CN110564763B - Genetic transformation method for populus alba - Google Patents
Genetic transformation method for populus alba Download PDFInfo
- Publication number
- CN110564763B CN110564763B CN201910967371.XA CN201910967371A CN110564763B CN 110564763 B CN110564763 B CN 110564763B CN 201910967371 A CN201910967371 A CN 201910967371A CN 110564763 B CN110564763 B CN 110564763B
- Authority
- CN
- China
- Prior art keywords
- culture
- medium
- genetic transformation
- liquid
- transformation method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Developmental Biology & Embryology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Environmental Sciences (AREA)
- Botany (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides a genetic transformation method of populus alba, and relates to the technical field of genetic transformation. The invention transfers the target gene into the body of the populus alba by an agrobacterium infection method, and obtains a positive plant in a short time. In the present example, genetic transformation of Populus alba was carried out using a β -glucuronidase Gene (GUS) as a reporter gene, and a large amount of transgenic Populus alba could be obtained in a short time. The genetic transformation method of the populus alba solves the problem that the existing genetic transformation method of the populus alba is not suitable for genetic transformation of the populus alba, can greatly improve the transformation efficiency of the populus alba, and effectively shortens the transformation time.
Description
Technical Field
The invention belongs to the technical field of genetic transformation, and particularly relates to a genetic transformation method of populus alba.
Background
Populus alba (Pop. mu.L. mu.s abla L.) is widely distributed in the West basin of Mediterranean, in Europe, eastern Europe and in Valley of Central Asia. The trees are mainly distributed in southern Liaodong, Shaanxi, Ningxia, Gansu, Shanxi, Qinghai, Xinjiang, Tibet and the like in China, have many excellent characteristics of drought resistance, wind resistance, cold resistance, long service life, straight dry shape, good material quality, tall and big tree shape, attractive appearance and the like, are main afforestation tree species of Qinghai-Tibet plateau and northwest loess plateau, and are often used for farmland protection, road greening, control of wasteland, building materials and firewood, furniture, carved patterns and the like. In the 80 s of the 20 th century, the research on the tissue culture and rapid propagation technology of populus alba is started in China, and important progress is made. However, the researches on the transformation system of the populus alba are not mature at present, and particularly, the existing poplar transgenic scheme is not suitable for the transgenic of the populus alba.
Disclosure of Invention
In view of the above, the present invention aims to provide a genetic transformation method for populus alba, which solves the problem that the existing genetic transformation method for populus alba is not suitable for genetic transformation of populus alba, can greatly improve the transformation efficiency of populus alba, and effectively shortens the transformation time.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a genetic transformation method of populus alba, which comprises the following steps: (1) taking leaves and stem segments of the populus alba aseptic tissue culture seedling as explants, and soaking the explants in an infection bacterial solution to obtain infected explants; the infection bacterial liquid is activated agrobacterium liquid carrying recombinant plasmids;
(2) after the infected explant surface liquid is sucked dry, the explant surface liquid is laid on a CM1 culture medium for dark culture for 2d, and then the explant surface liquid is transferred to a CM2 culture medium for dark culture for 4-5 weeks to obtain callus; the CM1 medium contained the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, acetosyringone 100. mu. mol/L, zeatin 10mg/L, NAA1mg/L and agar 6 g/L; the CM2 medium contained the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, zeatin 10mg/L, NAA1mg/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L;
(3) inoculating the callus on a CM3 culture medium for induction culture to obtain adventitious buds; the CM3 medium included the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, zeatin 10mg/L, NAA 0.1.1 mg/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L;
(4) inoculating the adventitious bud on a CM4 culture medium to carry out adventitious bud development culture to obtain a rootless seedling; the CM4 medium contained the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, 6-BA 0.5mg/L, NAA 0.1.1 mg/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L;
(5) inoculating the rootless seedling on a CM5 culture medium for rooting culture to obtain a transgenic seedling; the CM5 culture included the following concentrations of starting materials: 1/2MS 2.47g/L, IBA 0.5.5 mg/L, sucrose 15g/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L.
Preferably, leaves and stem segments of the sterile tissue culture populus alba seedlings for 3-5 weeks are selected as explants in the step (1), the leaves are small blocks with the side length of 0.4-0.6 cm, and the length of the stem segments is 0.4-0.6 cm.
Preferably, OD of the infected bacterial liquid in the step (1)6000.4 to 0.6.
Preferably, the preparation method of the infection bacterial liquid comprises the following steps: A. carrying out streak culture on agrobacterium carrying recombinant plasmid on a YEB plate culture medium to obtain a single colony; the YEB plate culture medium contains 50mg/L kanamycin and 50mg/L rifampicin;
B. the single colonies were subjected to the following 1 single colony: inoculating 5mLYEB in liquid culture medium, and shake culturing to OD6000.7-0.9, and obtaining expanded strains; the YEB liquid culture medium contains 50mg/L kanamycin and 50mg/L rifampicin;
C. inoculating the expanded strain in YEB non-antibiotic liquid culture medium, and shake culturing to OD6000.7-0.9, and obtaining activated bacterial liquid; the volume ratio of the expanded strain to the YEB non-resistant liquid culture medium is 1 mu L: 1 mL;
D. centrifuging the activated bacteria liquid, and collecting thalli;
E. re-suspending the thalli by using a WPM heavy suspension, and performing shake culture for 1-2 hours to obtain the infection bacterial liquid; the WPM heavy suspension comprises the following raw materials in concentration: WPM 2.41g/L, sucrose 30g/L and acetosyringone 100. mu. mol/L.
Preferably, the temperature of the shaking culture in steps B, C and E is 28 ℃ and the rotation speed is 180 rpm.
Preferably, the dark culture performed in step (2) on CM1 medium and CM2 medium are both at 25 ℃; during dark culture on the CM2 medium, the CM2 medium was changed every 10-14 days.
Preferably, the temperature of the induction culture in the step (3) is 25 ℃, the light cycle is 16h under light, 8h under dark condition, and the light intensity is 2000 lx.
Preferably, the temperature for development and culture of the adventitious bud in the step (4) is 25 ℃, the light cycle is 16h under light, 8h under dark condition, and the light intensity is 2000 lx.
Preferably, the height of the rootless seedlings in the step (5) is 1.8-2.5 cm.
Preferably, the temperature of the rooting culture in the step (5) is 25 ℃, the light cycle is 16h under illumination, the light is kept out for 8h, and the illumination intensity is 2000 lx.
The invention provides a genetic transformation method of populus alba, which is characterized in that a target gene is transferred into the body of the populus alba by an agrobacterium infection method, and a positive plant is obtained in a short time. The method divides the bud culture into two stages, firstly uses Zeatin (ZT) to induce the generation of adventitious buds at the early stage, and then uses 6-BA to induce the development of the adventitious buds at the later stage, and the two hormones are matched for use, so that the conversion time of the populus alba can be greatly shortened. In the present example, genetic transformation of Populus alba was carried out using a β -glucuronidase Gene (GUS) as a reporter gene, and a large amount of transgenic Populus alba could be obtained in a short time. The genetic transformation method of the populus alba solves the problem that the existing genetic transformation method of the populus alba is not suitable for genetic transformation of the populus alba, can greatly improve the transformation efficiency of the populus alba, and effectively shortens the transformation time.
Drawings
FIG. 1 is a culture diagram of explants on CM1 medium after infection;
FIG. 2 is a diagram of callus formation on CM2 medium;
FIG. 3 is a diagram of callus induced differentiation adventitious buds on CM3 medium;
FIG. 4 is a graph of adventitious bud development on CM4 medium;
FIG. 5 is a diagram of rootless seedling rooting on CM5 medium;
FIG. 6 is a diagram showing the result of PCR detection of a transgenic plant;
FIG. 7 is a GUS staining result chart of transgenic plants.
Detailed Description
The invention provides a genetic transformation method of populus alba, which comprises the following steps: (1) taking leaves and stem segments of the populus alba aseptic tissue culture seedling as explants, and soaking the explants in an infection bacterial solution to obtain infected explants; the infection bacterial liquid is activated agrobacterium liquid carrying recombinant plasmids;
(2) after the infected explant surface liquid is sucked dry, the explant surface liquid is laid on a CM1 culture medium for dark culture for 2d, and then the explant surface liquid is transferred to a CM2 culture medium for dark culture for 4-5 weeks to obtain callus; the CM1 medium contained the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, acetosyringone 100. mu. mol/L, zeatin 10mg/L, NAA1mg/L and agar 6 g/L; the CM2 medium contained the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, zeatin 10mg/L, NAA1mg/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L;
(3) inoculating the callus on a CM3 culture medium for induction culture to obtain adventitious buds; the CM3 medium included the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, zeatin 10mg/L, NAA 0.1.1 mg/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L;
(4) inoculating the adventitious bud on a CM4 culture medium to carry out adventitious bud development culture to obtain a rootless seedling; the CM4 medium contained the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, 6-BA 0.5mg/L, NAA 0.1.1 mg/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L;
(5) inoculating the rootless seedling on a CM5 culture medium for rooting culture to obtain a transgenic seedling; the CM5 culture included the following concentrations of starting materials: 1/2MS 2.47g/L, IBA 0.5.5 mg/L, sucrose 15g/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L.
The genetic transformation method of the populus alba takes leaves and stem sections of aseptic tissue culture seedlings of the populus alba as explants, and the explants are soaked in an infecting bacterial solution to obtain the infected explants; the infection bacterial liquid is activated agrobacterium liquid carrying recombinant plasmids. The leaves and stem segments of the invention are preferably derived from the poplar sterile tissue culture seedlings of 3-5 weeks, and more preferably derived from the poplar sterile tissue culture seedlings of 4 weeks. The invention preferably processes the leaves and stem segments of the aspen sterile tissue culture seedling, and comprises the steps of cutting the leaves into small pieces and cutting the stem segments into small segments. The side length of the small block is preferably 0.4-0.6 cm, and more preferably 0.5 cm. The length of the small section is preferably 0.4-0.6 cm, and more preferably 0.5 cm.
According to the invention, the explant is soaked in the infection bacterial liquid, and the soaking time is preferably 10-15 min. The preparation method of the infection bacterial liquid preferably comprises the following steps: A. carrying out streak culture on agrobacterium carrying recombinant plasmid on a YEB plate culture medium to obtain a single colony; the YEB plate culture medium contains 50mg/L kanamycin and 50mg/L rifampicin;
B. the single colonies were subjected to the following 1 single colony: inoculating 5mLYEB in liquid culture medium, and shake culturing to OD6000.7-0.9, and obtaining expanded strains; the YEB liquid culture medium contains 50mg/L kanamycin and 50mg/L rifampicin;
C. inoculating the expanded strain in YEB non-antibiotic liquid culture medium, and shake culturing to OD6000.7-0.9, and obtaining activated bacterial liquid; the volume ratio of the expanded strain to the YEB non-resistant liquid culture medium is 1 mu L: 1 mL;
D. centrifuging the activated bacteria liquid, and collecting thalli;
E. re-suspending the thalli by using a WPM heavy suspension, and performing shake culture for 1-2 hours to obtain the infection bacterial liquid; the WPM heavy suspension comprises the following raw materials in concentration: WPM 2.41g/L, sucrose 30g/L and acetosyringone 100. mu. mol/L.
When the infection bacterial liquid is prepared, agrobacterium carrying recombinant plasmid is streaked and cultured on a YEB plate culture medium to obtain a single colony; the YEB plate culture medium contains 50mg/L kanamycin and 50mg/L rifampicin. In the present invention, there is no particular limitation on the recombinant plasmid carried by said agrobacterium, and there is no limitation on the target gene on the recombinant plasmid, in the examples of the present invention, for convenience of description, the GUS gene is used for testing, but the gene is not regarded as the protection scope of the present invention. The method of streaking culture in the present invention is not particularly limited, and a conventional streaking culture method in the art may be used. The temperature of streaking culture according to the present invention is preferably 28 ℃ until a single colony is obtained.
After obtaining the single colony, the invention makes the single colony according to 1 single colony: inoculating 5mLYEB in liquid culture medium, and shake culturing to OD6000.7-0.9, and obtaining expanded strains; the YEB liquid culture medium contains 50mg/L kanamycin and 50mg/L rifampicin. The temperature of the shake culture is preferably 28 ℃, and the rotating speed is preferably 180 rpm. The OD of the expanded strain of the present invention600Preferably 0.8.
After obtaining the expanded strain, the invention inoculates the expanded strain in YEB non-antibiotic liquid culture medium, and the shake culture is carried out until OD6000.7-0.9, and obtaining activated bacterial liquid; the volume ratio of the expanded strain to the YEB non-resistant liquid culture medium is 1 mu L: 1 mL. The temperature of the shake culture is preferably 28 ℃, and the rotating speed is preferably 180 rpm. The OD of the expanded strain of the present invention600Preferably 0.8.
After the activated bacterial liquid is obtained, the activated bacterial liquid is centrifuged, and thalli are collected. The centrifugation is preferably carried out at 4 ℃ in the present invention, the rotation speed of the centrifugation is preferably 4000rpm, and the time of the centrifugation is preferably 10 min.
After obtaining the thalli, re-suspending the thalli by using WPM heavy suspension, and performing shake culture for 1-2 hours to obtain the infection bacterial liquid; the WPM heavy suspension comprises the following raw materials in concentration: WPM 2.41g/L, sucrose 30g/L and acetosyringone 100. mu. mol/L. The amount of the WPM resuspension is not particularly limited in the present invention. The temperature of the shake culture is preferably 28 ℃, and the rotating speed is preferably 180 rpm. The OD of the expanded strain of the present invention600Preferably 0.4 to 0.6. After the infectious bacterium liquid is obtained, the infectious bacterium liquid is preferably stored on ice.
After obtaining the infected explant, after sucking off the surface liquid of the infected explant, flatly paving the surface liquid on a CM1 culture medium for dark culture for 2 days, and transferring the surface liquid to a CM2 culture medium for dark culture for 4-5 weeks to obtain a callus; the CM1 medium contained the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, acetosyringone 100. mu. mol/L, zeatin 10mg/L, NAA1mg/L and agar 6 g/L; the CM2 medium contained the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, zeatin 10mg/L, NAA1mg/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L. Preferably, sterile filter paper is used for sucking dry the infected explant surface liquid, and then the explant surface liquid is spread on a CM1 culture medium for dark culture for 2d and then transferred to a CM2 culture medium for dark culture for 4-5 weeks. The temperature of the dark culture performed on the CM1 medium and the CM2 medium of the present invention is preferably 25 ℃ each. In the present invention, the CM2 medium is preferably replaced every 10 to 14 days during the dark culture on the CM2 medium. In the invention, the two dark culture processes are respectively the generation and development processes of the adventitious bud, Zeatin (ZT) is beneficial to the induction generation of the adventitious bud, 6-BA is beneficial to the development of the adventitious bud, and the transformation time of the populus alba can be greatly shortened under the combined action of ZT and 6-BA. The source and the preparation method of each raw material in the CM1 culture medium and the CM2 culture medium are not particularly limited, the conventional reagents in the field are utilized, when the culture medium is prepared, the pH value of the culture medium is preferably adjusted to 5.80-6.00, then agar is added, sterilization is carried out at 121 ℃ for 20min, and antibiotics and non-high temperature resistant hormones are added after sterilization.
After obtaining the callus, inoculating the callus on a CM3 culture medium for induction culture to obtain adventitious buds; the CM3 medium included the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, zeatin 10mg/L, NAA 0.1.1 mg/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L. The temperature of the induction culture is preferably 25 ℃, the light cycle is 16h under illumination, the light is kept out for 8h, and the illumination intensity is 2000 lx. The time for induction culture is preferably 3-4 weeks.
After obtaining the adventitious bud, inoculating the adventitious bud on a CM4 culture medium to carry out adventitious bud development culture to obtain a rootless seedling; the CM4 medium contained the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, 6-BA 0.5mg/L, NAA 0.1.1 mg/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L. The temperature of the development culture of the adventitious bud is preferably 25 ℃, the photoperiod is 16h under illumination, 8h under dark condition, and the illumination intensity is 2000 lx. The development and culture time of the adventitious bud is preferably 3-4 weeks.
After obtaining the rootless seedling, inoculating the rootless seedling on a CM5 culture medium for rooting culture to obtain a transgenic seedling; the CM5 culture included the following concentrations of starting materials: 1/2MS 2.47g/L, IBA0.5mg/L, sucrose 15g/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L. In the present invention, when the adventitious bud grows to about 2CM, the bud is cut off and transferred to a CM5 medium to induce the production of an adventitious root. The conditions for rooting culture are preferably 25 ℃, the photoperiod is 16h under illumination, 8h under dark condition and the illumination intensity is 2000 lx.
The genetic transformation method of Populus alba provided by the present invention will be described in detail with reference to the following examples, but they should not be construed as limiting the scope of the present invention.
1. An experiment preparation stage:
1) plant material: selecting leaves and stem sections of the aseptic tissue culture seedlings growing to the bottle mouth;
2) experimental reagent: sucrose (Sucrose), Agar powder (Agar), Acetosyringone (AS), Zeatin (ZT), naphthylacetic acid (NAA), 6-benzylaminopurine (6-BA), indoleacetic acid (IBA), cephamycin (Cef), hygromycin (Hyg), kanamycin (Kan), rifampicin (Rif), Woody Plant basic Medium with vitamins (WPM), Yeast Extract Mannitol Broth (YEB), 1/2MS Medium (1/2 MS);
3) an experimental instrument: a constant temperature incubator at 28 ℃, a shaking table at 28 ℃, an ultra-clean bench and an ultraviolet spectrophotometer;
4) preparation work: pre-sterilizing a test tube, a test tube plug, a 1.5mL Ep tube, a 250mL conical flask, scissors, tweezers, filter paper and the like;
5) preparing a culture medium: the formula is shown in table 1, and agar powder is added after the pH values of all culture media are 5.80-6.00 during preparation, and the culture media are sterilized for 20 minutes at 121 ℃. And adding antibiotics and hormone which does not resist high temperature after sterilization.
TABLE 1 culture Medium formulation
Example 1
Transferring GUS gene into Populus alba body:
1. GUS gene (GenBank: MG687280.1) is connected to delta pCAMBIA1302 vector, the delta pCAMBIA1302 vector is a novel binary expression vector modified by the traditional pCAMBIA1302, and the delta pCAMBIA1302 vector mainly replaces the constitutive CaMV35S promoter (CaMV35S-P) (538bp) and reporter gene GFP on the original T-DNA segment on the pCAMBIA1302 vector by a CaMV35S promoter (CaMV35S-P) (835bp) and a multiple cloning site (42 bp). The recombinant gene was transferred into DH10B E.coli competence. After the sequencing is correct, plasmids are extracted and transferred into EHA105 agrobacterium-infected cells by an electric shock transformation method.
2. Agrobacterium carrying the recombinant plasmid (EHA105) was streaked on YEB (50mg/L Kan +50mg/L Rif) plates, cultured at 28 ℃ and single colonies appeared after 2 days.
3. And selecting a single colony for colony PCR, inoculating the single colony into 1mL of YEB (50mg/L Kan +50mg/LRif) liquid culture medium, sequencing a PCR product, preserving bacteria after a sequencing result is correct, and directly shaking the bacteria in a subsequent transformation experiment.
4. Inoculating 50 μ L of the bacterial solution into 5mLYEB (50mg/L Kan +50mg/L Rif) liquid culture medium, culturing at 28 deg.C and 180rpm under shaking for 30 hr, and determining OD600＝0.773。
5. 200 mu L of bacterial liquid is taken to be put into 200mL of fresh YEB antibiotic-free liquid culture medium, 28 ℃, and OD is obtained after shaking culture at 180rpm for 15 hours6000.682. At this time, 200mL of the bacterial suspension was dispensed into 4 50mL centrifuge tubes on an ultra-close bench, centrifuged at 4000rpm at 4 ℃ for 10min, and the cells were collected at the bottom of the tubes.
6. Adding 35mLWPM heavy suspension into each centrifuge tube to resuspend the thalli, and performing shake culture at 28 ℃ for 2h to obtain OD600At 0.586 point, the inoculum was kept on ice for infestation.
7. Selecting tissue culture seedling of Populus alba growing for about 4 weeks, taking 4-5 th leaf with downward stem top and stem section with 2-4 nd node with downward stem top, cutting leaf into small pieces with side length of 0.5cm, cutting stem section into small sections with 0.5cm, soaking in the bacterial solution prepared in the last step, and infecting for 15 min.
8. The bacterial solution on the surface of the leaf and stem sections was blotted with sterile filter paper, spread on CM1 medium, and cultured in the dark at 25 ℃ for two days as shown in FIG. 1.
9. After dark culture for two days, the leaf and stem sections were transferred to CM2 medium and dark culture was carried out at 25 ℃ with medium replacement every 10-14 days. At 4 weeks, pale yellow callus clusters appeared on most of the leaf and stem margins, as shown in FIG. 2. At this point it was transferred to CM3 medium under the following conditions: the light intensity is 2000lx, the temperature is 25 ℃, the light period is 16h, and the light is 8 h. Adventitious buds appeared as shown in FIG. 3 at 3 weeks. Transferring the callus with adventitious buds to CM4 culture medium under the following conditions: the light intensity is 2000lx, the temperature is 25 ℃, the light period is 16h, and the light is 8 h. After 3 weeks of culture, a few adventitious buds grew to around 2cm, as shown in FIG. 4. This was cut off and transferred to CM5 medium to induce adventitious roots. After 2 weeks adventitious roots began to appear as shown in figure 5. When the root system is developed, the plant is transplanted to a greenhouse for soil culture.
10. Detection of transgenic plants
1) Detecting whether exogenous gene GUS is integrated into the genome of populus alba
Extracting genomic DNA of the poplar transgenic candidate positive plant as a template, performing PCR amplification by using a primer (p1302OE-JC1/p1302OE-JC2) and detecting whether the GUS gene is integrated into the poplar genome. Primers p1302OE-JC1/p1302OE-JC2 are positioned at two sides of the multi-cloning site of the delta pCAMBIA1302 vector, and whether an LB-RB segment containing a GUS gene is integrated on the genome of the populus alba is detected, wherein the sequences are respectively as follows:
p1302OE-JC1：TTATTGTGAAGATAGTGGAAAAGG；
p1302OE-JC 2: CAAGACCGGCAACAGGATT are provided. The results of the detection are shown in FIG. 6.
2) Histochemical staining of GUS gene
The specific method comprises the following steps: and (3) taking a newly grown leaf at the stem tip of the transgenic candidate positive plant, putting the leaf into a 1.5mL Ep tube, adding GUS dye solution, standing for about 2h at the constant temperature of 37 ℃, sufficiently dyeing the solution, decolorizing with 75% ethanol, and observing under a stereoscope. The plant leaves can be dyed into specific blue by GUS dye liquor, and the plants are positive for transgenosis.
The GUS dye solution comprises: 0.1mol/LK3Fe(CN)6，0.1mol/L K4Fe(CN)6，0.01mol/L Na2EDTA, 500mg/L X-Gluc, 1% Triton X-100(v/v), 0.14mol/L sodium phosphate buffer (pH 7.0).
The invention provides a genetic transformation method of populus alba, which solves the problem that the existing genetic transformation method of populus alba is not applicable to genetic transformation of populus alba, greatly improves the transformation efficiency of populus alba, and effectively shortens the transformation time.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Claims (10)
1. A genetic transformation method of populus alba comprises the following steps: (1) taking leaves and stem segments of the populus alba aseptic tissue culture seedling as explants, and soaking the explants in an infection bacterial solution to obtain infected explants; the infection bacterial liquid is activated agrobacterium liquid carrying recombinant plasmids;
the leaves are 4 th to 5 th leaves with the downward stem top;
(2) after the infected explant surface liquid is sucked dry, the explant surface liquid is laid on a CM1 culture medium for dark culture for 2d, and then the explant surface liquid is transferred to a CM2 culture medium for dark culture for 4-5 weeks to obtain callus; the CM1 medium contained the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, acetosyringone 100. mu. mol/L, zeatin 10mg/L, NAA1mg/L and agar 6 g/L; the CM2 medium contained the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, zeatin 10mg/L, NAA1mg/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L;
(3) inoculating the callus on a CM3 culture medium for induction culture to obtain adventitious buds; the CM3 medium included the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, zeatin 10mg/L, NAA 0.1.1 mg/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L;
(4) inoculating the adventitious bud on a CM4 culture medium to carry out adventitious bud development culture to obtain a rootless seedling; the CM4 medium contained the following concentrations of starting materials: WPM 2.41g/L, sucrose 30g/L, 6-BA 0.5mg/L, NAA 0.1.1 mg/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L;
(5) inoculating the rootless seedling on a CM5 culture medium for rooting culture to obtain a transgenic seedling; the CM5 medium contained the following concentrations of starting materials: 1/2MS 2.47g/L, IBA 0.5.5 mg/L, sucrose 15g/L, cefamycin 400mg/L, hygromycin 10mg/L and agar 6 g/L.
2. The genetic transformation method according to claim 1, wherein leaf pieces and stem pieces of the sterile tissue-cultured populus alba seedlings for 3-5 weeks are selected as explants in the step (1), wherein the leaf pieces are small pieces with the side length of 0.4-0.6 cm, and the stem pieces are 0.4-0.6 cm in length.
3. The genetic transformation method according to claim 1, wherein OD of the invader solution in step (1)6000.4 to 0.6.
4. The genetic transformation method according to claim 1 or 3, wherein the preparation method of the infection bacterial liquid comprises the following steps: A. carrying out streak culture on agrobacterium carrying recombinant plasmid on a YEB plate culture medium to obtain a single colony; the YEB plate culture medium contains 50mg/L kanamycin and 50mg/L rifampicin;
B. the single colonies were subjected to the following 1 single colony: inoculating 5mL YEB liquid culture medium in proportion, and shake culturing to OD6000.7-0.9, and obtaining expanded strains; the YEB liquid culture medium contains 50mg/L kanamycin and 50mg/L rifampicin;
C. inoculating the expanded strain in YEB non-antibiotic liquid culture medium, and shake culturing to OD6000.7-0.9, and obtaining activated bacterial liquid; the volume ratio of the expanded strain to the YEB non-resistant liquid culture medium is 1 mu L: 1 mL;
D. centrifuging the activated bacteria liquid, and collecting thalli;
E. re-suspending the thalli by using a WPM heavy suspension, and performing shake culture for 1-2 hours to obtain the infection bacterial liquid; the WPM heavy suspension comprises the following raw materials in concentration: WPM 2.41g/L, sucrose 30g/L and acetosyringone 100. mu. mol/L.
5. The genetic transformation method according to claim 4, wherein the temperature of the shake culture in steps B, C and E is 28 ℃ and the rotation speed is 180 rpm.
6. The genetic transformation method according to claim 1, wherein the dark culture performed in step (2) on CM1 medium and CM2 medium is performed at 25 ℃ each; during dark culture on the CM2 medium, the CM2 medium was changed every 10-14 days.
7. The genetic transformation method according to claim 1, wherein the temperature of the induction culture in step (3) is 25 ℃, the photoperiod is 16h under light, the photoperiod is 8h under dark condition, and the light intensity is 2000 lx.
8. The genetic transformation method according to claim 1, wherein the temperature for development and culture of the adventitious bud in the step (4) is 25 ℃, the photoperiod is 16h under light, the photoperiod is 8h under dark condition, and the light intensity is 2000 lx.
9. The genetic transformation method according to claim 1, wherein the height of the non-rooted seedling in the step (5) is 1.8 to 2.5 cm.
10. The genetic transformation method according to claim 1, wherein the temperature of the rooting culture in step (5) is 25 ℃, the photoperiod is 16h under light, the photoperiod is 8h under dark condition, and the light intensity is 2000 lx.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910967371.XA CN110564763B (en) | 2019-10-12 | 2019-10-12 | Genetic transformation method for populus alba |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910967371.XA CN110564763B (en) | 2019-10-12 | 2019-10-12 | Genetic transformation method for populus alba |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110564763A CN110564763A (en) | 2019-12-13 |
| CN110564763B true CN110564763B (en) | 2021-01-29 |
Family
ID=68784522
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910967371.XA Active CN110564763B (en) | 2019-10-12 | 2019-10-12 | Genetic transformation method for populus alba |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110564763B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111041044A (en) * | 2019-12-31 | 2020-04-21 | 中国林业科学研究院亚热带林业研究所 | Genetic transformation and transgenic plant regeneration method for triploid Chinese white poplar |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103636498A (en) * | 2013-11-29 | 2014-03-19 | 黑龙江省林业科学研究所 | Populus alba * pobulus davidiana dode 1333 tissue culture medium of pobulus davidiana dode improved variety |
-
2019
- 2019-10-12 CN CN201910967371.XA patent/CN110564763B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103636498A (en) * | 2013-11-29 | 2014-03-19 | 黑龙江省林业科学研究所 | Populus alba * pobulus davidiana dode 1333 tissue culture medium of pobulus davidiana dode improved variety |
Non-Patent Citations (3)
| Title |
|---|
| Adventitious shoot regeneration from leaf, petiole and root explants in triploid (Populus alba × P. glandulosa)× P. tomentosa;Qingqing Zeng et al;《Plant Cell, Tissue and Organ Culture》;20190406;121–130 * |
| 转rolB pttGA20ox 双价基因提高银白杨生根能力及生长速度的研究;李伟等;《北京林业大学学报》;20090530;第31卷(第2期);92-95 * |
| 银白杨叶片不定芽再生影响因素的研究;李慧等;《北京林业大学学报》;20040530;第26卷(第3期);46-50 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110564763A (en) | 2019-12-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Pan et al. | Agrobacterium tumefaciens-mediated transformation of biofuel plant Jatropha curcas using kanamycin selection | |
| CN108300735B (en) | Efficient lilium tenuifolia genetic transformation system based on somatic embryogenesis | |
| CN105543278B (en) | Dangshan pear genetic transformation method | |
| CN102485897A (en) | Method for changing petal colors by using cotton gene GbF3H | |
| CN108707624B (en) | Method for inducing and culturing hairy roots of macleaya cordata by utilizing agrobacterium rhizogenes and application | |
| CN110564763B (en) | Genetic transformation method for populus alba | |
| CN109182375B (en) | Genetic transformation method of German iris | |
| CN107475287B (en) | Eggplant genetic transformation method | |
| CN105755037A (en) | Agrobacterium-mediated rapid genetic transformation method for japonica rice | |
| CN112553248A (en) | Establishment method and genetic transformation method of Miscanthus stramineus genetic transformation system | |
| CN117070557A (en) | Rapid and efficient agrobacterium-mediated iris seed genetic transformation method | |
| CN108901844B (en) | Method for constructing lycoris genus genetic transformation system | |
| CN112889668B (en) | Populus genetic transformation method | |
| CN113755521B (en) | Construction method of agrobacterium-mediated strawberry 'sweet Charles' genetic transformation system | |
| CN113025645B (en) | Method for obtaining gypsophila transgenic plant by taking callus as receptor | |
| US7026529B2 (en) | Methods for Agrobacterium-mediated transformation of dandelion | |
| CN111778273B (en) | Dioscorea composita transgenic hairy root induction method | |
| CN115011634A (en) | Genetic transformation method for promoting wild jujube callus to form adventitious buds by using phytoplasma effector SJP 1and SJP2 | |
| Chen et al. | Eucalyptus | |
| CN110699377A (en) | Peanut transgenic method | |
| Lawrenson et al. | Highly efficient gene knockout in medicago truncatula genotype R108 using CRISPR-Cas9 system and an optimized agrobacterium transformation method | |
| CN106518992B (en) | Sclerotinia heterokaryon-incompatible YD-7 protein and coding gene and application thereof | |
| Jin et al. | In vitro plant regeneration and hairy roots induction in Dioscorea alata (cultivar Wenshanyao). | |
| NL2035132B1 (en) | GENETIC TRANSFORMATION METHOD OF E. UROPHYLLA x E. GRANDIS DH3213 | |
| CN115399240B (en) | Tissue culture medium, populus female plant regeneration system and method for establishing transgenic plant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |