110590927A (en) 2019-12-20
CN110590927B true CN110590927B (en) 2022-06-14

Family

ID=68860308

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910877775.XA Active CN110590927B (en) 2019-09-17 2019-09-17 Gecko verrucosa antioxidant peptide and application thereof

Country Status (1)

Country Link
CN (1) CN110590927B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101265296A (en) * 2008-04-08 2008-09-17 中国科学院昆明动物研究所 Reptile cathelicidin antibiotic peptide and derivatives, and application thereof
CN103613645A (en) * 2013-11-26 2014-03-05 大连理工大学 Antioxidant peptide sourced from limnonectes fragilis as well as gene and application thereof
CN105085647A (en) * 2015-09-07 2015-11-25 大连理工大学 Natural peptide Pb-CATH2 having anti-infection and antioxidant functions as well as gene and application of peptide

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101351474A (en) * 2005-12-29 2009-01-21 堪萨斯州立大学研究基金会 Antimicrobial cathelicidin peptides

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101265296A (en) * 2008-04-08 2008-09-17 中国科学院昆明动物研究所 Reptile cathelicidin antibiotic peptide and derivatives, and application thereof
CN103613645A (en) * 2013-11-26 2014-03-05 大连理工大学 Antioxidant peptide sourced from limnonectes fragilis as well as gene and application thereof
CN105085647A (en) * 2015-09-07 2015-11-25 大连理工大学 Natural peptide Pb-CATH2 having anti-infection and antioxidant functions as well as gene and application of peptide

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
"PREDICTED: cathelicidin-2-like [Gekko japonicus]"，NCBI Reference Sequence: XP_015277828.1;no;《GenBank》;20160120;"Definition"、"Organism"、"CDS"、"Origin" *
Cathelicidins PMAP-36, LL-37 and CATH-2 are similar peptides with different modes of action;Maaike R.Scheenstra等;《Scientific Reports》;20190318;第9卷(第1期);第2页第1-2段，第7页第5段 *
Maaike R.Scheenstra等.Cathelicidins PMAP-36, LL-37 and CATH-2 are similar peptides with different modes of action.《Scientific Reports》.2019,第9卷(第1期), *
no."PREDICTED: cathelicidin-2-like [Gekko japonicus]"，NCBI Reference Sequence: XP_015277828.1.《GenBank》.2016, *
Snake cathelicidin from bungarus fasciatus is a potent peptide antibiotics;Yipeng Wang等;《Plos One》;20080930;第3卷(第9期);第1页右栏最后一段-第2页左栏第1段，第4页右栏最后一段，图1、2 *
Yipeng Wang等.Snake cathelicidin from bungarus fasciatus is a potent peptide antibiotics.《Plos One》.2008,第3卷(第9期), *
日本鳗鲡 I 型 Cathelicidin 基因的克隆与原核表达;张东玲等;《生物技术通报》;20151231;第31卷(第7期);124-131 *

Also Published As

Publication number Publication date
CN110590927A (en) 2019-12-20

Similar Documents

Publication Publication Date Title
Weng et al. Antioxidant properties of fractions isolated from blue shark (Prionace glauca) skin gelatin hydrolysates
CN106188265B (en) A kind of antimicrobial peptide Cm-CATH2 and its gene, preparation method and application
Luo et al. Isolation and identification of antioxidant peptides from tartary buckwheat albumin (Fagopyrum tataricum Gaertn.) and their antioxidant activities
WO1987001038A1 (en) Peptide analogues of mammalian insulin-like growth factor-1
DK161048B (en) METHOD OF MANUFACTURING HUMANT INTERFERON
CN105624247B (en) Preparation method of Nrf2-ARE pathway activator in tuna high-F-value oligopeptide
CN111647043B (en) Oligopeptide with platelet resisting and antithrombotic functions containing Hyp-Gly sequence
CN103613645B (en) Antioxidant peptide sourced from limnonectes fragilis as well as gene and application thereof
CN110240630B (en) Natural oligopeptide with liver cell oxidative damage protection effect
CN112661811B (en) Antihypertensive peptide, long-acting antihypertensive peptide and preparation method thereof
CN104497119A (en) Natural antibacterial peptide and application thereof
CN110590927B (en) Gecko verrucosa antioxidant peptide and application thereof
CN113151388B (en) Sea cucumber peptide with antioxidant and DPP-IV (dipeptidyl peptidase IV) inhibiting functions and preparation method thereof
CN102786583B (en) Rana kunyuensis modified antibacterial peptides as well as preparation method and application of rana kunyuensis kunyuenin kunyuenin-3
CN105037498B (en) Derived from the anti-oxidation peptide and its gene of the Wuyi rapids frog and application
CN109748951B (en) Angelica sinensis antioxidant polypeptide and preparation method and application thereof
CN108191958B (en) Linseed meal antioxidant hexapeptide and preparation method and application thereof
CN111235156B (en) Immune regulatory peptide derived from rana huashanensis and application of gene thereof in skin photodamage protection
CN113943346B (en) Antihypertensive peptide of spirulina and application
CN112375132B (en) Antibacterial peptide derived from Taihu whitefish and application thereof
CN103193876B (en) Rana margaretae antioxidation peptide odorranain-H-OM, gene with coding sequence of rana margaretae antioxidation peptide odorranain-H-OM, and application of rana margaretae antioxidation peptide odorranain-H-OM
CN103193866B (en) Odorranawuchuanensis antioxidant peptide wuchuanin-B2 and gene and application of coding sequence thereof
CN103172720B (en) Rana wuchuanensis antioxidant peptide wuchuanin-G, gene of coded sequence thereof and application of rana wuchuanensis antioxidant peptide wuchuanin-G
CN102796176B (en) Kunyuenin, preparation method and application
CN109438556B (en) Active peptide, recombinant vector, recombinant cell, anti-inflammatory composition, and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant